Next Article in Journal
A Bioregionalization of South Africa Based on Beetles (Coleoptera)
Next Article in Special Issue
Fishing for Estuarine Oomycetes
Previous Article in Journal
The Effects of Termites and Beetle Larvae on the Decomposition of Pinus densiflora and Quercus acutissima in South Korea over a 6-Year Period
Previous Article in Special Issue
Genome-Based Classification of Pedobacter albus sp. nov. and Pedobacter flavus sp. nov. Isolated from Soil
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Diversity
Volume 16
Issue 8
10.3390/d16080453
diversity-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Diversity of Endophytic Fungi and Bacteria Inhabiting the Roots of the Woodland Grass, Festuca gigantea (Poaceae)

by
Izolda Pašakinskienė
1,2,*,
Violeta Stakelienė
1,2,
Saulė Matijošiūtė
1,2 and
Justas Martūnas
1
1
Botanical Garden of Vilnius University, Kairėnų 43, 10239 Vilnius, Lithuania
2
Life Sciences Centre, Vilnius University, Saulėtekio 7, 10221 Vilnius, Lithuania
*
Author to whom correspondence should be addressed.
Diversity 2024, 16(8), 453; https://doi.org/10.3390/d16080453
Submission received: 17 June 2024 / Revised: 25 July 2024 / Accepted: 25 July 2024 / Published: 1 August 2024
(This article belongs to the Special Issue Microbial Diversity and Culture Collections Hotspots in 2024)
Browse Figures
Versions Notes

Abstract

:
We studied the occurrence of endophytic fungi and bacteria in the roots of F. gigantea, a woodland perennial grass common throughout Europe and temperate Asia. The taxonomic assignment was carried out according to the isolate’s colony and cytological species morphotype characteristics and confirmed by the assessment of the standard DNA sequences, ITS, RPB2, SSU, and TEF1-a for fungi and 16S rDNA for bacteria. Our study has shown that F. gigantea roots are the habitat to a wide range of fungi and bacteria. The occurrence of fungal structures was determined in ~40% of the roots examined by Trypan Blue staining. In a surface-sterile root-cutting culture on PDA medium, we obtained isolates of six endophytic fungi species: four members of Ascomycota—Alternaria alternata, Cadophora fastigiata, Chaetomium funicola, and Microdochium bolleyi—and two of Basidiomycota—Coprinellus sp. and Sistotrema brinkmannii. In addition, we report bacteria co-occurring endophytically in the roots of this grass. The Firmicutes group was the most prevalent, consisting of four Gram-positive, endospore-forming bacteria taxa. The isolates were identified as Bacillus pumilus, Bacillus sp., Lysinibacillus sp., and Priestia aryabhattai. Moreover, two Gram-negative bacteria were detected—Kosakonia sp. (Proteobacteria) and Pedobacter sp. (Bacteroidetes). Thus, applying the isolate-culture approach, we identified a set of microorganisms in the roots of a typical grass native to the deciduous forest floor. The functional roles of these endophytes are diverse, and many of them, saprotrophs and decomposers of wood and plant debris, are linked to the decomposition of organic matter. This is the first detailed report on fungal and bacterial endophytes inhabiting the roots of F. gigantea. This study fills in a research gap on endophytes associated with the below-ground parts of Festuca spp., hitherto extensively studied for Epichloë/Neotyphodium associations in their foliar parts.

1. Introduction

Endophytic fungi and bacteria are associated with almost all plants across diverse ecosystems [1,2,3]. Although plant endophytes are diverse, most come from the phylum Ascomycota and, to a lesser extent, from the phylum Basidiomycota. They thrive in temperate and tropical habitats up to polar sites. Endophytic fungi are common in meadows, the Alps, deserts, and forests of the middle zones [4,5,6,7,8]. Endophytic fungi are usually present in the plant tissues of leaves and roots without causing obvious symptoms. Many well-known endophytes of the anamorphic Ascomycota are characterized by melanized septate hyphae. Due to this feature, these fungi are assigned to a special group of dark septate endophytes, DSEs [9,10,11]. Endophytic fungi produce bioactive compounds that help plants resist biotic and abiotic stress, are antagonists to host pests, and are beneficial for host growth and development [11,12].
Many studies show that the roots of most grasses are home to endophytic fungi [7,13,14,15]. However, it should be noted that endophytes in the roots of Festuca spp. and closely related Lolium spp. have been greatly underestimated compared to a very broad literature describing Epichloë/Neotyphodium (Clavicipitaceae) associations in the foliar parts and seeds of these plants [16,17,18,19,20,21,22,23,24].
Festuca gigantea, a member of the Schedonorus subgenus, is a woodland perennial grass common throughout Europe and temperate Asia. Unlike the closely related F. arundinacea and F. pratensis, this species is not used in agricultural pastures. It prefers shady places, damp wet habitats along ditches and riverbanks and is a common grass in forests and parks. Festuca gigantea is adapted to deal with light deficiency in a specific ecological niche rich in decomposing leaf litter and other plant debris shaded by the tree canopy. According to Ellenberg-type indicator value ranking, the light requirement optima for F. gigantea is half that for other members of the Schedonorus group, F. arundinacea and F. pratensis [25]. Like other Festuca, F. gigantea plants are associated with Epichloë/Neotyphodium fungal endophytes [19,26,27,28]. As mentioned above, this fungus systemically colonizes the leaves and stems of host plants but not the roots. Meanwhile, the data on root endophytes in F. gigantea are limited to a brief note where the presence of the fungal hyphae was recorded microscopically, but no species description was specified [29]. Thus, by investigating the occurrence of fungi and bacteria in the roots of F. gigantea, our study attempts to fill in the gap of root endophyte studies and is the first observation of this kind in the broad-leaved Festuca group.
There are a limited number of studies of fungal and bacterial endophytes using the same experiment, whether focused on a particular plant or a particular ecosystem [3,15,30,31]. One of the best examples is Toju and co-authors’ study [3] of fungal and bacterial communities in the leaves and roots across more than 100 plant species sampled in the grassland. Their observations reveal that the below-ground microbiome has different features and dynamics compared to the above-ground microbiome. Therefore, research revealing the complexity of the assemblage of endophytic fungi and bacteria in the hidden parts of plants is greatly valuable for the understanding of plant life.
A diverse group of bacteria, including strains of Pseudomonas, Bacillus, Paenibacillus, Serratia, Kosakonia, and Xanthomonas, has been shown to promote plant growth and has been assigned as plant growth-promoting rhizobacteria (PGPR) or plant growth-promoting bacteria (PGPB) [32,33]. In grasses, the inoculation of bermudagrass with Bacillus spp. strains has demonstrated beneficial effects, showing nitrogenase activity, phosphate solubilization, and siderophore production [34]. In addition, the removal of bacteria from the seeds by sterilization demonstrated significant detrimental effects on root hair development in F. arundinacea and Lolium perenne plants [35]. To date, reports on bacterial endophytes in grasses related to F. gigantea are limited to a set of strains isolated from surface-sterilized seeds of F. arundinacea, where Bacillus, Pantoea, and Pseudomonas bacteria were detected [36]. However, bacteria inhabiting the roots of F. gigantea and other related Festuca have not yet been documented. Thus, one of the objectives of this study was to isolate culturable bacterial strains from the roots of F. gigantea and determine their taxonomy.
Firstly, in the course of the microscopic examination of F. gigantea root apical sections, we detected fungal and bacterial morphostructures. Following this discovery, we aimed to determine the species of fungi and bacteria colonizing the roots of F. gigantea. A taxonomic assignment was carried out according to the typical isolate’s colony and cytomorphotype characteristics of the species, and it was confirmed by the assessment of the standard DNA sequences. Based on this investigation, we describe a set of endophytic fungi and bacteria colonizing the roots of F. gigantea. This is the first detailed report on the endophytes inhabiting the roots of this woodland grass.

2. Materials and Methods

2.1. Root Sampling and Sterilization

For isolation of the fungi and bacteria, tiller samples of F. gigantea from healthy plants were collected on the edges of deciduous forest sites in the Botanical Garden of Vilnius University, Kairėnai (Lithuania, Vilnius; N 54.7362067, E 25.4034823) and Vingis Park (Lithuania, Vilnius, N 54.682574, E 25.233736) during the vegetation season in May–June. The tillers were washed under running tap water, and the roots were removed. Tillers without roots were placed in test tubes filled with tap water. New roots, 1–2 cm long, were collected and sterilized accordingly: 50% ethanol for 90 s, 1.25% sodium hypochlorite for 90 s, and, finally, the samples were washed 3 times for 3 min with sterile water. In addition, 200 μL of final wash water was added to three Petri dishes with PDA or LB medium during the fungal and bacterial culture step, which were used as a negative control to confirm that root sterilization was adequate.

2.2. Microscopy and Estimation of the Abundance of Endophytic Fungi in F. gigantea Roots

For microscopy, newly grown roots are described in Section 2.1, (excluding the sterilization step) were collected and placed in 1.5 mL Eppendorf test tubes with a fixative of ethanol–glacial acetic acid (3:1) and kept in the refrigerator (at 2–3 °C) until use.
Prior to microscopy, all the roots were softened using enzyme treatment as follows: the sampled roots were washed twice with citrate buffer (0.1 M, pH 4.8) at 27–28 °C for 10 min. and treated with 0.5% Macerozyme R-10 at 37 °C for 25 min.
The root cross-sections were prepared without specimen staining and examined for fungal and bacterial morphostructures under a Nikon ECLICE Ci-L phase-contrast microscope. In total, ~100 roots from 25 plants were analyzed.
To determine the frequency of endophytic fungi in F. gigantea, tillers from the plants collected from Kairėnai and Vingis locations were used. In each location, three sampling replicates were made during the season, with two tillers from 5 plants and 2 roots from each tiller collected, making 60 root samples in total for each location. After the enzyme treatment, the roots were washed with citric citrate buffer and stained with 0.025% Trypan Blue, following the protocol described by Kiheri et al. [37] with some modifications: root staining at 90 °C for 30 min, then bleaching with a lactic acid–glycerol (1:1) mixture, repeating it three times. The first two bleaches were at 37 °C for 30 min, and the third was left at room temperature for 24 h before microscopic analysis. A lactic acid–glycerol mixture (4:1) was used to prepare the root tip sections on the microscopy slides. The presence of fungal structures was assessed using a phase contrast microscope in 10 fields of view for each root at ×400 magnification.

2.3. Isolation of Fungi

To make Potato Dextrose Agar (PDA) medium, 200 g of peeled, sliced potatoes (Lithuanian var. Rasa) were boiled in 1 L of distilled water for 30 min. The potato mass was filtered through cheesecloth, saving effluent. The potato infusion was poured into flasks 200 mL at a time. A total of 4 g of dextrose and 4 g of agar were added to each flask. Mixtures were autoclaved at 121 °C for 20 min. The medium was enriched with ampicillin sodium salt (final concentration—100 µg/mL) and streptomycin sulfate (final concentration—100 µg/mL) to selectively inhibit bacterial growth.
The experiment was repeated in 8 replicates, with 4 replicates from Kairėnai and 4 from Vingis locations. In total, 200 root fragments were evaluated for the cultivation of endophytes. Five cuttings of sterile roots were placed in each Petri dish with a PDA medium. Before isolation, the roots were squashed with a sterile needle to facilitate the proliferation of endophytic fungi. The root cuttings in Petri dishes with PDA were incubated in the dark at 27 °C. After 7–14 days, we observed the growth of fungal colonies in proximity to the root segments. The obtained fungal isolates are deposited in the collection of the Laboratory of the Botanical Garden of Vilnius University.

2.4. Isolation of Bacteria

A total of 25 g of LB powder (Fisher BioReagents, Waltham, MA, USA) were dissolved in 1 L of purified water, heated and agitated until completely dissolved, and sterilized by autoclaving at 121 °C for 15 min. Sterile root cuttings were prepared as described in Section 2.1. Root cuttings in Petri dishes with LB medium were incubated at 37 °C in the dark. After 1–2 days, we observed bacterial colonies in proximity to the root segments. The experiment was repeated twice; in total, 50 root fragments were evaluated. The obtained bacterial isolates are deposited in the collection of the Laboratory of the Botanical Garden of Vilnius University.

2.5. DNA Extraction from Fungi and Bacteria Culture Colonies

The fungi and bacteria’s genomic DNA was isolated using the Quick-DNA™ HMW MagBead Kit (Zymo Research, Irvine, CA, USA) following the manufacturer’s guidelines.
For the extraction of the genomic DNA of the fungi, 10-day-old fungal colonies were used, sampling 100 mg of mycelial biomass. For bacteria, 1–2-day-old colonies were used. Each bacterial colony was grown in a liquid LB medium, and the next day, genomic DNA was isolated.

2.6. Standard DNA Amplification and Sequencing

For standard DNA amplification, the primer pairs used in the PCR reactions are listed in Table 1 and Table 2 for fungi and bacteria. The total volume of the PCR mix for amplification was 50 μL. PCR was conducted under the temperature profile of 94 °C for 3 min, followed by 35 cycles of 94 °C for 30 s, 49–61 °C [calculated according to the primer’s Ta = Tm − (0–4 °C)] for 30 s and 72 °C for 1 min, and the final extension at 72 °C for 5 min.
The PCR products were purified using the GeneJET PCR Purification Kit (Thermo Fisher Scientific Baltics, Vilnius, Lithuania). The sequencing was performed by BaseClear B.V., Leiden, Netherlands. The fungal and bacterial colonies representing sequences were analyzed against NCBI reference data using the BLAST tool https://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 17 July 2024).

2.7. Morphological Characterization of Endophytic Fungi

The fungal isolates were characterized by their morphological characteristics, including structure, color, and colony edge. A mixture of glycerol–lactic acid (1:4) was used for analyzing and photographing the fungal mycelium specimens. For viewing, a microscopic Nikon ECLICE Ci-L phase-contrast microscope was used.

2.8. Photography

The images of the colonies were taken by a Sony Alpha a6300 camera (Sony Corporation, Tokyo, Japan) with a Sigma 56 mm f/1.4 lens. Root section cuttings and mycelium samples were analyzed under the phase-contrast microscope, and the NIS-Elements D software (version 6.02.01) program was used for microscopic photography and analysis.

3. Results

3.1. Cytological Morphotypes of Endophytes and Their Abundance in the Roots of F. gigantea

Firstly, in the course of a microscopic examination of F. gigantea root apical sections, we detected patterns of fungal and bacterial morphostructures.
The variable type of hyphae morphology observed demonstrates that the fungi living inside the roots represent different fungi species (Figure 1A–E). In some tissue specimens, we found both hyaline, cystidia-like hyphae (~130 µm long) and thin, melanized, dichotomously branched hyphae present in the same root (Figure 1B,C). The majority of the fungal structures were extracellular (Figure 1A–C,E,H,I), although some appeared intracellular (Figure 1D and Figure S1). Some hyphae were clustered together in abundant groups, which indicates rapid proliferation of endophytic fungi (Figure 1H,I). The Alternaria-type conidia recorded show that Alternaria sp. has an active developmental cycle inside the root tissues of F. gigantea (Figure 1F).
In addition, we viewed images of endophytic bacteria (Figure 1J,K). Large bunches of scattered rod-type bacteria indicated active Bacillus sp. spread (Figure 1J). Moreover, the occurrence of fungi and bacteria together was quite common in some root specimens.
The abundance of endophytic fungi was analyzed in the root tip cross-sections stained with Trypan blue. At the Kairėnai and Vingis locations, the fresh-grown roots were sampled in three replicates from the tillers collected during the vegetation season in May–June. The microscopical analysis of 60 roots for each location in total (no significant differences between replicates were observed) showed the occurrence of fungal structures in about ~40% of the roots examined (Table 3).

3.2. Fungal Endophyte Isolation and Taxonomic Assignment

Endophytic fungi were isolated from the surface-sterile fresh root cuttings of F. gigantea placed on a PDA medium. Twenty-five root segments were planted in eight replicates, four from Kairėnai and four from Vingis locations. Seven fungal isolates were obtained from a total of 200 root segments planted. Four fungal species identified belong to Ascomycota, and two are from Basidiomycota (Figure 2, Table 4). No colony growth was detected in control Petri dishes with the final root-wash water after sterilization.
The taxonomic assignment was based on the colony morphology and the cytomorphological characteristics of the species (Figure 2) and confirmed by the alignment of the PCR-produced ITS, RPB2, SSU, and TEF1-a sequences with the reference fungal DNA data using the BLAST tool [43] (Table 4).
In the isolate culture using PDA medium, the fungal community obtained from the roots of F. gigantea was dominated by Ascomycota species represented by Alternaria alternata, Cadophora fastigiata, Chaetomium funicola, and Microdochium bolleyi.
Alternaria alternata (Fr.) Keissler (1912) isolate’s colony view and cytomorphology images are shown in Figure 2(A1–A4). The colonies on the PDA medium are fast-growing, black to olivaceous-black or greyish, floccose; conidiophores single or in small groups; conidia multicell, ovoid or ellipsoidal, often with a short conical beak, present singly or in acropetal chains, having both transverse and longitudinal septations, pale brown or golden-brown to brown, ~20–50 × 6–10 μm; hyphae subhyaline, septate. Typical A. alternata conidia were observed microscopically in both isolate mycelium (Figure 2(A3)) and root section specimens (Figure 1F).
Cadophora fastigiata Lagerb. & Melin (1928) [=Phialophora fastigiate (Lagerb. & Melin) Conant (1937)] isolate’s colony view and cytomorphology images are shown in Figure 2(B1–B5). The colonies on the PDA are medium greyish-brown, suede-like, reverse dark brown to black, producing ray-like strands towards the center; conidiophores pale brown, straight, unbranched, producing terminal phialides; phialides appear clustered or singly; conidiogenous cells phialidic, pale brown, smooth, with funnel-shaped collarette; conidia ovoid, smooth, light brown, nonseptate, ~5 × 2.5 μm; hyphae subhyaline to pale brown, septate.
Chaetomium funicola Cooke (1872) (=Dichotomopilus funicola (Cooke) X. Wei Wang & Samson 2016) isolate’s colony view and cytomorphology images are shown in Figure 2(C1–C4). The ten-day isolate colonies on the PDA medium are white with a grey tint, reverse pale orange, floccose, hyphae segmented; ascomata dark brown, dichotomously hairy, globose to ovoid, brown, 150–220 μm; terminal hairs dichotomously branched 2–5 times, forming a dense head; ascospores brown, ovate, slightly apiculate at both ends, ~5 × 3 μm.
Microdochium bolleyi (R. Sprague) de Hoog & Herm-Nijh. (1977) isolate’s colony view and cytomorphology images are shown in Figure 2(D1–D3). The colonies on the PDA are peachy orange, suede-like or floccose, in reverse black-spotted at the center, white at edges; hyphae hyaline, septate; conidiogenous cells ampullate or cylindrical; conidia crescent-shaped, hyaline, one-celled, thin-walled, smooth, ~6 × 2 µm.
Two isolate cultures of Basidiomycota, Coprinellus sp. and S. brinkmannii, were obtained on a PDA medium from the surface-sterile root fragments of F. gigantea.
Coprinellus sp. (Pers.) J. E. Lange (1938) isolate’s colony view and cytomorphology images are shown in Figure 2(E1–E4). The isolate colonies on the PDA medium are white to yellowish, growing fluffy, with aerial mycelial tufts filling Petri; hyphae subhyaline, septate, and some clamp projections visible.
Sistotrema brinkmannii (Bres.) J. Erikss. (1948) isolate’s colony view and cytomorphology images are shown in Figure 2(F1–F5). The isolate colonies on the PDA medium are pale yellowish-white, floccose to fluffy, with concentric rings; “chain chlamydospores” are visible microscopically, which is consistent with Potvin and co-authors [44]; basidiospores are dark, ellipsoid, ~4 × 2 µm.

3.3. Bacterial Endophyte Isolation and Taxonomic Assignment

In the culture, from fifty root segments of F. gigantea incubated on an LB medium, we obtained isolated cultures of six bacterial taxa. The group of Firmicutes bacteria was the most prevalent and was represented by Bacillus pumilus, Bacillus sp., Lysinibacillus sp., and Priestia aryabhattai (Table 5). All these four taxa belong to Gram-positive, endospore-forming bacteria. In addition, from the root tissues of F. gigantea, we obtained isolates of two Gram-negative, non-spore-forming bacteria—Kosakonia sp. (=Enterobacter sp.) (Proteobacteria) and Pedobacter sp. (Bacteroidetes). No colony growth was detected in control Petri dishes with the final root-wash water after sterilization. The taxonomic assignment of the bacteria was confirmed by the BLAST results of 16S rDNA sequences (Table 5). The obtained 16S DNA sequences of our bacterial isolates were deposited in the GenBank (Table S1).

4. Discussion

Phylogenetically diverse fungi, bacteria, and archaea are widely found coexisting in plant aerials and below-ground parts. They make communities that affect plant life by playing pivotal roles in nutritional chains and ensuring well-being by providing resistance to stress, diseases, and pests [1,2,12,45,46,47]. In this study, we describe the set of endophytic fungi and bacteria found in the roots of F. gigantea. This is the first detailed report on fungal and bacterial associations in the roots of this woodland grass, which is native to Europe and much of Asia.
We identified six species of endophytic fungi, four members of Ascomycota—A. alternata, C. fastigiata, Ch. funicola, and M. bolleyi—and two of Basidiomycota—Coprinellus sp. and S. brinkmannii. In addition, we report six bacteria taxa; four isolates were identified from Firmicutes—B. pumilus, Bacillus sp., Lysinibacillus sp., and P. aryabhattai—along with Kosakonia sp. (Proteobacteria) and Pedobacter sp. (Bacteroidetes), colonizing the root tissues of F. gigantea.
In the roots of Poaceae and other plant taxa, Ascomycota endophytes are the most common, accounting for about 90% of the community, with Basidiomycota making a minor component [3,48,49,50]. In contrast, we found this proportion rather different. Two Basidiomycota species were detected out of 6 in total, which makes 1/3 of this association. This could be explained by the fact that F. gigantea is native to forest sites where the occurrence of Basidiomycota is highly expected.
The fungal endophytes obtained in this study are taxonomically diverse. Both Ascomycota and Basidiomycota endophytes represent unrelated taxa at the order level, and their functional role and distribution are diverse. In meta-data studies of grassland endophyte communities, the members of Heliotales and Phleosporales are among the most prevalent [3,10,51]. This is consistent with the occurrence of C. fastigiata and A. alternata in the roots of F. gigantea grass found in our culture-dependent study. Alternaria alternata (Phleosporales) is a highly common saprophyte found in soil or decaying plant debris and a pathogen that causes leaf spots, rots, and blights on different plant parts [52,53,54,55]. In addition, many studies show that Alternaria spp. can exist asymptomatically within a wide host range, and they have been shown to be communities’ dominant components in many grasses [56,57,58,59,60]. In the taxonomic group linked to F. gigantea, A. alternata endophyte was recorded among the most abundant taxa in the roots of Festuca rubra subsp. purinosa from harsh ecological niches in marine cliffs [51], whereas in Lolium multiflorum it was found to cause leaf spot disease [61].
Species of the genus Cadophora are widespread geographically. They inhabit different plant roots [4,5,10,62,63,64] and may even appear as grapevine trunk pathogens [65,66]. Although Cadophora endophytes are found colonizing very different plants, Sánchez Márquez and co-authors [56], in summarizing their research with the findings of other authors, do not list Cadophora species among the dominant taxa in grass mycobiota associations; they appear more linked to wood/tree habitats. Many samples of C. fastigiata (=Phialophora fastigiata) (Heliotales), which is a type Cadophora species, come from dying wood; they are often found growing on the wood pulp and roots of Pinus sylvestris, Picea excelsa, and Fagus sylvatica (references listed in Schol-Schwarz [67]). This indicates that C. fastigiata is a common inhabitant in boreal forests, which can explain its occurrence in F. gigantea collected under the forest canopy in our study.
Cheatomium funicola (=Dichotomopilus funicola) (Sordariales) fungus is common in terrestrial habitats; it has been found as a decomposer on plant debris and in soil [68]. Chaetomium funicola has been found widely occurring in very specific ecosystems, such as coastal dunes in Spain and Caatinga semiarid tropical sites in Brazil [69,70,71]. Cheatomium spp. are known as endophytes of many plants; they are often found in the roots of Poaceae [48,69,72]. However, their occurrence in Festuca spp. has not yet been reported. Notably, products obtained from different Chaetomium spp. are widely used as biofungicides and biostimulants [73,74]; however, Ch. funicola is not specified in these agricultural applications.
Microdochium bolleyi (Amphisphaeriales) is a DSE fungus that typically resides endophytically in plant roots, especially in herbaceous plants, including many Poaceae [5,69,72,75,76]. David and colleagues [77] reported strains of M. bolleyi as the most abundant in the roots of coastal herbaceous plant species along the Pacific Northwest coast of the United States. Although the effects of M. bolleyi on herbaceous hosts have not yet been fully qualified, M. bolleyi is generally considered a commensal or weak pathogen. M. bolleyi is often found on the roots of cereal crops and grasses, where it appears as a weak pathogen under certain conditions [78,79]. Within Poaceae grasses, Hong and co-authors [80] found M. bolleyi associated with the basal rot of creeping bentgrass, Agrostis stolonifera.
Although the assemblage identified in this study consists mainly of Ascomycota grass-host generalist species, we also obtained isolates of two Agaricomycetes from Basidiomycota—Coprinellus sp. and S. brinkmannii, co-occurring in the root tissues of woodland grass F. gigantea. In our study, obtaining the isolate of Coprinellus sp. (Agaricales) from the roots of F. gigantea was rather surprising, as these cosmopolitan saprotrophs are not known to colonize the roots of plants as endophytes. There are data about a C. disseminatus isolate culture obtained from an achlorophyllous orchid, Epipogium roseum [81,82]. Recent studies demonstrated that this fungus forms mycorrhizal structures and facilitates the germination and seedling formation of orchids in tropical forests [83]. In addition, C. disseminatus culture isolates were reported from Holcus lanatus (Poaceae) leaves [72], and some were obtained from the living stems of trees, including tropical species [84,85].
Sistotrema brinkmannii (Cantharellales) is a wood-rotting fungus that is widespread on the bark of trees and also found in soil. It was isolated from various substrates, including decayed Pinus sylvestris roots [86] and Pinus contorta wood [87], and was also found in healthy Ipomea leaves [88]. Sometimes, this fungus was found to be involved in mycorrhizal associations in the roots of some trees; however, its exact function remains to be elucidated since typical endo- or ectomycorrhizae were not formed [44]. Notably, S. brinkmannii shows highly antagonistic activity against Heterobasidion spp., the pathogen causing Heterobasidion root disease of conifers [89]. In summary, S. brinkmannii is not a typical grass endophyte, so its discovery as a root associate in F. gigantea shows that its habitat diversity could be border rather than wood association. However, considering the wide distribution of the S. brinkmannii fungus in boreal forests [90], finding this endophyte in woodland grass seems quite possible. To the best of our knowledge, S. brinkmannii occurrence within the roots of grasses has not yet been reported.
Although there is still some possibility that the fungus spores or external hyphae may have survived after surface sterilization, and further inoculation studies are needed to fully verify that Coprinellus sp. and S. brinkmannii have originated from the endosphere, the distinct cystidia-like structures in the root tip cross-sections (Figure 1B) that can be assigned to Basidiomycota but not to Ascomycota are indicative of Basidiomycota in the roots of F. gigantea. Besides endophytic fungi, plants are hosts to diverse endophytic bacteria that are beneficial to plant growth and development [32,33,34]. In the roots of grasses, diverse bacterial communities were reported across many species [1,3,15,91,92]. In our study, most, four out of six, of the bacteria detected come from Bacillaceae; these are B. pumilus, Bacillus sp., Lysinibacillus sp., and P. aryabhattai. Network analysis of microbial communities involved in the decomposition of organic matter shows that bacteria of the genus Bacillus and fungi representing Chaetomium spp. and Alternaria spp. are among the most common keystone taxa [31]. This is related to the endophytic representatives that we found in the roots of F. gigantea, a grass native to the forest floor, where organic matter normally decomposes. Notably, our analysis detected Pedobacter sp., a member of Sphingobacteriales that, according to Banerjee and co-authors [2], is also among the keystone taxa in woodland and grassland ecosystems. Therefore, even though the list of endophytes detected in this study is relatively short compared to the meta-analysis data, we demonstrate the existence of the pivotal microbial community players in the roots of a single woodland grass, F. gigantea.
This study shows that F. gigantea roots are the habitat for a wide range of root endophytes, fungi, and bacteria, which fills in a gap in the studies of Festuca spp. and other closely related grasses for root endophytes, hitherto widely investigated for their associations with Epichloë/Neotyphodium in the foliar parts. The functional roles of the identified endophytes are diverse, and many of them, saprotrophs and decomposers of wood and plant debris, are linked to the decomposition of organic matter. It should be noted that for isolation, we used a single medium, PDA for fungi and LB for bacteria; therefore, future studies using other media and taxonomic identification from a molecular meta-analysis will likely detect a much broader microbial community. On the other hand, a culture-dependent assessment allows for microorganism identification at the species level, whereas a bulk sequence meta-analysis is usually limited to the order/genera level. The obtained isolates preserved in our collection can serve as the basis for further physiological and ecological studies disclosing the interactions between endophytes and F. gigantea plants. Among the broad-leaved Festuca, F. gigantea belongs to a certain ecological niche; this grass prefers a shady and moderately moist environment, typical of the deciduous forest floor. Further studies, including the related Festuca species from the contrasting ecological sites (open field grasslands), may demonstrate differences in root endophyte assemblages and elucidate different functional roles of endophyte coexistence.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/d16080453/s1, Figure S1: Endophytic fungi structures in Festuca gigantea root tip cross-sections. Table S1: The list of obtained 16S DNA sequences of bacterial isolates deposited in the GenBank.

Author Contributions

Conceptualization, I.P. and V.S.; methodology, I.P. and V.S.; validation, V.S. and J.M.; formal analysis, I.P., V.S. and J.M.; investigation, V.S., I.P., J.M. and S.M.; data curation, V.S., I.P., J.M. and S.M.; writing—original draft preparation, I.P. and V.S.; writing—review and editing, I.P. and V.S.; visualization, V.S. and I.P.; supervision, I.P. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data are contained within the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Kandel, S.L.; Joubert, P.M.; Doty, S.L. Bacterial endophyte colonization and distribution within plants. Microorganisms 2017, 5, 77. [Google Scholar] [CrossRef]
  2. Banerjee, S.; Schlaeppi, K.; van der Heijden, M.G.A. Keystone taxa as drivers of microbiome structure and functioning. Nat. Rev. Microbiol. 2018, 16, 567–576. [Google Scholar] [CrossRef]
  3. Toju, H.; Kurokawa, H.; Kenta, T. Factors influencing leaf- and root-associated communities of bacteria and fungi across 33 plant orders in a grassland. Front. Microbiol. 2019, 10, 241. [Google Scholar] [CrossRef] [PubMed]
  4. Porras-Alfaro, A.; Herrera, J.; Sinsabaugh, R.L.; Odenbach, K.J.; Lowrey, T.; Natvig, D.O. Novel root fungal consortium associated with a dominant desert grass. Appl. Environ. Microbiol. 2008, 74, 2805–2813. [Google Scholar] [CrossRef]
  5. Mandyam, K.; Loughin, T.; Jumpponen, A. Isolation and morphological and metabolic characterization of common endophytes in annually burned tallgrass prairie. Mycologia 2010, 102, 813–821. [Google Scholar] [CrossRef]
  6. Glynou, K.; Ali, T.; Buch, A.-K.; Haghi Kia, S.; Ploch, S.; Xia, X.; Çelik, A.; Thines, M.; Maciá-Vicente, J.G. The local environment determines the assembly of root endophytic fungi at a continental scale. Environ. Microbiol. 2016, 18, 2418–2434. [Google Scholar] [CrossRef]
  7. Knapp, D.G.; Imrefi, I.; Boldpurev, E.; Csíkos, S.; Akhmetova, G.; Berek-Nagy, P.J.; Otgonsuren, B.; Kovács, G.M. Root-colonizing endophytic fungi of the dominant grass Stipa krylovii from a mongolian steppe grassland. Front. Microbiol. 2019, 10, 2565. [Google Scholar] [CrossRef]
  8. Menoyo, E.; Teste, F.P.; Ferrero, M.A.; Lugo, M.A. Associations between fungal root endophytes and grass dominance in arid highlands. Fungal Ecol. 2020, 45, 100924. [Google Scholar] [CrossRef]
  9. Mandyam, K.; Jumpponen, A. Seeking the elusive function of the root-colonising dark septate endophytic fungi. Stud. Mycol. 2005, 53, 173–189. [Google Scholar] [CrossRef]
  10. Knapp, D.G.; Pintye, A.; Kovács, G.M. The dark side is not fastidious—Dark septate endophytic fungi of native and invasive plants of semiarid sandy areas. PLoS ONE 2012, 7, e32570. [Google Scholar] [CrossRef]
  11. Andrade-Linares, D.; Franken, P. Fungal endophytes in plant roots: Taxonomy, colonization patterns, and functions. In Symbiotic Endophytes; Springer: Berlin/Heidelberg, Germany, 2013; pp. 311–334. [Google Scholar] [CrossRef]
  12. Knapp, D.G.; Németh, J.B.; Barry, K.; Hainaut, M.; Henrissat, B.; Johnson, J.; Kuo, A.; Lim, J.H.P.; Lipzen, A.; Nolan, M.; et al. Comparative genomics provides insights into the lifestyle and reveals functional heterogeneity of dark septate endophytic fungi. Sci. Rep. 2018, 8, 6321. [Google Scholar] [CrossRef] [PubMed]
  13. Addy, H.D.; Piercey, M.M.; Currah, R.S. Microfungal endophytes in roots. Can. J. Bot. 2005, 83, 1–13. [Google Scholar] [CrossRef]
  14. Wearn, J.A.; Sutton, B.C.; Morley, N.J.; Gange, A.C. Species and organ specificity of fungal endophytes in herbaceous grassland plants. J. Ecol. 2012, 100, 1085–1092. [Google Scholar] [CrossRef]
  15. Hardoim, P.R.; van Overbeek, L.S.; Berg, G.; Pirttilä, A.M.; Compant, S.; Campisano, A.; Döring, M.; Sessitsch, A. The hidden world within plants: Ecological and evolutionary considerations for defining functioning of microbial endophytes. Microbiol. Mol. Biol. Rev. 2015, 79, 293–320. [Google Scholar] [CrossRef] [PubMed]
  16. Schardl, C.L. The epichloae, symbionts of the grass subfamily Poöideae. Ann. Mo. Bot. Gard. 2010, 97, 646–665. [Google Scholar] [CrossRef]
  17. Tadych, M.; Bergen, M.S.; White, J.F. Epichloë spp. associated with grasses: New insights on life cycles, dissemination and evolution. Mycologia 2014, 106, 181–201. [Google Scholar] [CrossRef] [PubMed]
  18. Saikkonen, K.; Ahlholm, J.; Helander, M.; Lehtimäki, S.; Niemeläinen, O. Endophytic fungi in wild and cultivated grasses in Finland. Ecography 2000, 23, 360–366. [Google Scholar] [CrossRef]
  19. Leyronas, C.; Raynal, G. Presence of neotyphodium-like endophytes in European grasses. Ann. Appl. Biol. 2001, 139, 119–127. [Google Scholar] [CrossRef]
  20. Müller, C.B.; Krauss, J. Symbiosis between grasses and asexual fungal endophytes. Curr. Opin. Plant Biol. 2005, 8, 450–456. [Google Scholar] [CrossRef]
  21. Soto-Barajas, M.; Azquez-De-Aldana, B.; Alvarez, A.; Zabalgogeazcoa, I. Sympatric Epichloë species and chemotypic profiles in natural populations of Lolium Perenne. Fungal Ecol. 2019, 39, 231–241. [Google Scholar] [CrossRef]
  22. Krauss, J.; Vikuk, V.; Young, C.A.; Krischke, M.; Mueller, M.J.; Baerenfaller, K. Epichloë endophyte infection rates and alkaloid content in commercially available grass seed mixtures in Europe. Microorganisms 2020, 8, 498. [Google Scholar] [CrossRef]
  23. Hume, D.E.; Stewart, A.V.; Simpson, W.R.; Johnson, R.D. Epichloë fungal endophytes play a fundamental role in New Zealand grasslands. J. R. Soc. N. Z. 2020, 50, 279–298. [Google Scholar] [CrossRef]
  24. Garces, K.R.; Sage, H.E.; Christian, N.; Emery, S.M. Epichloë increases root fungal endophyte richness and alters root fungal endophyte composition in a changing world. J. Fungi 2022, 8, 1142. [Google Scholar] [CrossRef]
  25. Tichý, L.; Axmanová, I.; Dengler, J.; Guarino, R.; Jansen, F.; Midolo, G.; Nobis, M.P.; Van Meerbeek, K.; Aćić, S.; Attorre, F.; et al. Ellenberg-type indicator values for European vascular plant species. J. Veg. Sci. 2023, 34, e13168. [Google Scholar] [CrossRef]
  26. Siegel, M.R.; Latch, G.C.M.; Bush, L.P.; Fannin, F.F.; Rowan, D.D.; Tapper, B.A.; Bacon, C.W.; Johnson, M.C. Fungal endophyte-infected grasses: Alkaloid accumulation and aphid response. J. Chem. Ecol. 1990, 16, 3301–3315. [Google Scholar] [CrossRef] [PubMed]
  27. Leuchtmann, A. Isozyme relationships of Acremonium endophytes from twelve Festuca species. Mycol. Res. 1994, 98, 25–33. [Google Scholar] [CrossRef]
  28. Leuchtmann, A.; Schmidt, D.; Bush, L.P. Different levels of protective alkaloids in grasses with stroma-forming and seed-transmitted Epichloë/Neotyphodium endophytes. J. Chem. Ecol. 2000, 26, 1025–1036. [Google Scholar] [CrossRef]
  29. Popkova, E.G.; Blagoveshchenskaya, E.Y. Fungal endophyte colonization within different organs of Festuca gigantea (L.) VILL. Bull. Mosc. Soc. Nat. Scientists. Dep. Biol. 2019, 124, 65–69. [Google Scholar]
  30. de Souza, R.S.C.; Okura, V.K.; Armanhi, J.S.L.; Jorrín, B.; Lozano, N.; da Silva, M.J.; González-Guerrero, M.; de Araújo, L.M.; Verza, N.C.; Bagheri, H.C.; et al. Unlocking the bacterial and fungal communities assemblages of sugarcane microbiome. Sci. Rep. 2016, 6, 28774. [Google Scholar] [CrossRef]
  31. Banerjee, S.; Kirkby, C.A.; Schmutter, D.; Bissett, A.; Kirkegaard, J.A.; Richardson, A.E. Network analysis reveals functional redundancy and keystone taxa amongst bacterial and fungal communities during organic matter decomposition in an arable soil. Soil Biol. Biochem. 2016, 97, 188–198. [Google Scholar] [CrossRef]
  32. Backer, R.; Rokem, J.S.; Ilangumaran, G.; Lamont, J.; Praslickova, D.; Ricci, E.; Subramanian, S.; Smith, D.L. Plant growth promoting Rhizobacteria: Context, mechanisms of action, and roadmap to commercialization of biostimulants for sustainable agriculture. Front. Plant Sci. 2018, 9, 1473. [Google Scholar] [CrossRef] [PubMed]
  33. Aloo, B.N.; Nyongesa, B.O.; Were, J.O.; Were, B.A.; Tumuhairwe, J.B. Rhizobacterial biomolecules for sustainable crop production and environmental management: Plausible functions and molecular mechanism. In Microbial Biomolecules Emerging Approach in Agriculture, Pharmaceuticals and Environment Management, 1st ed.; Kumar, A., Bilal, M., Ferreira, L.F.R., Madhuree, K., Eds.; Academic Press: Cambridge, MA, USA, 2023; pp. 1–30. [Google Scholar]
  34. Coy, R.M.; Held, D.W.; Kloepper, J.W. Rhizobacterial colonization of bermudagrass by Bacillus spp. in a Marvyn loamy sand soil. Appl. Soil Ecol. 2019, 141, 10–17. [Google Scholar] [CrossRef]
  35. White, J.F.; Chen, Q.; Torres, M.S.; Mattera, R.; Irizarry, I.; Tadych, M.; Bergen, M. Collaboration between grass seedlings and rhizobacteria to scavenge organic nitrogen in soils. AoB Plants 2015, 7, plu093. [Google Scholar] [CrossRef]
  36. Roberts, E.L. Plant growth promoting fungal and bacterial endophytes of Tall Fescue: A Review. Grass Res. 2022, 2, 2. [Google Scholar] [CrossRef]
  37. Kiheri, H.; Heinonsalo, J.; Timonen, S. Staining and microscopy of mycorrhizal fungal colonization in preserved ericoid plant roots. J. Berry Res. 2017, 4, 231–237. [Google Scholar] [CrossRef]
  38. White, T.J.; Bruns, T.; Lee, S.J.W.T.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Academic Press: Cambridge, MA, USA, 1990; pp. 315–322. [Google Scholar]
  39. Groenewald, J.Z.; Nakashima, C.; Nishikawa, J.; Shin, H.-D.; Park, J.-H.; Jama, A.N.; Groenewald, M.; Braun, U.; Crous, P.W. Species concepts in cercospora: Spotting the weeds among the roses. Stud. Mycol. 2013, 75, 115–170. [Google Scholar] [CrossRef] [PubMed]
  40. Sung, G.-H.; Sung, J.-M.; Hywel-Jones, N.L.; Spatafora, J.W. A multi-gene phylogeny of Clavicipitaceae (Ascomycota, fungi): Identification of localized incongruence using a combinational bootstrap approach. Mol. Phylogenet. Evol. 2007, 44, 1204–1223. [Google Scholar] [CrossRef]
  41. Coombs, J.T.; Franco, C.M.M. Isolation and identification of actinobacteria from surface-sterilized wheat roots. Appl. Environ. Microbiol. 2003, 69, 5603–5608. [Google Scholar] [CrossRef]
  42. Klindworth, A.; Pruesse, E.; Schweer, T.; Peplies, J.; Quast, C.; Horn, M.; Glöckner, F.O. Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies. Nucleic Acids Res. 2013, 41, e1. [Google Scholar] [CrossRef]
  43. Vu, D.; Groenewald, M.; de Vries, M.; Gehrmann, T.; Stielow, B.; Eberhardt, U.; Al-Hatmi, A.; Groenewald, J.Z.; Cardinali, G.; Houbraken, J.; et al. Large-scale generation and analysis of filamentous fungal DNA barcodes boosts coverage for kingdom fungi and reveals thresholds for fungal species and higher taxon delimitation. Stud. Mycol. 2019, 92, 135–154. [Google Scholar] [CrossRef]
  44. Potvin, L.R.; Richter, D.L.; Jurgensen, M.F.; Dumroese, R.K. Association of Pinus Banksiana Lamb. and Populus Tremuloides Michx. seedling fine roots with Sistotrema Brinkmannii (Bres.) J. Erikss. (Basidiomycotina). Mycorrhiza 2012, 22, 631–638. [Google Scholar] [CrossRef] [PubMed]
  45. Kovács, G.; Szigetvári, C. Mycorrhizae and other root-associated fungal structures of the plants of a sandy grassland on the Great Hungarian Plain. Phyton-Ann. Rei Bot. 2002, 42, 211–223. [Google Scholar]
  46. Alibrandi, P.; Schnell, S.; Perotto, S.; Cardinale, M. Diversity and structure of the endophytic bacterial communities associated with three terrestrial orchid species as revealed by 16S rRNA gene metabarcoding. Front. Microbiol. 2020, 11, 604964. [Google Scholar] [CrossRef] [PubMed]
  47. Hassani, M.A.; Durán, P.; Hacquard, S. Microbial interactions within the plant holobiont. Microbiome 2018, 6, 58. [Google Scholar] [CrossRef] [PubMed]
  48. Sánchez Márquez, S.; Bills, G.; Zabalgogeazcoa, I. The endophytic mycobiota of the grass Dactylis glomerata. Fungal Divers. 2007, 27, 171–195. [Google Scholar]
  49. Toju, H.; Yamamoto, S.; Sato, H.; Tanabe, A.S.; Gilbert, G.S.; Kadowaki, K. Community composition of root-associated fungi in a Quercus-dominated temperate forest: “Codominance” of mycorrhizal and root-endophytic fungi. Ecol. Evol. 2013, 3, 1281–1293. [Google Scholar] [CrossRef] [PubMed]
  50. Rashmi, M.; Kushveer, J.S.; Sarma, V.V. A worldwide list of endophytic fungi with notes on ecology and diversity. Mycosphere 2019, 10, 798–1079. [Google Scholar] [CrossRef]
  51. Pereira, E.; Vázquez de Aldana, B.R.; San Emeterio, L.; Zabalgogeazcoa, I. A survey of culturable fungal endophytes from Festuca rubra subsp. pruinosa, a grass from marine cliffs, reveals a core microbiome. Front. Microbiol. 2019, 9, 3321. [Google Scholar] [CrossRef] [PubMed]
  52. Thomma, B.P.H.J. Alternaria spp.: From general saprophyte to specific parasite. Mol. Plant Pathol. 2003, 4, 225–236. [Google Scholar] [CrossRef]
  53. Lawrence, D.P.; Rotondo, F.; Gannibal, P.B. Biodiversity and taxonomy of the pleomorphic genus Alternaria. Mycol. Prog. 2015, 15, 3. [Google Scholar] [CrossRef]
  54. El Gobashy, S.F.; Mikhail, W.Z.A.; Ismail, A.M.; Zekry, A.; Moretti, A.; Susca, A.; Soliman, A.S. Phylogenetic, Toxigenic and virulence profiles of Alternaria species causing leaf blight of tomato in Egypt. Mycol. Prog. 2018, 17, 1269–1282. [Google Scholar] [CrossRef]
  55. DeMers, M. Alternaria alternata as endophyte and pathogen. Microbiol. Read. Engl. 2022, 168, 001153. [Google Scholar] [CrossRef] [PubMed]
  56. Sánchez Márquez, S.; Bills, G.; Herrero, N.; Zabalgogeazcoa, I. Non-systemic fungal endophytes of grasses. Fungal Ecol 2011, 5, 289–297. [Google Scholar] [CrossRef]
  57. Woudenberg, J.H.C.; Groenewald, J.Z.; Binder, M.; Crous, P.W. Alternaria redefined. Stud. Mycol. 2013, 75, 171–212. [Google Scholar] [CrossRef]
  58. Woudenberg, J.H.C.; Seidl, M.F.; Groenewald, J.Z.; de Vries, M.; Stielow, J.B.; Thomma, B.P.H.J.; Crous, P.W. Alternaria section Alternaria: Species, formae speciales or pathotypes? Stud. Mycol. 2015, 82, 1–21. [Google Scholar] [CrossRef]
  59. Armitage, A.D.; Barbara, D.J.; Harrison, R.J.; Lane, C.R.; Sreenivasaprasad, S.; Woodhall, J.W.; Clarkson, J.P. Discrete lineages within Alternaria alternata species group: Identification using new highly variable loci and support from morphological characters. Fungal Biol. 2015, 119, 994–1006. [Google Scholar] [CrossRef] [PubMed]
  60. Armitage, A.D.; Cockerton, H.M.; Sreenivasaprasad, S.; Woodhall, J.; Lane, C.R.; Harrison, R.J.; Clarkson, J.P. Genomics evolutionary history and diagnostics of the Alternaria alternata species group including apple and asian pear pathotypes. Front. Microbiol. 2020, 10, 3124. [Google Scholar] [CrossRef]
  61. Wei, X.K.; Xue, L.H.; Li, C.J. First report of leaf spot caused by Alternaria alternata on italian ryegrass (Lolium multiflorum) in China. Plant Dis. 2021, 105, 1211. [Google Scholar] [CrossRef]
  62. Jumpponen, A. Dark septate endophytes—Are they mycorrhizal? Mycorrhiza 2001, 11, 207–211. [Google Scholar] [CrossRef]
  63. Knapp, D.G.; Kovács, G.M.; Zajta, E.; Groenewald, J.Z.; Crous, P.W. Dark septate endophytic pleosporalean genera from semiarid areas. Persoonia-Mol. Phylogeny Evol. Fungi 2015, 35, 87–100. [Google Scholar] [CrossRef]
  64. Maciá-Vicente, J.G.; Piepenbring, M.; Koukol, O. Brassicaceous roots as an unexpected diversity hot-spot of helotialean endophytes. IMA Fungus 2020, 11, 16. [Google Scholar] [CrossRef] [PubMed]
  65. Gramaje, D.; Mostert, L.; Armengol, J. Characterization of Cadophora luteo-olivacea and C. melinii isolates obtained from grapevines and environmental samples from grapevine nurseries in Spain. Phytopathol. Mediterr. 2011, 50, 112–126. [Google Scholar]
  66. Travadon, R.; Lawrence, D.P.; Rooney-Latham, S.; Gubler, W.D.; Wilcox, W.F.; Rolshausen, P.E.; Baumgartner, K. Cadophora species associated with wood-decay of grapevine in North America. Fungal Biol. 2015, 119, 53–66. [Google Scholar] [CrossRef]
  67. Schol-Schwarz, M.B. Revision of the genus Phialophora (Moniliales). Persoonia-Mol. Phylogeny Evol. Fungi 1970, 6, 59–94. [Google Scholar]
  68. Ames, L.M. A Monograph of the Chaetomiaceae; Army Research Office: Durham, NC, USA, 1961. [Google Scholar]
  69. Sánchez Márquez, S.; Bills, G.; Zabalgogeazcoa, I. Diversity and structure of the fungal endophytic assemblages from two sympatric coastal grasses. Fungal Divers. 2008, 33, 87–100. [Google Scholar]
  70. Barbosa, F.; Raja, H.; Gusmao, L. Three Chaetomium species (Chaetomiaceae, Ascomycota) from the semi-arid region of Brazil. Sitientibus Sér. Ciênc. Biológicas 2012, 12, 115–118. [Google Scholar] [CrossRef]
  71. Fortes, N.; Vitoria, N. New records of Chaetomium and Chaetomium-like species (Ascomycota, Chaetomiaceae) on Syagrus coronata from the Raso da Catarina Ecological Station (ESEC), Caatinga, Bahia, Brazil. Mycotaxon 2023, 137, 171. [Google Scholar] [CrossRef]
  72. Sánchez Márquez, S.; Bills, G.F.; Domínguez Acuña, L.; Zabalgogeazcoa, I. Endophytic mycobiota of leaves and roots of the grass Holcus lanatus. Fungal Divers. 2010, 41, 115–123. [Google Scholar] [CrossRef]
  73. Moya, P.; Cipollone, J.; Sisterna, M. The fungal genus Chaetomium and its agricultural applications. In Plant Defence: Biological Control; Mérillon, J.M., Ramawat, K.G., Eds.; Springer: Cham, Switzerland, 2020; Volume 22, pp. 289–308. [Google Scholar]
  74. Soytong, K.; Kahonokmedhakul, S.; Song, J.; Tongon, R.; Soytong, K.; Kahonokmedhakul, S.; Song, J.; Tongon, R. Chaetomium application in agriculture. In Technology in Agriculture; IntechOpen: London, UK, 2021. [Google Scholar] [CrossRef]
  75. Wirsel, S.G.R.; Leibinger, W.; Ernst, M.; Mendgen, K. Genetic diversity of fungi closely associated with common reed. New Phytol. 2001, 149, 589–598. [Google Scholar] [CrossRef]
  76. Gao, Y.; Ren, G.-C.; Wanasinghe, D.; Xu, J.-C.; Farias, A.; Gui, H. Two new species and a new record of Microdochium from grasses in Yunnan province, South-West China. J. Fungi 2022, 8, 1297. [Google Scholar] [CrossRef]
  77. David, A.S.; Seabloom, E.W.; May, G. Plant host species and geographic distance affect the structure of aboveground fungal symbiont communities, and environmental filtering affects belowground communities in a coastal dune ecosystem. Microb. Ecol. 2016, 71, 912–926. [Google Scholar] [CrossRef] [PubMed]
  78. Kirk, J.J.; Deacon, J.W. Control of the take-all fungus by Microdochium bolleyi, and interactions involving M. Bolleyi, Phialophora graminicola and Periconia macrospinosa on cereal roots. Plant Soil 1987, 98, 231–237. [Google Scholar] [CrossRef]
  79. Ünal, F. Phylogenetic analysis of Microdochium spp. associated with turfgrass and their pathogenicity in cereals. PeerJ 2024, 12, e16837. [Google Scholar] [CrossRef] [PubMed]
  80. Hong, S.K.; Kim, W.G.; Choi, H.W.; Lee, S.Y. Identification of Microdochium bolleyi associated with basal rot of creeping bent grass in Korea. Mycobiology 2008, 36, 77–80. [Google Scholar] [CrossRef] [PubMed]
  81. Yagame, T.; Fukiharu, T.; Yamato, M.; Suzuki, A.; Iwase, K. Identification of a mycorrhizal fungus in Epipogium roseum (Orchidaceae) from morphological characteristics of basidiomata. Mycoscience 2008, 49, 147–151. [Google Scholar] [CrossRef]
  82. Yagame, T.; Funabiki, E.; Yukawa, T.; Nagasawa, E. Identification of mycobionts in an achlorophyllous orchid, Cremastra aphylla (Orchidaceae), based on molecular analysis and basidioma morphology. Mycoscience 2018, 59, 18–23. [Google Scholar] [CrossRef]
  83. Gao, Y.; Peng, S.; Hang, Y.; Xie, G.; Ji, N.; Zhang, M. Mycorrhizal fungus Coprinellus Disseminatus influences seed germination of the terrestrial orchid Cremastra Appendiculata (D. Don) Makino. Sci. Hortic. 2022, 293, 110724. [Google Scholar] [CrossRef]
  84. de Errasti, A.; Carmarán, C.C.; Novas, M.V. Diversity and significance of fungal endophytes from living stems of naturalized trees from Argentina. Fungal Divers. 2010, 41, 29–40. [Google Scholar] [CrossRef]
  85. Martin, R.; Gazis, R.; Skaltsas, D.; Chaverri, P.; Hibbett, D. Unexpected diversity of basidiomycetous endophytes in sapwood and leaves of Hevea. Mycologia 2015, 107, 284–297. [Google Scholar] [CrossRef]
  86. Menkis, A.; Vasiliauskas, R.; Taylor, A.F.S.; Stenström, E.; Stenlid, J.; Finlay, R. Fungi in decayed roots of conifer seedlings in forest nurseries, afforested clear-cuts and abandoned farmland. Plant Pathol. 2006, 55, 117–129. [Google Scholar] [CrossRef]
  87. Son, E.; Kim, J.-J.; Lim, Y.W.; Au-Yeung, T.T.; Yang, C.Y.H.; Breuil, C. Diversity and decay ability of basidiomycetes isolated from lodgepole pines killed by the mountain pine beetle. Can. J. Microbiol. 2011, 57, 33–41. [Google Scholar] [CrossRef] [PubMed]
  88. Steiner, U.; Ahimsa-Müller, M.A.; Markert, A.; Kucht, S.; Groß, J.; Kauf, N.; Kuzma, M.; Zych, M.; Lamshöft, M.; Furmanowa, M.; et al. Molecular characterization of a seed transmitted clavicipitaceous fungus occurring on dicotyledoneous plants (Convolvulaceae). Planta 2006, 224, 533–544. [Google Scholar] [CrossRef] [PubMed]
  89. Burņeviča, N.; Kļaviņa, D.; Lione, G.; Pellicciaro, M.; Silbauma, L.; Zaļuma, A.; Nikolajeva, V.; Gonthier, P. In vitro screening of Latvian isolates of Bjerkandera adusta and Sistotrema brinkmannii as potential biocontrol agents against Heterobasidion root and butt rots. Balt. For. 2022, 28, 1–9. [Google Scholar] [CrossRef]
  90. Hallenberg, N. Speciation and distribution in Corticiaceae (Basidiomycetes). Plant Syst. Evol. 1991, 177, 93–110. [Google Scholar] [CrossRef]
  91. Li, Y.H.; Zhu, J.N.; Liu, Q.F.; Liu, Y.; Liu, M.; Liu, L.; Zhang, Q. Comparison of the diversity of root-associated bacteria in Phragmites Australis and Typha Angustifolia L. in artificial wetlands. World J. Microbiol. Biotechnol. 2013, 29, 1499–1508. [Google Scholar] [CrossRef]
  92. Wemheuer, F.; Kaiser, K.; Karlovsky, P.; Daniel, R.; Vidal, S.; Wemheuer, B. Bacterial endophyte communities of three agricultural important grass species differ in their response towards management regimes. Sci. Rep. 2017, 7, 40914. [Google Scholar] [CrossRef]
Diversity 16 00453 g001
Figure 1. Cytological view of fungal and bacterial endophyte morphotypes in the root meristem of F. gigantea: (A–E) images of endophytic fungi hyphae; (F) Alternaria-type conidia; (G) agglomerates of fungal spores; (H,I) clusters of hyphae; (J) large bunches of Bacillus-type endophytic bacteria; (K) chains of filamentous bacteria. Scale bar = 10 µm.
Figure 1. Cytological view of fungal and bacterial endophyte morphotypes in the root meristem of F. gigantea: (A–E) images of endophytic fungi hyphae; (F) Alternaria-type conidia; (G) agglomerates of fungal spores; (H,I) clusters of hyphae; (J) large bunches of Bacillus-type endophytic bacteria; (K) chains of filamentous bacteria. Scale bar = 10 µm.
Diversity 16 00453 g001
Diversity 16 00453 g002
Figure 2. The 7–10-day isolate colonies on PDA medium from the roots of F. gigantea and cytomorphological images obtained from mycelium: (A1,A2) Alternaria alternata (isolate BSG001) top and reverse view, (A3) multicelled, obclavate conidia with short conical beaks, and (A4) segmented hyphae; (B1,B2) Cadophora fastigiata (BSG003) top and reverse views, (B3,B5) conidiophores (funnel-shaped collarette marked) and segmented hyphae, and (B4) conidia; (C1,C2) Chaetomium funicola (BSG039) front and reverse views, (C3) ascomata, and (C4) ascomata hair and ascospores sticking to it; (D1,D2) Microdochium bolleyi (BSG008) top and reverse, (D3) conidia on cylindrical conidiogenous cells; (E1,E2) Coprinellus sp. (BSG004) top and reverse view, and (E3,E4) segmented hyphae; (F1,F2) Sistotrema brinkmannii (BSG005) top and reverse view, (F3,F5) hyphae, and (F4) spores. Scale bar: (A3,A4,B3,C3,E3,F3) = 100 µm; (B4,B5,C4,D3,E4,F4,F5) = 10 µm.
Figure 2. The 7–10-day isolate colonies on PDA medium from the roots of F. gigantea and cytomorphological images obtained from mycelium: (A1,A2) Alternaria alternata (isolate BSG001) top and reverse view, (A3) multicelled, obclavate conidia with short conical beaks, and (A4) segmented hyphae; (B1,B2) Cadophora fastigiata (BSG003) top and reverse views, (B3,B5) conidiophores (funnel-shaped collarette marked) and segmented hyphae, and (B4) conidia; (C1,C2) Chaetomium funicola (BSG039) front and reverse views, (C3) ascomata, and (C4) ascomata hair and ascospores sticking to it; (D1,D2) Microdochium bolleyi (BSG008) top and reverse, (D3) conidia on cylindrical conidiogenous cells; (E1,E2) Coprinellus sp. (BSG004) top and reverse view, and (E3,E4) segmented hyphae; (F1,F2) Sistotrema brinkmannii (BSG005) top and reverse view, (F3,F5) hyphae, and (F4) spores. Scale bar: (A3,A4,B3,C3,E3,F3) = 100 µm; (B4,B5,C4,D3,E4,F4,F5) = 10 µm.
Diversity 16 00453 g002
Table 1. The list of primers in PCR reactions for amplification of fungi DNA sequences.
Table 1. The list of primers in PCR reactions for amplification of fungi DNA sequences.
LocusPrimersPrimer Sequences (5′–3′)Tm °CReference
ITSITS1TCCGTAGGTGAACCTGCGG54[38]
ITS4TCCTCCGCTTATTGATATGC
TEFaEF1-728FCATCGAGAAGTTCGAGAAGG54[39]
EF-2GGARGTACCAGTSATCATGTT
SSUNS1GTAGTCATATGCTTGTCTC49[38]
NS4CTTCCGTCAATTCCTTTAAG
RPB2RPB2-5F2GGGGWGAYCAGAAGAAGGC58[40]
fRPB2-7cRCCCATRGCTTGYTTRCCCAT
Table 2. The list of primers in PCR reactions for amplification of standard bacteria 16S rDNA sequences.
Table 2. The list of primers in PCR reactions for amplification of standard bacteria 16S rDNA sequences.
LocusPrimersPrimer Sequences (5′–3′)Tm °CReference
16S rDNA27f CMAGAGTTTGATCMTGGCTCAG52[41]
1492RTACGGYTACCTTGTTACGACTT
16S rDNA704FGTAGCGGTGAAATGCGTAGA56[41]
765RCTGTTTGCTCCCCACGCTTTC
16S rDNAS-D-Bact-0341-b-S-17CCTACGGGNGGCWGCAG56[42]
S-D-Bact-0785-a-A-21GACTACHVGGGTATCTAATCC
Table 3. Endophytic fungi structure abundance in F. gigantea root tip tissues.
Table 3. Endophytic fungi structure abundance in F. gigantea root tip tissues.
LocationRoots Fragments Roots with
Endophytic Fungi, %		Microscopical Fields of View
* No.
Analysed		No. with Fungi Structures DetectedNo.
Analysed		No. with Fungi
Structures Detected		Endophytic Fungi Abundance, %
Kairėnai602846.760015525.8
Vingis602541.760014123.5
* No.—number.
Table 4. Taxonomic assignment of the endophytic fungi isolated from the roots of F. gigantea according to the standard DNA data.
Table 4. Taxonomic assignment of the endophytic fungi isolated from the roots of F. gigantea according to the standard DNA data.
FungusIsolate CodeDNA LocusDNA Identities, bpCongruence, %BLAST ID
Alternaria
alternata		BSG001
BSG002		ITS440/440100.0PP218262.1
RPB2587/587100.0MN922279.1
SSU647/647100.0OR453387.1
TEF373/373100.0MK386655.1
Cadophora
fastigiata		BSG003ITS531/531100.0MN833359.1
508/508100.0MF077223.1
Chaetomium funicolaBSG039ITS248/24999.6FN394680
570/570100.0PP165499.1
RPB2527/54097.6XM_062782192.1
SSU417/417100.0AF048794.1
Microdochium bolleyiBSG008ITS460/460100.0MT276137.1
RPB2543/543100.0MN817764.1
Coprinellus sp.BSG004ITS390/39798.2JN689938
464/47198.5FN386275
Sistotrema
brinkmannii		BSG005ITS514/514100.0DQ093653.1
650/650100.0JQ912675.1
SSU567/567100.0KM222227.1
Table 5. Taxonomic assignment of endophytic bacteria isolated from the roots of F. gigantea according to standard 16S rDNA sequences.
Table 5. Taxonomic assignment of endophytic bacteria isolated from the roots of F. gigantea according to standard 16S rDNA sequences.
BacteriaBacteria
Isolate Code		Colony Characteristics Congruence, %BLAST ID
Colony Shape, Surface, Edge ShapeColorDNA
Identities, bp
Bacillus pumilusBSB021Almost round, opaque, shiny, uneven edgeYellow1086/108799.91MK521063.1
Bacillus sp.BSB013Round, opaque, rough, uneven edgeWhite986/101297.43CP026662.1
Lysinibacillus sp.BSB054Round, flat, opaque, smooth edgeWhite1084/108799.72MH385002.1
Priestia aryabhattaiBSB045Round, straight edges, shiny oil, fluff-shaped colonyCream1084/108899.63MH321608.1
Kosakonia sp.BSB028Round, the surface is smooth, shiny, uneven edgeWhite1068/108898.16MG835978.1
Pedobacter sp.BSB034Round, convex, opaque, shiny, smooth edgePink1039/109295.15CP079218.1
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Pašakinskienė, I.; Stakelienė, V.; Matijošiūtė, S.; Martūnas, J. Diversity of Endophytic Fungi and Bacteria Inhabiting the Roots of the Woodland Grass, Festuca gigantea (Poaceae). Diversity 2024, 16, 453. https://doi.org/10.3390/d16080453

AMA Style

Pašakinskienė I, Stakelienė V, Matijošiūtė S, Martūnas J. Diversity of Endophytic Fungi and Bacteria Inhabiting the Roots of the Woodland Grass, Festuca gigantea (Poaceae). Diversity. 2024; 16(8):453. https://doi.org/10.3390/d16080453

Chicago/Turabian Style

Pašakinskienė, Izolda, Violeta Stakelienė, Saulė Matijošiūtė, and Justas Martūnas. 2024. "Diversity of Endophytic Fungi and Bacteria Inhabiting the Roots of the Woodland Grass, Festuca gigantea (Poaceae)" Diversity 16, no. 8: 453. https://doi.org/10.3390/d16080453

APA Style

Pašakinskienė, I., Stakelienė, V., Matijošiūtė, S., & Martūnas, J. (2024). Diversity of Endophytic Fungi and Bacteria Inhabiting the Roots of the Woodland Grass, Festuca gigantea (Poaceae). Diversity, 16(8), 453. https://doi.org/10.3390/d16080453

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop