Next Article in Journal
A Clinical Update on SARS-CoV-2: Pathology and Development of Potential Inhibitors
Next Article in Special Issue
Mapping QTLs for Super-Earliness and Agro-Morphological Traits in RILs Population Derived from Interspecific Crosses between Pisum sativum × P. fulvum
Previous Article in Journal
Lavender Essential Oil Modulates Hepatic Cholesterol Metabolism in HepG2 Cells
Previous Article in Special Issue
Identification of Candidate Genes Associated with Pulp Color by Transcriptomic Analysis of ‘Huaxiu’ Plum (Prunus salicina Lindl.) during Fruit-Ripening
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
CIMB
Volume 45
Issue 1
10.3390/cimb45010027
cimb-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Characterization of Highbush Blueberry (Vaccinium corymbosum L.) Anthocyanin Biosynthesis Related MYBs and Functional Analysis of VcMYB Gene

by
Yongyan Zhang
1,2,†,
Dingquan Huang
1,3,†,
Bin Wang
1,
Xuelian Yang
4,
Huan Wu
1,
Pengyan Qu
2,
Li Yan
4,
Tao Li
5,
Chunzhen Cheng
2,* and
Dongliang Qiu
1,*
1
College of Horticulture, Fujian Agriculture and Forestry University, Fuzhou 350002, China
2
College of Horticulture, Shanxi Agricultural University, Jinzhong 030801, China
3
College of Agriculture, Fujian Agriculture and Forestry University, Fuzhou 350002, China
4
College of Agriculture, Guizhou University, Guiyang 550025, China
5
Fruit Research Institute, Fujian Academy of Agricultural Sciences, Fuzhou 350013, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Curr. Issues Mol. Biol. 2023, 45(1), 379-399; https://doi.org/10.3390/cimb45010027
Submission received: 2 December 2022 / Revised: 22 December 2022 / Accepted: 31 December 2022 / Published: 3 January 2023
(This article belongs to the Special Issue Genetic Sight: Plant Traits during Postharvest)
Browse Figures
Versions Notes

Abstract

:
As one of the most important transcription factors regulating plant anthocyanin biosynthesis, MYB has attracted great attentions. In this study, we identified fifteen candidate anthocyanin biosynthesis related MYB (ABRM) proteins, including twelve R2R3-MYBs and three 1R-MYBs, from highbush blueberry. The subcellular localization prediction results showed that, with the exception of VcRVE8 (localized in chloroplast and nucleus), all of the blueberry ABRMs were nucleus-localized. The gene structure analysis revealed that the exon numbers of the blueberry ABRM genes varied greatly, ranging between one and eight. There are many light-responsive, phytohormone-responsive, abiotic stress-responsive and plant growth and development related cis-acting elements in the promoters of the blueberry ABRM genes. It is noteworthy that almost all of their promoters contain light-, ABA- and MeJA-responsive elements, which is consistent with the well-established results that anthocyanin accumulation and the expression of MYBs are influenced significantly by many factors, such as light, ABA and JA. The gene expression analysis revealed that VcMYB, VcMYB6, VcMYB23, VcMYBL2 and VcPH4 are expressed abundantly in blueberry fruits, and VcMYB is expressed the highest in the red, purple and blue fruits among all blueberry ABRMs. VcMYB shared high similarity with functionally proven ABRMs from many other plant species. The gene cloning results showed that VcMYB had three variable transcripts, but only the transient overexpression of VcMYB-1 promoted anthocyanin accumulation in the green fruits. Our study can provide a basis for future research on the anthocyanin biosynthesis related MYBs in blueberry.

1. Introduction

Anthocyanins, which are natural polyphenols that are widely found in many foods, possess many biological and health-beneficial abilities, such as anti-inflammatory, visual-improving and so on [1,2,3,4]. All of these abilities are achieved through their high antioxidant activity [5,6] and some other biological effects, such as their anti-proliferative effect [7], hepatoprotective effect [8] and anti-depressant behavior [9].
Blueberries are one of the richest sources of anthocyanins among common fruits [10], and the bio-availabilities of blueberry anthocyanins have been extensively investigated [11,12]. During the last two decades, a large number of studies have been conducted on anthocyanin metabolism [13,14,15,16,17,18,19,20,21,22], and some anthocyanin biosynthesis related structural genes (such as cinnamic acid 4-hydroxylase (C4H) [13], flavanone-3-hydroxylase (F3H) [14], dihydroflavonol reductase (DFR) [15], anthocyanidin synthase (ANS) [16]) and regulatory transcriptional factors (such as genes encoding MYBs and bHLHs [17,18,19,20,21,22]) were identified or functionally verified in blueberry.
The MYB transcription factor plays an important role in regulating the spatio-temporal expression of anthocyanin biosynthesis related structural genes and anthocyanin accumulation, and is one of the most important and widely investigated transcription factors involved in anthocyanin biosynthesis regulation [17,22]. The first plant MYB gene, C1, was discovered from maize [23], whose encoded protein was required for anthocyanin biosynthesis in the aleurone layer [24]. Since then, MYBs have been isolated from many plant species. Most MYB proteins contain conserved MYB domain/domains at their N-terminus. According to the number of their MYB domains, MYBs can be further classified into four types, i.e., 1R-MYB/MYB-related, R2R3-MYB, 3R-MYB and 4R-MYB. It is noteworthy that most of the reported anthocyanin biosynthesis related MYBs (ABRMs) were R2R3-MYBs, followed by 1R-MYB/MYB-related MYBs [25]. In blueberry, most of the reported anthocyanin metabolism regulatory transcription factors were MYBs [26]. For example, the up-regulated expression of VcMYB21 and VcR2R3MYB was confirmed to be associated with the UV-B-induced anthocyanin accumulation in blueberry pericarp [27]; VcMYB21 played a negative regulatory role in anthocyanin accumulation [28]; the transient overexpression of blueberry MYBA in an Antirrhinum majus MYB mutant restored the anthocyanin accumulation, and its co-expression with a heterologous bHLH could induce anthocyanin accumulation in tobacco leaves [29]; the pink fruit mutation phenotype of ‘Pink Lemonade’ was caused by the mutation of MYB1 [20]; the expression of VcUFGT in highbush blueberry was positively regulated by VcMYBA1 and negatively regulated by VcMYBC2 [30].
Although some studies have been conducted on blueberry ABRMs [31,32], their applications are restricted as almost all these reported ABRMs were obtained based on de novo assembled transcriptome data. The publication of the draft genome of blueberry [33,34] greatly facilitated the genome-wide identification of the functional and regulatory genes involved in anthocyanin biosynthesis [35]. Based on the genome data, Wang et al. [31] identified a total of 229 MYB members that could be further divided into 23 subfamilies, but they did not focus on the anthocyanin biosynthesis related members; Zhao et al. [17] identified 11 MYBs from blueberry fruits through homologous protein searching, using Arabidopsis, apple, grape and strawberry MYBs belonging to the MBW complex as queries. Recently, many ABRMs have been identified and functionally approved in various plant species, such as Arabidopsis [36], Helianthus tuberosus [37], monkeyflower [38], Eutrema salsugineum [39], Freesia hybrida [40], grape hyacinth [41], apple [42] and so on. In this study, for the exploration and characterization of blueberry ABRMs, we identified the blueberry ABRMs by homologous searches against the blueberry protein data provided by the highbush blueberry genome project using the reported ABRMs from some other plant species as queries, characterized their sequences, and investigated their corresponding genes’ expression patterns in blueberry fruits at five different ripening stages, based on our previously obtained transcriptome data and quantitative real time PCR (qRT-PCR) analysis. Moreover, the function of VcMYB (VaccDscaff1486-snap-gene-0.3), whose encoded protein showed high similarity with ten functionally proved ABRMs from other plant species (including Arabidopsis AtMYB114, AtMYB90, AtMYB75 and AtMYB113, H. tuberosus HtMYB2, monkeyflower PELAN, E. salsugineum EsMYB90, F. hybrida FhPAP1, grape hyacinth MaAN2 and apple MdMYB10), was further studied by transient overexpression in young blueberry fruits. The results obtained in this study will provide a foundation for the functional analysis and applications of blueberry anthocyanin biosynthesis related MYB genes, and will lay the foundations for research on the high-anthocyanin aimed blueberry breeding in the future.

2. Materials and Methods

2.1. Plant Materials

The plant materials used in this study were the fruits of four-year-old southern highbush blueberry ‘FL03’ at five different stages (green fruit (GF), pink fruit (PiF), red fruit (RF), purple fruit (PF) and blue fruit (BF)) [22]. After harvesting, the fruits were quickly taken back to the laboratory, washed with distilled water three times, immediately frozen in liquid nitrogen after draining the fruit surface with sterilized filter paper, and stored in the refrigerator at −80 °C for further use.

2.2. Identification of ABRM Proteins in Blueberry

The gDNA, cDNA and protein sequence files of the blueberries were downloaded from https://www.vaccinium.org/analysis/49 (accessed on 3 March 2021). To identify ABRM proteins in the blueberries, homologous protein sequence alignment was performed against the blueberry protein data, using recently reported ABRM protein sequences as queries with e-value ≤ 1 × 10−5 and similarity >50% as criteria. The screened sequences with the highest bit score were selected as candidate MYBs and were named according to their homologous proteins sharing the highest similarity with them. One exception is that one candidate MYB (VaccDscaff1486-snap-gene-0.3) was named as VcMYB to distinguish it from blueberry VcMYBA (MH105054) [32]. A phylogenetic tree was constructed by Maximum Likelihood method using MEGAX (Possion mode, complete deletion, and 1000 bootstrap values) to show the relationships among the blueberry ABRMs and the reported ABRMs from some other plants.

2.3. Bioinformatic Analysis of Blueberry ABRM Genes and Their Encoded Proteins

The physicochemical properties, conserved motifs (motif number set as 10) and domains, as well as the subcellular localization of the blueberry MYB proteins, were analyzed according to the method described by Zhang et al. [22]. Gene structure analysis was performed using GSDS (http://gsds.gao-lab.org/, accessed on 3 March 2021). The ClustalW program in MEGA 6.06 software was used for multiple protein sequence alignment, and the alignment results were incorporated into MEGA 6.06 for the construction of the phylogenetic tree using the neighbor-joining method under the criteria of the Poisson model, complete deletion and bootstrap value = 1000. The 2000 bp sequences to upstream the start codon of the MYBs were extracted from the blueberry genome database and considered as promoter sequences, and were then subjected to cis-acting element analysis using PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/, accessed on 3 March 2021).

2.4. Gene Expression Analysis

In our previous study, we sequenced the transcriptome of ‘FL03’ blueberry fruits at five different ripening stages (GF, PiF, RF, PF and BF). To study the expression patterns of these identified blueberry ABRMs, their FPKM (Fragments Per Kilobase of exon model per Million mapped fragments) values were first extracted from the transcriptome data and transformed into Log2(FPKM + 1) for heatmap drawing using TBtools software [43].
To validate the expression of the blueberry ABRMs, four highly expressed ABRMs, including VcMYB6, VcMYB23, VcMYBL2 and VcMYB, were selected and subjected to quantitative real time PCR analysis. Primers were designed according to their CDS sequences using Primer 3.0 (Table 1). A Trizol RNA Extraction Kit (TaKaRa, Dalian, China) was used to isolate the total RNA from the blueberry fruits at five different ripening stages. Then, high quality RNA was used for cDNA synthesis using TransScript All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (One-Step gDNA Removal) kit (TransGen, Beijing China). The qRT-PCR reactions were performed on a Bio-Rad CFX96TM real-time quantitative fluorescent PCR instrument using a TB Green Premix Ex Taq II (Tli RNaseH Plus; TaKaRa, Dalian, China) kit according to the manual. The relative expression levels of the selected blueberry ABRM genes in the fruits at different ripening stages were calculated using the 2−ΔΔCt method with GAPDH (Genbank ID: AY123769) as the internal reference gene [22]. Three biological and three technical replications were made for the qRT-PCR analysis of the selected genes.

2.5. Gene Cloning, Vector Construction and Transient Overexpression Analysis

A RevertAid First-strand cDNA synthesis Kit (Thermo Scientific, Shanghai, China) was used to synthesize the cDNA for gene cloning. The primers for VcMYB gene amplification were designed using Primer 3 (Table 1). The 25 μL PCR system contained 1 μL cDNA, 1 μL each of the forward and reverse primer, 12.5 μL 2 × Green mix and 9.5 μL ddH2O. The PCR conditions were set as follows: predenaturation at 95 °C for 3 min; 35 cycles of denaturation at 95 °C for 30 s, annealing at 59 °C for 30 s, and extension at 72 °C for 2.5 min; and final extension at 72 °C for 8 min. The electrophoresis detection results showed that there were three variable transcripts for VcMYB. The PCR products of the three transcripts were separately gel extracted, ligated into an 18-T vector and transformed into Escherichia coli DH5a. Positive clones were selected and sent to Beijing Liuhe Huada Gene Technology Co., Ltd. (Beijing, China) for sequencing verification. According to the sequencing results, the primers for the VcMYB gene vector construction were further designed and used for the amplification of the three variable transcripts (Table 1). The cloned fragments were ligated into the pBI123 vector using the Ready-to-use Seamless Cloning Kit (Sangon Biotech, Shanghai, China), and transformed into Agrobacterium tumefaciens GV3101. A. tumefaciens GV3101 carrying empty pBI123 (as control), pBI123-VcMYB-1, pBI123-VcMYB-2 and pBI123-VcMYB-3 vectors were cultured in the dark at 180 rpm and 28 °C until OD600 = 0.6~0.8 they were centrifuged at 5000 rpm for 4 min, resuspended using an MES solution (2-(N-Morpholino) and ethanesulfonic acid hydrate) solution (containing 10 mM MES, 10 mM MgCl2·6H2O and 200 μM acetosyringone) to a final concentration of OD600 = 0.6. Then, they were injected into the green fruits (at about 15 days post flowering (dpf), to further confirm the function of VcMYB-1, green fruits at 20 dpf were also used) of the ‘Legacy’ blueberry, cultured in the dark for 1 day and removed to normal light for fruit color change observation. At three days post treatment, the colour parameters (L*, a* and b* values) of the fruit pericarps were measured using a CR8 Portable Colorimeter (Shenzhen Threenh Technology Co., Ltd., Shenzhen, China), and the anthocyanin was extracted using the acidified ethanol [44] from the blueberry fruit pericarps. The anthocyanin content in the blueberry pericarps was measured and calculated according to the method of Zhuang et al. [45].

3. Results

3.1. The Identified Blueberry ABRMs

Through homologous protein searching, fifteen candidate blueberry ABRM proteins were identified (Table 2). The phylogenetic analysis results revealed that all of these blueberry ABRM proteins shared a close relationship with the query homologous proteins from other plants (Supplementary Figure S1). Among them, VcMYB shared high similarity, up to 93.40%, with the reported blueberry anthocyanin biosynthesis regulatory VcMYBA [32]. Moreover, it shared more than 50% sequence similarities with ten known ABRMs, including Arabidopsis AtMYB114 (74.36%), H. tuberosus HtMYB2 (62.25%), monkeyflower PELAN (59.87%), E. salsugineum EsMYB90 (59.35%), Arabidopsis AtMYB90 (PAP2) (58.97%) and AtMYB75(PAP1) (58.71%), F. hybrida FhPAP1 (56.86%), grape hyacinth MaAN2 (56.86%), Arabidopsis AtMYB113 (56.77%) and apple MdMYB10 (54.36%). VcMYB12 shared the highest similarity with Arabidopsis AtMYB12 (66.86%), followed by AtMYB12 and AtMYB111. The similarities of VcMYB123 with kiwifruit AcMYB123 and apple MYB9 were both higher than 70% (72.33% and 71.43%, respectively). VcMYBL2 shared the highest similarity with apple MdMYBL2 (65.29%), followed by eggplant SmelMYBL1 (51.61%). VcMYB6 shared the highest similarity with apple MdMYB6 (55.26%). VcPL shared the highest similarity with rice OsPL (75.19%). VcMYB24L shared the highest similarity with apple MdMYB24L (75.00%). VcRVE8 shared the highest similarity to Pyrus bretschneideri PbRVE8 (68.22%). VcCPC shared the highest similarity with Arabidopsis AtCPC (57.41%). VcMYBC1, VcMYB23, VcMYB340, VcPH4, VcMYBATV and VcMYB85 shared the highest similarity with kiwifruit AaMYBC1, apple MdMYB23, sweet potato IbMYB340, citrus CsPH4, tomato SlMYBATV and millet SiMYB85, respectively.

3.2. Physiobiochemical Properties and Sequence Characteristics of Blueberrry ABRMs

The identified blueberry ABRM proteins consisted of between 73 and 365 aa, with molecular weights ranging between 8407.08 and 40,095.85 Da, and isoelectric points (pI) ranging between 4.31 and 9.72. Their instability coefficients ranged between 36.10 and 79.67. All of these proteins were predicted to be hydrophilic proteins. The subcellular localization prediction results showed that all of these blueberry ARBMs were nucleus-localized, with the exception of VcRVE8 (localized to both chloroplast and nucleus) (Table 3). By analyzing the amino acid sequences, we found that VcMYB12, VcMYB85, VcMYB340, VcPL, VcMYB6, VcMYB23, VcMYBC1, VcMYB24L, VcMYB123, VcMYB, VcPH4 and VcMYBL2 have conserved R2 and R3 domains, indicating that they belong to the R2R3-MYB (2R-MYB). The remaining three ARBMs belong to 1R-MYB, of which VcMYBATV and VcCPC contain a R3 domain, and VcRVE8 contains a R1/2 domain (Figure 1).

3.3. Conserved Motifs in Blueberry ABRM Proteins and Gene Structures of Their Corresponding Genes

In total, we identified five conserved motifs from the blueberry ABRM proteins (Figure 2A). Among these motifs, Motif1 was found in all of the ABRMs. The R2R3 type blueberry ABRMs all contained Motif1~3, VcMYB23 contained two Motif3, and VcMYB contained an extra Motif5. VcPCP and VcMYBATV contained only one Motif1, VcRVE8 contained only one Motif1 and one Motif4.
The gene structure analysis results showed that the exon numbers of the blueberry ARBM genes ranged between one and eight (Figure 2B). VcRVE8 had the largest number of exons with eight, VcMYB24L had four exons, VcPH4 and VcMYB123 contained two exons, and VcMYB6 had only one exon. All the other blueberry ABRMs contained three exons.

3.4. Cis-Acting Elements in Promoters of Blueberry ABRM Genes

We further analyzed the cis-acting elements in the promoters of the blueberry ABRM genes. The results showed that there were many light-responsive, phytohormone-responsive, stress-responsive, and growth and development related elements in their promoters (Figure 3). In total, we identified ten types of light-responsive elements in their promoters. All of the blueberry ABRMs, with the exception of VcMYB, contained a light-responsive Box4 element in their promoter regions, and the promoters of 12 blueberry ABRM genes (except VcMYB24L, VcMYB6 and VcMYBATV) contained the light responsive G-box elements (Figure 3).
Nine types of phytohormone-responsive elements, including three gibberellin (GA)-responsive (P-box, TATC-box and GARE-motif), two methyl jasmonate (MeJA)-responsive (TGACG-motif and CGTCA-motif), one auxin-responsive (TAG-element), one abscisic acid (ABA)-responsive (ABRE), one salicylic acid (SA)-responsive (TCA-Element), and one ethylene-responsive elements (ERE), were found in the promoters of blueberry ABRM genes (Figure 3). With the exception of VcMYB24L, VcMYB6 and VcMYBATV, all the other ABRMs’ promoters contained ABA-responsive ABRE elements. With the exception of VcCPC, VcMYB85, VcMYBC1 and VcPH4, the promoters of all the other ABRM genes contained the MeJA-responsive TGACG-motif and CGTCA-motif elements. With the exception of VcPCP, VcMYB123, VcMYBC1, VcMYBL2 and VcPL, all the other ABRMs’ promoters contained ethylene-responsive ERE elements. In addition, auxin-, SA- and GA-responsive elements were found in the promoters of six, five and four ABRMs, respectively.
In total, six kinds of stress-related elements, including low temperature-responsive element LTR, anaerobic-induction related element ARE, MYB drought-inducibility related element MBS, defense and stress related element TC-rich elements, anoxic specific inducibility related element GC-motif and wounding related element WUN-motif, were identified in the blueberry ABRM promoters (Figure 3). Moreover, there were eleven, nine, six, five, four and three ABRMs contained ARE, LTR, MBS, GC-motif, TC-rich repeats and WUN-motif in their promoters, respectively.
Additionally, we also identified many growth and development related cis-acting elements in the promoters of the blueberry ABRM genes (Figure 3). Eight ABRMs contained the regulatory A-box element in their promoters; seven ABRMs’ promoters contained the zein metabolism regulation related O2-site element; seven ABRMs’ promoters contained the MYBHV1-binding site element CCAAT-box; four ABRMs’ promoters contained the meristem expression related element CAT-box; the promoters of VcMYB24L and VcMYB340 contained the endosperm expression related GCN4_motif element; the promoter of VcMYBL2 contained the circadian control related element. Moreover, the VcMYB24L promoter specifically contained the flavonoid biosynthetic related MBSl element.

3.5. Protein and Protein Interaction Analysis of Blueberry ABRM Proteins

Based on the Arabidopsis protein database, the STRING software was used to predict the interacting proteins of blueberry ABRMs (Figure 4). The results showed that VcCPC, VcMYB, VcMYB6, VcMYBATV, VcMYB23 and VcRVE8 were homologous protein of AtCPC (At2G46410), AtMYB114 (At1G66380), AtMYBR1 (At5G67300), AtTT2 (At5G35550), AtMYB15 (At3G23250) and AtRVE8 (At3G09600), respectively. AtPCP interacts with AtGL3 (At5G41315), AtEGL3 (At1G63650), AtGL2 (At1G79840) and AtTTG1 (At5G24520). AtMYB114 interacts with AtEGL3 (At1G63650), AtTT1 (At1G34790) and AtTTG1 (At5G24520). AtTT2 interacts with AtTT1 (At1G34790), AtTT8 (At4G09820), AtEGL3 (At1G63650), AtTTG1 (At5G24520) and AtGL3 (At5G41315). AtMYBR1 (At5G67300) interacts with AtRCAR3 (At5G53160). AtMYB15 (At3G23250) interacts with AtICE1 (At3G26744). And AtRVE8 interacts with AtLNK1 (At5G64170) and AtLNK2 (At3G54500).

3.6. Expression Analysis of Blueberry ABRM Genes

According to our transcriptome data, the expression patterns of the blueberry ABRM genes in fruits at different ripening stages were studied. It was found that VcMYB6, VcMYB23, VcMYB, VcMYBL2 and VcPH4 are expressed highly in blueberry fruits, but other ABRMs, such as VcMYB12, VcMYB123, VcPL, VcMYB24L and VcMYB340, showed either low expression (FPKM < 4) or are not expressed in the fruits (Figure 5). The expression level of VcMYB was low in GF (FPKM < 2), gradually increased in PiF (FPKM > 10), and then maintained at an abundant level in RF, PF and BF (FPKM > 40). The expression levels of VcMYB in RF and PF were both higher than that in BF. Moreover, its expression in the late three stages was found to be the highest among all the blueberry ABRMs and very significantly higher than that in GF and PiF, indicating that it might play an important role in regulating anthocyanin biosynthesis, particularly at the late fruit ripening stages. The expression level of VcMYB6 in fruits at all stages was high (FPKM > 10), and its expression level changed slightly during blueberry fruit ripening. The expression of VcMYB23 was the highest in RF and PF. VcMYBL2 showed a ‘fall-rise’ expression pattern, and its expression level in PiF was the lowest, but there was no significant expression difference at the late three ripening stages. VcPH4 also showed a ‘fall-rise’ expression profile during fruit ripening, but no significant difference was found among the fruits at different ripening stages.
For the validation of the expression changes of the blueberry ABRM genes in fruits during ripening, quantitative real time PCR (qRT-PCR) analysis of four selected genes, including VcMYB6, VcMYB23, VcMYBL2 and VcMYB, was performed. The results showed that the expression change patterns of these blueberry ABRMs during fruit ripening were mostly consistent with our transcriptome data (Figure 6), indicating that our transcriptome data is believable. Among them, the expression of VcMYB was found to be the lowest in GF, and its expression in PiF, RF, PF and BF was approximately 1.44-fold, 1.79-fold, 2.1-fold and 1.75-fold of GF, respectively.

3.7. Transient Overexpression Analysis of Three VcMYB Variable Transcripts

Given the high similarity with more than ten reported ABRM genes and its high expression in fruits, particularly at the late ripening stages, VcMYB was proposed to play a key role in regulating blueberry anthocyanin biosynthesis. To confirm its function, the gene was successfully cloned by reverse transcription PCR (RT-PCR). The electrophoresis detection results showed that this gene had three variable transcripts, which were all shorter than the reference cDNA sequence (VaccDscaff1486-snap-gene-0.3) (Figure 7A). The sequencing results showed that the lengths of these three transcripts were 786 bp, 704 bp and 568 bp, respectively, and they were termed as VcMYB-1, VcMYB-2 and VcMYB-3, in descending order of sequence length.
The three transcripts were separately inserted into the pBI123 vector, transformed into A. tumefaciens GV3101, and then transiently overexpressed in the young blueberry fruits. The results showed that only the transient overexpression of VcMYB-1 triggered anthocyanin accumulation in the young blueberry fruits (Figure 7B). For the green blueberry fruits, at approximately 15 days post-flowering (dpf), at three days post-treatment, the areas injected with A. tumefaciens GV3101 carrying VcMYB-1 became purple-red, and the L*, a* and b* values of the fruit pericarps overexpressing VcMYB-1 were all significantly lower than the control check group (CK) (Figure 7C). For the green fruits, at about 20 dpf, at three days post-treatment, the injected areas became much redder than the fruits at 15 dpf. By measuring the anthocyanin content, we found that the anthocyanin content in the VcMYB-1 overexpressing fruit pericarps was approximately 1.56-fold of the CK (Figure 7D–F). However, no obvious pigmentation was found in the areas injected with A. tumefaciens GV3101 carrying VcMYB-2 and VcMYB-3, indicating that their transient overexpression could not trigger anthocyanin accumulation in the blueberry fruit pericarps.

4. Discussion

According to their R repeat numbers and sequences, MYBs could be classified into four major types, i.e., 1R-MYB/MYB-related, R2R3-MYB, 3R-MYB and 4R-MYB [25]. In plants, R2R3-MYBs and 1R-MYBs are the major types of MYBs. It was frequently discovered that most of the ABRMs belong to the R2R3 type, followed by the 1R type [62]. In this study, we identified fifteen ABRMs from the blueberry genome data through the homologous protein sequence alignment method. Among these ABRMs, twelve were R2R3-MYBs and three were 1R-MYBs. The subcellular localization prediction results showed that almost all of these ABRMs were nucleus-localized, which was consistent with the localization characteristics of the transcription factors. The gene structure analysis revealed that the exon number of blueberry ABRMs varied greatly, ranging between one and eight. The gene expression analysis showed that only VcMYB6, VcMYB23, VcMYB, VcMYBL2 and VcPH4 were expressed highly in fruits at different ripening stages, suggesting that they may play more important roles in regulating anthocyanin biosynthesis in blueberry.
MYBs function in regulating anthocyanin biosynthesis by associating with bHLH, WD40 and anthocyanin biosynthesis structural genes. Wang et al. [49] reported that exogenous cytokinin treatment could induce anthocyanin accumulation in red-fleshed apple callus by promoting the expression of MdDFR, MdUFGT, MdMYB10 and MdbHLH3 genes, and by suppressing the expression of MYBL2. Moreover, they found that MdMYBL2 could interact with MdbHLH3. In the callus overexpressing MdMYBL2, anthocyanin accumulation decreased, and the expression levels of MdDFR, MdUFGT, MdMYB10 and MdbHLH3 were all significantly inhibited. Actinidia arguta AaMYBC1 could interact with AabHLH42. The virus-induced gene silencing of AaMYBC1 resulted in decreased anthocyanin accumulation and the reduced expression of anthocyanin biosynthesis structural genes in ‘HB’ kiwifruit [57]. Eggplant SmMYB86, a negative regulator of anthocyanin biosynthesis, can inhibit the expression of SmCHS, SmF3H and SmANS by binding to their promoters [63]. The down-regulation of SmMYB86 resulted in anthocyanin content reduction and SmCHS, SmF3H and SmANS gene expression up-regulation, and its overexpression resulted in a significant decrease in the anthocyanin content in eggplant.
In this study, we predicted the protein-protein interaction network of blueberry ARBMs. According to their interacting proteins, it was predicted that the functions of these MYBs varied. VcCPC, VcMYB6 and VcMYBATV were found to be highly homologous to AtCPC, AtMYBR1 and AtTT2, respectively. AtCPC is a MYB that negatively regulates anthocyanin accumulation [64], suggesting that VcCPC might play a negative role in regulating the anthocyanin biosynthesis in blueberry. AtMYBR1 (also called AtMYB44) is involved in the abiotic stress responses of A. thaliana and exhibited a negative regulatory role in anthocyanin biosynthesis. Sweet potato IbMYB44 could interact with IbMYB340 and IbNAC56a/b, thereby inhibiting the formation of the MYB340-BHLH2-NAC56 complex and negatively regulating the accumulation of anthocyanins [52]. Apple MdMYB6 can bind to the promoters of MdANS and MdGSTF12, and the overexpression of MdMYB6 in red apple callus would reduce anthocyanin accumulation and inhibit the expression of MdANS and MdGSTF12 [51]. RCAR3, the interacting protein of AtMYBR1, is an ABA receptor regulator and plays a pivotal role in activating ABA signaling [65], suggesting that VcMYB6 might play a role in the ABA-regulated anthocyanin biosynthesis in blueberry. AtTT2 (AtMYB123) is mainly responsible for the biosynthesis regulation of tannins, such as proanthocyanidins [66]. VcMYB23 and VcRVE8 are homologous to AtMYB15 and AtRVE8, respectively. In Arabidopsis, the AtMYB15 interacts with AtICE1, and AtRVE interacts with AtLNK2 and AtLNK2. ICE1 plays an important role in plants’ responses to low temperatures [67], while LNK1 and LNK2 play roles in the integrated regulation of light signal responses and circadian regulation [68,69], and they can also act as corepressors of phenylpropanoid metabolism by interacting with MYB [70], suggesting that VcMYB23 and VcREV8 might be involved in the low temperature and light triggered anthocyanin biosynthesis in blueberry, respectively.
It is worth noting that VcMYB shared the highest similarity with one reported blueberry MYB (VcMYBA) [32] and was identified as a homologous protein of many positive anthocyanin regulatory MYB proteins, such as Arabidopsis AtMYB114, AtMYB90 (PAP2), AtMYB75 (PAP1) and AtMYB113, Helianthus tuberosus HtMYB2, monkeyflower PELAN, Eutrema salsugineum EsMYB90, Freesia hybrida FhPAP1, grape hyacinth MaAN2 and apple MdMYB10. In Arabidopsis, the AtMYB75/90/113/114 members of the SG6 subfamily of the MYB family have been proven to be involved in the regulation of anthocyanin biosynthesis; the SG7 subfamily members AtMYB11/12/111 are involved in the flavonol biosynthesis regulation; the AtMYB5/123 are involved in the regulation of tannin biosynthesis, and AtMYB3/4/7/32 encode the transcriptional repressors [36]. The expression levels of HtMYB2 in the root, stem, leaf and tuber epidermis of the red-skinned tubers variety ‘QY1’ are higher than those of the white-skinned tubers variety ‘QY3’. The heterologous overexpression of HtMYB2 in tobacco activates the anthocyanin biosynthesis pathway and accumulated pigments in leaves [37]. PyMYB114 and PyMYB10 can activate anthocyanin biosynthesis by interacting with PybHLH3; PyWRKY26 and PybHLH3 can synergistically target the promoter of PyMYB114 and participate in the regulation of anthocyanin biosynthesis and transportation [71]. The co-expression of the PalbHLH1 and PalMYB90 genes in Populus alba could improve its disease resistance by promoting flavonoid synthesis [72]. The overexpression of MdMYB90-like upregulated the expression of the anthocyanin biosynthesis related structural genes and regulatory genes (including MdCHS, MdCHI, MdANS, MdUFGT, MdbHLH3 and MdMYB1) and induced the accumulation of pigments in transgenic callus and pericarps [73]. The overexpression of onion MYB1 can restore anthocyanin accumulation and the cyanic petal phenotype of the A. majus R2R3-MYB mutant, and heterologous co-expression of MYB1 and bHLH can promote ectopic red pigmentation in garlic plants [74]. VcMYB is highly homologous to AtMYB114, which is a SG6 subfamily member of the Arabidopsis MYB family that positively regulates anthocyanin biosynthesis. Moreover, based on our transcriptome data, we found that the expression levels of VcMYB in RF, PF and BF were the highest among all members. Our qRT-PCR results also revealed that VcMYB was expressed significantly higher in the fruits at the red, purple and blue stages, accounting for 1.79-fold, 2.1-fold and 1.75-fold of that in GF, respectively. These results suggested that VcMYB may be a pivotal positive regulator of anthocyanin biosynthesis in blueberry. To verify the function of VcMYB in anthocyanin biosynthesis in blueberry, it was further cloned and functionally analyzed. Similar to sweet potato IbMYB1 [75], the VcMYB also has three transcripts. The transient transformation results showed that only the longest VcMYB transcript, VcMYB-1, could promote anthocyanin accumulation in young blueberry fruit pericarps.
These results have demonstrated that the expression of anthocyanin regulatory MYBs was greatly influenced by light, ABA and MeJA [76,77,78,79]. Consistently, in this study, we identified many light-, ABA- and MeJA-elements in the promoters of blueberry ABRMs. Light quality and quantity greatly and widely affect the biosynthesis of anthocyanins or flavonoids in various plants [79,80]. UV-B treatment could upregulate the expression of the HY5 gene that encodes the UV receptor at the green fruit stage, and HY5 promoted anthocyanin accumulation by upregulating the expression of VcMYBA1, while inhibiting the expression of VcMYBC2 [30]. However, the expression of VcMYBC2 was induced by UV-B treatment in the mature fruits, which could inhibit the excessive accumulation of anthocyanins. JA is an important signal for the biosynthesis of plants’ secondary metabolites, and its induction role in anthocyanin accumulation has also been found in many plants [77]. Exogenous JA treatment can activate the expression of anthocyanin biosynthesis related structural genes and regulatory transcription factor genes, and enhance anthocyanin accumulation in Arabidopsis under far-red light [81]. In apple, JA can induce anthocyanin and proanthocyanin accumulations by regulating the JAZ-TRB1-MyB9 complex [78]. In addition, MeJA treatment could induce the expression of MdMYB9 and MdMYB11, whose overexpression in apple callus could improve anthocyanin and proanthocyanin accumulation, and this promotion effect could be further enhanced by MeJA [82]. ABA is considered to be one of the most important positive regulators of the ripening of non-climacteric fruits and anthocyanin biosynthesis [32,83,84]. Karppinen et al. [85] found that exogenous ABA treatment could promote the accumulation of anthocyanins in V. myrtillus. Han et al. [32] found that the expression levels of CHS, CHI, DRF, LDOX/ANS and some other anthocyanin biosynthesis related genes were significantly up-regulated in blueberries when treated with ABA at the late ripening stages, and were highly positively correlated with the anthocyanin content. Consistently, in our present study, we found that 16 of the 19 identified blueberry ABRM genes contained the ABA-responsive ABRE element in their promoters, indicating that ABA have a significant function in influencing the expression of blueberry ABRMs and in regulating anthocyanin biosynthesis.

5. Conclusions

In this study, we identified fifteen candidate ABRM proteins from blueberry. Among them, twelve were R2R3-MYBs and three were 1R-MYBs, which could be well supported by their conserved motif types and numbers. With the exception of VcRVE8, which was localized in the chloroplast and nucleus, all of the blueberry ABRMs were predicted to be nucleus-localized. The exon numbers of the blueberry ABRM genes varied significantly. The promoters of ABRMs contain a large number of light-, ABA- and MeJA-responsive elements, indicating that the influences of these factors on anthocyanin accumulation were achieved, at least partially, by regulating the expression of the ABRM genes. VcMYB was highly expressed in blueberry fruits at the late ripening stages. This gene had three transcripts; however, only the transient overexpression of its longest transcripts (VcMYB-1) could promote anthocyanin accumulation in young blueberry fruits. Our study will provide a basis for the applications of the blueberry anthocyanin biosynthesis related MYB genes, and will lay the foundation for the high-anthocyanin aimed blueberry selection and breeding in the future.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/cimb45010027/s1. Figure S1: Phylogenetic analysis result of anthocyanin biosynthesis related MYB proteins from blueberry and some other plant species.

Author Contributions

Conceptualization, Y.Z., C.C. and D.Q.; methodology, Y.Z., B.W. and D.H.; software, Y.Z. and C.C.; validation, B.W. and Y.Z.; formal analysis, Y.Z., D.H. and C.C.; investigation, Y.Z., H.W., P.Q. and L.Y.; resources, D.Q., X.Y. and T.L.; data curation, C.C. and B.W.; writing—original draft preparation, Y.Z. and C.C.; writing—review and editing, C.C. and D.Q.; visualization, Y.Z. and D.H.; supervision, D.Q.; project administration, D.Q.; funding acquisition, D.Q., C.C., T.L. and X.Y. All authors have read and agreed to the published version of the manuscript.

Funding

The work supported by the Science and Technology Development Fund of Fujian Agriculture and Forestry University (Agriculture and Forestry University Section [2015] No. 36), the Construction of Plateau Discipline of Fujian Province (102/71201801101), the National Natural Science Foundation of China (31860225), the Natural Science Basic Research Program of Shanxi Province (202203021211267), the Fund for High-level Talents of Shanxi Agricultural University (2021XG010), the Reward Fund for PhDs and Postdoctors of Shanxi Province (SXBYKY2022004), Qian Kehe Foundation ([2019]1408), Qian Kehe platform Personnel ([2018]5781) and Special Fund for Scientific Research Institutes in the Public Interest of Fujian Province (2019R1028-1).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data are available in this article.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Joseph, J.A.; Shukitt-Hale, B.; Denisova, N.A.; Bielinski, D.; Martin, A.; Mcewen, J.J.; Bickford, P.C. Reversals of age-related declines in neuronal signal transduction, cognitive, motor behavioral deficits with blueberry, spinach, or strawberry dietary supplementation. J. Neurosci. 1999, 19, 8114–8121. [Google Scholar] [CrossRef] [PubMed]
  2. Hou, D.X.; Fujii, M.; Terahara, N.; Yoshimoto, M. Molecular mechanisms behind the chemopreventive effects of anthocyanidins. J. Biomed. Biotechnol. 2004, 5, 321–325. [Google Scholar] [CrossRef] [PubMed]
  3. Miguel, M. Anthocyanins: Antioxidant and/or anti-inflammatory activities. J. Appl. Pharm. Sci. 2011, 1, 7–15. [Google Scholar]
  4. Mazza, G.; Kay, C.D.; Cottrell, T.; Holub, B.J. Absorption of anthocyanins from blueberries and serum antioxidant status in human subjects. J. Agric. Food Chem. 2002, 50, 7731–7737. [Google Scholar] [CrossRef] [PubMed]
  5. Chun, O.K.; Kim, D.O.; Lee, C.Y. Superoxide radical scavenging activity of the major polyphenols in fresh plums. J. Agric. Food Chem. 2003, 51, 8067–8072. [Google Scholar] [CrossRef]
  6. Williams, R.J.; Spencer, J.P.; Rice-Evans, C. Flavonoids: Antioxidants or signalling molecules? Free Radic. Biol. Med. 2004, 36, 838–849. [Google Scholar] [CrossRef]
  7. Ma, Y.; Li, Y.; Zhang, H.; Wang, Y.; Wu, C.; Huang, W. Malvidin induces hepatic stellate cell apoptosis via the endoplasmic reticulum stress pathway and mitochondrial pathway. Food Sci. Nutr. 2020, 8, 5095–5106. [Google Scholar] [CrossRef]
  8. Liu, Y.; Zhang, D.; Hu, J.; Liu, G.; Chen, J.; Sun, L.; Jiang, Z.; Zhang, X.; Chen, Q.; Ji, B. Visible light-induced lipid peroxidation of unsaturated fatty acids in the retina and the inhibitory effects of blueberry polyphenols. J Agric. Food Chem. 2015, 63, 9295–9305. [Google Scholar] [CrossRef]
  9. Gapski, A.; Gomes, T.M.; Bredun, M.A.; Ferreira-Lima, N.E.; Ludka, F.K.; Bordignon-Luiz, M.T.; Burin, V.M. Digestion behavior and antidepressant-like effect promoted by acute administration of blueberry extract on mice. Food Res. Int. 2019, 125, 108618. [Google Scholar] [CrossRef]
  10. Kalt, W.; Cassidy, A.; Howard, L.R.; Krikorian, R.; Stull, A.J.; Tremblay, F.; Zamora-Ros, R. Recent research on the health benefits of blueberries and their anthocyanins. Adv. Nutr. 2020, 11, 224–236. [Google Scholar] [CrossRef]
  11. Yang, S.; Wang, C.; Li, X.; Wu, C.; Liu, C.; Xue, Z.; Kou, X. Investigation on the biological activity of anthocyanins and polyphenols in blueberry. J. Food Sci. 2021, 86, 614–627. [Google Scholar] [CrossRef]
  12. Herrera-Balandrano, D.D.; Chai, Z.; Beta, T.; Feng, J.; Huang, W. Blueberry anthocyanins: An updated review on approaches to enhancing their bioavailability. Trends Food Sci. Technol. 2021, 118, 808–821. [Google Scholar] [CrossRef]
  13. Li, X.; Pei, J.; Zhang, Z.; Wu, L.; Liu, H.; Li, Y.; Li, H. Molecular cloning and expression of chalcone synthase gene in blueberry. J. Northeast For. Univ. 2012, 40, 60–65. (In Chinese) [Google Scholar]
  14. Zhang, C.; Guo, Q.; Liu, Y.; Liu, H.; Wang, F.; Jia, C. Molecular cloning and functional analysis of a flavanone 3-hydroxylase gene from blueberry. J. Hortic. Sci. Biotechnol. 2016, 92, 57–64. [Google Scholar] [CrossRef]
  15. Song, Y.; Dou, L.; Zhang, H.; Zhang, Z.; Li, Y. Cloning and expression of VcDFR gene from ‘Jersey’ blueberry. J. Fruit Sci. 2014, 31, 784–792. (In Chinese) [Google Scholar]
  16. Li, X.; Pei, J.; Zhang, Z.; Wu, L.; Liu, H.; Li, H.; Li, Y. Molecular cloning and expression analysis of VcANS gene in blueberry. J. Northwest AF Univ. (Nat. Sci. Ed.) 2012, 40, 201–209. (In Chinese) [Google Scholar]
  17. Zhao, M.; Li, J.; Zhu, L.; Chang, P.; Li, L.; Zhang, L. Identification and characterization of MYB-bHLH-WD40 regulatory complex members controlling anthocyanidin biosynthesis in blueberry fruits development. Genes 2019, 10, 496. [Google Scholar] [CrossRef] [Green Version]
  18. Yang, J.; Li, B.; Shi, W.; Gong, Z.; Chen, L.; Hou, Z. Transcriptional activation of anthocyanin biosynthesis in developing fruit of blueberries (Vaccinium corymbosum L.) by preharvest and postharvest UV irradiation. J. Agric. Food Chem. 2018, 66, 10931–10942. [Google Scholar] [CrossRef] [PubMed]
  19. Lin, T.; Walworth, A.; Zong, X.; Danial, G.H.; Song, G.Q. VcRR2 regulates chilling-mediated flowering through expression of hormone genes in a transgenic blueberry mutant. Hortic. Res.-Engl. 2019, 6, 96. [Google Scholar] [CrossRef] [Green Version]
  20. Die, J.V.; Jones, R.W.; Ogden, E.L.; Ehlenfeldt, M.K.; Rowland, L.J. Characterization and analysis of anthocyanin-related genes in wild-type blueberry and the pink-fruited mutant cultivar ‘Pink Lemonade’: New insights into anthocyanin biosynthesis. Agronomy 2020, 10, 1296. [Google Scholar] [CrossRef]
  21. Günther, C.S.; Dare, A.P.; Mcghie, T.K.; Deng, C.; Lafferty, D.J.; Plunkett, B.J.; Grierson, E.R.P.; Turner, J.L.; Jaakola, L.; Albert, N.W.; et al. Spatiotemporal modulation of flavonoid metabolism in blueberries. Front. Plant Sci. 2020, 11, 545. [Google Scholar] [CrossRef] [PubMed]
  22. Zhang, Y.; Liu, F.; Wang, B.; Wu, H.; Wu, J.; Liu, J.; Sun, Y.; Cheng, C.; Qiu, D. Identification, characterization and expression analysis of anthocyanin biosynthesis-related bHLH genes in blueberry (Vaccinium corymbosum L.). Int. J. Mol. Sci. 2021, 22, 13274. [Google Scholar] [CrossRef] [PubMed]
  23. Paz-Ares, J.; Ghosal, D.; Wienand, U.; Peterson, P.A.; Saedler, H. The regulatory c1 locus of Zea mays encodes a protein with homology to myb proto-oncogene products and with structural similarities to transcriptional activators. EMBO J. 1987, 6, 3553–3558. [Google Scholar] [CrossRef] [PubMed]
  24. Lloyd, A.M.; Walbot, V.; Davis, R.W. Arabidopsis and Nicotiana anthocyanin production activated by maize regulator R and C1. Science 1992, 258, 1773–1775. [Google Scholar] [CrossRef] [PubMed]
  25. Dubos, C.; Stracke, R.; Grotewold, E.; Weisshaar, B.; Martin, C.; Lepiniec, L. MYB transcription factors in Arabidopsis. Trends Plant Sci. 2010, 15, 573–581. [Google Scholar] [CrossRef] [PubMed]
  26. Lafferty, D.J.; Espley, R.V.; Deng, C.H.; Gunther, C.S.; Plunkett, B.; Turner, J.L.; Jaakola, L.; Karppinen, K.; Allan, A.C.; Albert, N.W. Hierarchical regulation of MYBPA1 by anthocyanin- and proanthocyanidin-related MYB proteins is conserved in Vaccinium species. J. Exp. Bot. 2021, 73, 1344–1356. [Google Scholar] [CrossRef]
  27. Nguyen, C.T.T.; Lim, S.; Lee, J.G.; Lee, E.J. VcBBX, VcMYB21, and VcR2R3MYB transcription factors are involved in UV-B-Induced anthocyanin biosynthesis in the peel of harvested blueberry fruit. J. Agric. Food Chem. 2017, 65, 2066–2073. [Google Scholar] [CrossRef]
  28. Liu, Z.S.; Yuan, Y.H.; Zhang, T.; Zhang, L.Y. Expression characteristics of the transcription factor VcMYB21 in blueberry fruit coloration and response to UV in seedling. Plant Physiol. J. 2017, 53, 115–125. (In Chinese) [Google Scholar]
  29. Plunkett, B.J.; Espley, R.V.; Dare, A.P.; Warren, B.A.W.; Grierson, E.R.P.; Cordiner, S.; Turner, J.L.; Allan, A.C.; Albert, N.W.; Davies, K.M.; et al. MYBA from blueberry (Vaccinium Section Cyanococcus) is a subgroup 6 type R2R3MYB transcription factor that activates anthocyanin production. Front. Plant Sci. 2018, 9, 1300. [Google Scholar] [CrossRef]
  30. Li, T.; Yamane, H.; Tao, R. Preharvest long-term exposure to UV-B radiation promotes fruit ripening and modifies stage-specific anthocyanin metabolism in highbush blueberry. Hortic. Res. 2021, 8, 67. [Google Scholar] [CrossRef]
  31. Wang, A.; Liang, K.; Yang, S.; Cao, Y.; Wang, L.; Zhang, M.; Zhou, J.; Zhang, L. Genome-wide analysis of MYB transcription factors of Vaccinium corymbosum and their positive responses to drought stress. BMC Genom. 2021, 22, 565. [Google Scholar] [CrossRef] [PubMed]
  32. Han, T.; Wu, W.; Li, W. Transcriptome analysis revealed the mechanism by which exogenous ABA increases anthocyanins in blueberry fruit during veraison. Front. Plant Sci. 2021, 12, 758215. [Google Scholar] [CrossRef] [PubMed]
  33. Gupta, V.; Estrada, A.D.; Blakley, I.; Reid, R.; Patel, K.; Meyer, M.D.; Andersen, S.U.; Brown, A.F.; Lila, M.A.; Loraine, A.E. RNA-Seq analysis and annotation of a draft blueberry genome assembly identifies candidate genes involved in fruit ripening, biosynthesis of bioactive compounds, and stage-specific alternative splicing. Gigascience 2015, 4, 5. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Wang, J.; Wisecaver, J.H.; Yocca, A.E.; Alger, E.I.; Tang, H.; Xiong, Z.; Callow, P.; Ben-Zvi, G.; Brodt, A.; Baruch, K.; et al. Haplotype-phased genome and evolution of phytonutrient pathways of tetraploid blueberry. Gigascience 2019, 8, giz012. [Google Scholar]
  35. Rowland, L.J.; Alkharouf, N.; Darwish, O.; Ogden, E.L.; Polashock, J.J.; Bassil, N.V.; Main, D. Generation and analysis of blueberry transcriptome sequences from leaves, developing fruit, and flower buds from cold acclimation through deacclimation. BMC Plant Biol. 2012, 12, 46. [Google Scholar] [CrossRef] [Green Version]
  36. Stracke, R.; Werber, M.; Weisshaar, B. The R2R3-MYB gene family in Arabidopsis thaliana. Curr. Opin. Plant Biol. 2001, 4, 447–456. [Google Scholar] [CrossRef]
  37. Gao, J.; Sun, X.; Zong, Y.; Yang, S.; Wang, L.; Liu, B. Functional MYB transcription factor gene HtMYB2 is associated with anthocyanin biosynthesis in Helianthus tuberosus L. BMC Plant Biol. 2020, 20, 247. [Google Scholar] [CrossRef]
  38. Yuan, Y.W.; Sagawa, J.M.; Frost, L.; Vela, J.P.; Bradshaw, H.D., Jr. Transcriptional control of floral anthocyanin pigmentation in monkeyflowers (Mimulus). New Phytol 2014, 204, 1013–1027. [Google Scholar] [CrossRef] [Green Version]
  39. Qi, Y.; Gu, C.; Wang, X.; Gao, S.; Li, C.; Zhao, C.; Li, C.; Ma, C.; Zhang, Q. Identification of the Eutrema salsugineum EsMYB90 gene important for anthocyanin biosynthesis. BMC Plant Biol. 2020, 20, 186. [Google Scholar] [CrossRef]
  40. Li, Y.; Shan, X.; Tong, L.; Wei, C.; Lu, K.; Li, S.; Kimani, S.; Wang, S.; Wang, L.; Gao, X. The conserved and particular roles of the R2R3-MYB regulator FhPAP1 from Freesia hybrida in flower anthocyanin biosynthesis. Plant Cell Physiol 2020, 61, 1365–1380. [Google Scholar] [CrossRef]
  41. Chen, K.; Du, L.; Liu, H.; Liu, Y. A novel R2R3-MYB from grape hyacinth, MaMybA, which is different from MaAN2, confers intense and magenta anthocyanin pigmentation in tobacco. BMC Plant Biol. 2019, 19, 390. [Google Scholar] [CrossRef] [Green Version]
  42. Jia, D.; Li, Z.; Dang, Q.; Shang, L.; Shen, J.; Leng, X.; Wang, Y.; Yuan, Y. Anthocyanin biosynthesis and methylation of the MdMYB10 promoter are associated with the red blushed-skin mutant in the red striped-skin “Changfu 2” apple. J. Agric. Food Chem. 2020, 68, 4292–4304. [Google Scholar] [CrossRef]
  43. Chen, C.; Chen, H.; Zhang, Y.; Thormas, H.; Frank, M.; He, Y.; Xia, R. TBtools: An integrative toolkit developed for interactive analyses of big biological data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef]
  44. Fuleki, T.; Francis, F. Quantitative methods for anthocyanins. J. Food Sci. 1968, 33, 266–274. [Google Scholar] [CrossRef]
  45. Zhuang, L.; Huang, G.; Li, X.; Xiao, J.; Guo, L. Effect of different LED lights on aliphatic glucosinolates metabolism and biochemical characteristics in broccoli sprouts. Food Res. Int. 2022, 154, 111015. [Google Scholar] [CrossRef]
  46. Stracke, R.; Jahns, O.; Keck, M.; Tohge, T.; Niehaus, K.; Fernie, A.R.; Weisshaar, B. Analysis of PRODUCTION OF FLAVONOL GLYCOSIDES-dependent flavonol glycoside accumulation in Arabidopsis thaliana plants reveals MYB11-, MYB12- and MYB111-independent flavonol glycoside accumulation. New Phytol. 2010, 188, 985–1000. [Google Scholar] [CrossRef]
  47. Wang, L.; Tang, W.; Hu, Y.; Zhang, Y.; Sun, J.; Guo, X.; Lu, H.; Yang, Y.; Fang, C.; Niu, X.; et al. A MYB/bHLH complex regulates tissue-specific anthocyanin biosynthesis in the inner pericarp of red-centered kiwifruit Actinidia chinensis cv. Hongyang. Plant J. 2019, 99, 359–378. [Google Scholar] [CrossRef]
  48. An, J.P.; An, X.H.; Yao, J.F.; Wang, X.N.; You, C.X.; Wang, X.F.; Hao, Y.J. BTB protein MdBT2 inhibits anthocyanin and proanthocyanidin biosynthesis by triggering MdMYB9 degradation in apple. Tree Physiol 2018, 38, 1578–1587. [Google Scholar] [CrossRef]
  49. Wang, Y.; Sun, J.; Wang, N.; Xu, H.; Qu, C.; Jiang, S.; Fang, H.; Su, M.; Zhang, Z.; Chen, X. MdMYBL2 helps regulate cytokinin-induced anthocyanin biosynthesis in red-fleshed apple (Malus sieversii f. niedzwetzkyana) callus. Funct. Plant Biol 2019, 6, 187–196. [Google Scholar] [CrossRef]
  50. Moglia, A.; Florio, F.E.; Iacopino, S.; Guerrieri, A.; Milani, A.M.; Comino, C.; Barchi, L.; Marengo, A.; Cagliero, C.; Rubiolo, P.; et al. Identification of a new R3 MYB type repressor and functional characterization of the members of the MBW transcriptional complex involved in anthocyanin biosynthesis in eggplant (S. melongena L.). PLoS ONE 2020, 15, e0232986. [Google Scholar]
  51. Xu, H.; Zou, Q.; Yang, G.; Jiang, S.; Fang, H.; Wang, Y.; Zhang, J.; Zhang, Z.; Wang, N.; Chen, X. MdMYB6 regulates anthocyanin formation in apple both through direct inhibition of the biosynthesis pathway and through substrate removal. Hortic. Res. 2020, 7, 72. [Google Scholar] [CrossRef] [PubMed]
  52. Wei, Z.Z.; Hu, K.D.; Zhao, D.L.; Tang, J.; Huang, Z.Q.; Jin, P.; Li, Y.H.; Han, Z.; Hu, L.Y.; Yao, G.F.; et al. MYB44 competitively inhibits the formation of the MYB340-bHLH2-NAC56 complex to regulate anthocyanin biosynthesis in purple-fleshed sweet potato. BMC Plant Biol. 2020, 20, 258. [Google Scholar] [CrossRef] [PubMed]
  53. Akhter, D.; Qin, R.; Nath, U.K.; Eshag, J.; Jin, X.; Shi, C. A rice gene, OsPL, encoding a MYB family transcription factor confers anthocyanin synthesis, heat stress response and hormonal signaling. Gene 2019, 699, 62–72. [Google Scholar] [CrossRef] [PubMed]
  54. Wang, Y.; Liu, W.; Jiang, H.; Mao, Z.; Wang, N.; Jiang, S.; Xu, H.; Yang, G.; Zhang, Z.; Chen, X. The R2R3-MYB transcription factor MdMYB24-like is involved in methyl jasmonate-induced anthocyanin biosynthesis in apple. Plant Physiol. Biochem. 2019, 139, 273–282. [Google Scholar] [CrossRef] [PubMed]
  55. Li, X.; Wu, T.; Liu, H.; Zhai, R.; Wen, Y.; Shi, Q.; Yang, C.; Wang, Z.; Ma, F.; Xu, L. REVEILLE transcription factors contribute to the nighttime accumulation of anthocyanins in ‘Red Zaosu’ (Pyrus bretschneideri Rehd.) pear fruit skin. Int. J. Mol. Sci. 2020, 21, 1634. [Google Scholar] [CrossRef] [Green Version]
  56. Zhu, H.F.; Fitzsimmons, K.; Khandelwal, A.; Kranz, R.G. CPC, a single-repeat R3 MYB, is a negative regulator of anthocyanin biosynthesis in Arabidopsis. Mol Plant 2009, 2, 790–802. [Google Scholar] [CrossRef]
  57. Li, Y.; Cui, W.; Qi, X.; Lin, M.; Qiao, C.; Zhong, Y.; Hu, C.; Fang, J. MicroRNA858 negatively regulates anthocyanin biosynthesis by repressing AaMYBC1 expression in kiwifruit (Actinidia arguta). Plant Sci. 2020, 296, 110476. [Google Scholar] [CrossRef]
  58. An, J.P.; Li, R.; Qu, F.J.; You, C.X.; Wang, X.F.; Hao, Y.J. R2R3-MYB transcription factor MdMYB23 is involved in the cold tolerance and proanthocyanidin accumulation in apple. Plant J. 2018, 96, 562–577. [Google Scholar] [CrossRef] [Green Version]
  59. Zhang, Y.; Ye, J.; Liu, C.; Xu, Q.; Long, L.; Deng, X. Citrus PH4-Noemi regulatory complex is involved in proanthocyanidin biosynthesis via a positive feedback loop. J. Exp. Bot. 2020, 71, 1306–1321. [Google Scholar] [CrossRef]
  60. Qiu, Z.; Wang, H.; Li, D.; Yu, B.; Hui, Q.; Yan, S.; Huang, Z.; Cui, X.; Cao, B. Identification of candidate HY5-dependent and -independent regulators of anthocyanin biosynthesis in tomato. Plant Cell Physiol. 2019, 60, 643–656. [Google Scholar] [CrossRef]
  61. Bai, H.; Song, Z.; Zhang, Y.; Li, Z.; Wang, Y.; Liu, X.; Ma, J.; Quan, J.; Wu, X.; Liu, M.; et al. The bHLH transcription factor PPLS1 regulates the color of pulvinus and leaf sheath in foxtail millet (Setaria italica). Appl. Genet. 2020, 133, 1911–1926. [Google Scholar] [CrossRef]
  62. Li, Y.; Liang, J.; Zeng, X.; Guo, H.; Luo, Y.; Kear, P.; Zhang, S.; Zhu, G. Genome-wide analysis of MYB gene family in potato provides insights into tissue-specific regulation of anthocyanin biosynthesis. Hortic. Plant J. 2021, 7, 129–141. [Google Scholar]
  63. Li, L.; He, Y.; Ge, H.; Liu, Y.; Chen, H. Functional characterization of SmMYB86, a negative regulator of anthocyanin biosynthesis in eggplant (Solanum melongena L.). Plant Sci. 2021, 302, 110696. [Google Scholar] [CrossRef]
  64. Zhang, W.; Ning, G.; Lv, H.; Liao, L.; Bao, M. Single MYB-type transcription factor AtCAPRICE: A new efficient tool to engineer the production of anthocyanin in tobacco. Biochem. Biophys. Res. Commun. 2009, 388, 742–747. [Google Scholar] [CrossRef]
  65. Jaradat, M.R.; Feurtado, J.A.; Huang, D.; Lu, Y.; Cutler, A.J. Multiple roles of the transcription factor AtMYBR1/AtMYB44 in ABA signaling, stress responses, and leaf senescence. BMC Plant Biol. 2013, 13, 192. [Google Scholar] [CrossRef] [Green Version]
  66. Nesi, N.; Jond, C.; Debeaujon, I.; Caboche, M.; Lepiniec, L. The Arabidopsis TT2 gene encodes an R2R3 MYB domain protein that acts as a key determinant for proanthocyanidin accumulation in developing seed. Plant Cell 2001, 13, 2099–2114. [Google Scholar] [CrossRef] [Green Version]
  67. Xie, H.; Sun, Y.; Cheng, B.; Xue, S.; Cheng, D.; Liu, L.; Meng, L.; Qiang, S. Variation in ICE1 methylation primarily determines phenotypic variation in freezing tolerance in Arabidopsis thaliana. Plant Cell Physiol. 2019, 60, 152–165. [Google Scholar] [CrossRef]
  68. Xie, Q.; Wang, P.; Liu, X.; Yuan, L.; Wang, L.; Zhang, C.; Li, Y.; Xing, H.; Zhi, L.; Yue, Z.; et al. LNK1 and LNK2 are transcriptional coactivators in the Arabidopsis circadian oscillator. Plant Cell 2014, 26, 2843–2857. [Google Scholar] [CrossRef]
  69. Xing, H.; Wang, P.; Cui, X.; Zhang, C.; Wang, L.; Liu, X.; Yuan, L.; Li, Y.; Xie, Q.; Xu, X. LNK1 and LNK2 recruitment to the evening element require morning expressed circadian related MYB-like transcription factors. Plant Signal Behav. 2015, 10, e1010888. [Google Scholar] [CrossRef] [Green Version]
  70. Zhou, M.; Zhang, K.; Sun, Z.; Yan, M.; Chen, C.; Zhang, X.; Tang, Y.; Wu, Y. LNK1 and LNK2 corepressors interact with the MYB3 transcription factor in phenylpropanoid biosynthesis. Plant Physiol. 2017, 174, 1348–1358. [Google Scholar] [CrossRef] [Green Version]
  71. Li, C.; Wu, J.; Hu, K.D.; Wei, S.W.; Sun, H.Y.; Hu, L.Y.; Han, Z.; Yao, G.F.; Zhang, H. PyWRKY26 and PybHLH3 cotargeted the PyMYB114 promoter to regulate anthocyanin biosynthesis and transport in red-skinned pears. Hortic Res. 2020, 7, 37. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  72. Bai, Q.; Duan, B.; Ma, J.; Fen, Y.; Sun, S.; Long, Q.; Lv, J.; Wan, D. Coexpression of PalbHLH1 and PalMYB90 genes from Populus alba enhances pathogen resistance in poplar by increasing the flavonoid content. Front. Plant Sci. 2020, 10, 1772. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  73. Sun, C.; Wang, C.; Zhang, W.; Liu, S.; Wang, W.; Yu, X.; Song, T.; Yu, M.; Yu, W.; Qu, S. The R2R3-type MYB transcription factor MdMYB90-like is responsible for the enhanced skin color of an apple bud sport mutant. Hortic. Res. 2021, 8, 156. [Google Scholar] [CrossRef] [PubMed]
  74. Schwinn, K.E.; Ngo, H.; Kenel, F.; Brummell, D.A.; Albert, N.W.; McCallum, J.A.; Pither-Joyce, M.; Crowhurst, R.N.; Eady, C.; Davies, K.M. The onion (Allium cepa L.) R2R3-MYB gene MYB1 regulates anthocyanin biosynthesis. Front. Plant Sci. 2016, 7, 1865. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  75. Tanaka, M.; Takahata, Y.; Kurata, R.; Nakayama, H.; Yoshinaga, M. Structural and functional characterization of IbMYB1 genes in recent Japanese purple-fleshed sweetpotato cultivars. Mol. Breed. 2012, 29, 565–574. [Google Scholar] [CrossRef]
  76. An, X.H.; Tian, Y.; Chen, K.Q.; Liu, X.J.; Liu, D.D.; Xie, X.B.; Cheng, C.G.; Cong, P.H.; Hao, Y.J. MdMYB9 and MdMYB11 are involved in the regulation of the JA-induced biosynthesis of anthocyanin and proanthocyanidin in apples. Plant Cell Physiol. 2015, 56, 650–662. [Google Scholar] [CrossRef] [Green Version]
  77. Wasternack, C.; Strnad, M. Jasmonates are signals in the biosynthesis of secondary metabolites—Pathways, transcription factors and applied aspects—A brief review. N Biotechnol 2019, 48, 1–11. [Google Scholar] [CrossRef]
  78. An, J.P.; Xu, R.R.; Liu, X.; Zhang, J.C.; Wang, X.F.; You, C.X.; Hao, Y.J. Jasmonate induces biosynthesis of anthocyanin and proanthocyanidin in apple by mediating the JAZ1-TRB1-MYB9 complex. Plant J 2021, 106, 1414–1430. [Google Scholar] [CrossRef]
  79. Guan, L.; Dai, Z.; Wu, B.H.; Wu, J.; Merlin, I.; Hilbert, G.; Renaud, C.; Gomès, E.; Edwards, E.; Li, S.H.; et al. Anthocyanin biosynthesis is differentially regulated by light in the skin and flesh of white-fleshed and teinturier grape berries. Planta 2016, 243, 23–41. [Google Scholar] [CrossRef]
  80. Ma, Y.; Ma, X.; Gao, X.; Wu, W.; Zhou, B. Light induced regulation pathway of anthocyanin biosynthesis in plants. Int. J. Mol. Sci. 2021, 22, 11116. [Google Scholar] [CrossRef]
  81. Li, T.; Jia, K.P.; Lian, H.L.; Yang, X.; Li, L.; Yang, H.Q. Jasmonic acid enhancement of anthocyanin accumulation is dependent on phytochrome A signaling pathway under far-red light in Arabidopsis. Biochem. Biophys. Res. Commun. 2014, 454, 78–83. [Google Scholar] [CrossRef]
  82. Dubos, C.; Le, G.J.; Baudry, A.; Huep, G.; Lanet, E.; Debeaujon, I.; Routaboul, J.M.; Alboresi, A.; Weisshaar, B.; Lepiniec, L. MYBL2 is a new regulator of flavonoid biosynthesis in Arabidopsis thaliana. Plant J. 2008, 55, 940–953. [Google Scholar] [CrossRef]
  83. Li, D.D.; Luo, Z.S.; Mou, W.S.; Wang, Y.S.; Ying, T.J.; Mao, L.C. ABA and UV-C effects on quality, antioxidant capacity and anthocyanin contents of strawberry fruit (Fragaria ananassa Duch.). Postharvest Biol. Technol. 2014, 90, 56–62. [Google Scholar] [CrossRef]
  84. Gupta, K.; Wani, S.H.; Razzaq, A.; Skalicky, M.; Samantara, K.; Gupta, S.; Pandita, D.; Goel, S.; Grewal, S.; Hejnak, V.; et al. Abscisic acid: Role in fruit development and ripening. Front. Plant Sci. 2022, 13, 817500. [Google Scholar] [CrossRef]
  85. Karppinen, K.; Lafferty, D.J.; Albert, N.W.; Mikkola, N.; McGhie, T.; Allan, A.C.; Afzal, B.M.; Häggman, H.; Espley, R.V.; Jaakola, L. MYBA and MYBPA transcription factors co-regulate anthocyanin biosynthesis in blue-coloured berries. New Phytol. 2021, 232, 1350–1367. [Google Scholar] [CrossRef]
Cimb 45 00027 g001 550
Figure 1. Repeat (R) domains sequences in blueberry ABRM proteins. (A): The R domain sequences of blueberry ABRM proteins. Sequences in dashed boxes represent the helix sequences in R domains; (B): Sequence logos for the R2 and R3 domain of R2R3-MYB type blueberry ABRMs; (C): Sequence logo for the R3 domain of 1R-MYB type blueberry ARBMs.
Figure 1. Repeat (R) domains sequences in blueberry ABRM proteins. (A): The R domain sequences of blueberry ABRM proteins. Sequences in dashed boxes represent the helix sequences in R domains; (B): Sequence logos for the R2 and R3 domain of R2R3-MYB type blueberry ABRMs; (C): Sequence logo for the R3 domain of 1R-MYB type blueberry ARBMs.
Cimb 45 00027 g001
Cimb 45 00027 g002 550
Figure 2. Conserved motifs distributions in blueberry ABRM proteins (A) and gene structures of their corresponding genes (B).
Figure 2. Conserved motifs distributions in blueberry ABRM proteins (A) and gene structures of their corresponding genes (B).
Cimb 45 00027 g002
Cimb 45 00027 g003 550
Figure 3. The identified cis-acting elements in the promoters of blueberry anthocyanin biosynthesis related MYB genes.
Figure 3. The identified cis-acting elements in the promoters of blueberry anthocyanin biosynthesis related MYB genes.
Cimb 45 00027 g003
Cimb 45 00027 g004 550
Figure 4. The predicted protein-protein interaction network for blueberry anthocyanin biosynthesis related MYBs based on the Arabidopsis protein database using STRING. At: Arabidopsis thaliana; Vc: Vaccinium corymbosum.
Figure 4. The predicted protein-protein interaction network for blueberry anthocyanin biosynthesis related MYBs based on the Arabidopsis protein database using STRING. At: Arabidopsis thaliana; Vc: Vaccinium corymbosum.
Cimb 45 00027 g004
Cimb 45 00027 g005 550
Figure 5. Expression analysis of blueberry ABRM genes in fruits at five different ripening stages based on transcriptome data. GF: green fruit; PiF: pink fruit; RF: red fruit; PF: purple fruit; BF: blue fruit. Log2(FPKM + 1) values were used for heatmap drawing.
Figure 5. Expression analysis of blueberry ABRM genes in fruits at five different ripening stages based on transcriptome data. GF: green fruit; PiF: pink fruit; RF: red fruit; PF: purple fruit; BF: blue fruit. Log2(FPKM + 1) values were used for heatmap drawing.
Cimb 45 00027 g005
Cimb 45 00027 g006 550
Figure 6. Quantitative real time PCR results of four selected blueberry ABRM genes. GF: green fruit; PiF: pink fruit; RF: red fruit; PF: purple fruit; BF: blue fruit. Different letters above columns represent significant difference at p < 0.05 level.
Figure 6. Quantitative real time PCR results of four selected blueberry ABRM genes. GF: green fruit; PiF: pink fruit; RF: red fruit; PF: purple fruit; BF: blue fruit. Different letters above columns represent significant difference at p < 0.05 level.
Cimb 45 00027 g006
Cimb 45 00027 g007 550
Figure 7. VcMYB gene has three variable transcripts and only the transient overexpression of VcMYB-1 promotes the anthocyanin accumulation in blueberry fruits. (A): The three amplified transcripts of VcMYB, and sequence alignment results of their nucleotide sequences together with their reference VcMYB (VaccDscaff1486-snap-gene-0.3). (B): Transient overexpression of VcMYB variable transcripts in green blueberry fruits. For fruits of the MYB-1 group, the left one is green fruit at 15 days post flowering, and the right one is green fruit at 20 days post flowering (C): Colour parameters (L*, a* and b* values) of fruit pericarps at three days post treatment. (D): Anthocyanin extract solution of CK group. (E): Anthocyanin extract solution of MYB-1 group. (F): Anthocyanin content in blueberry fruit pericarps. The ‘*’ above columns in C and F represents significant difference at p < 0.05 level.
Figure 7. VcMYB gene has three variable transcripts and only the transient overexpression of VcMYB-1 promotes the anthocyanin accumulation in blueberry fruits. (A): The three amplified transcripts of VcMYB, and sequence alignment results of their nucleotide sequences together with their reference VcMYB (VaccDscaff1486-snap-gene-0.3). (B): Transient overexpression of VcMYB variable transcripts in green blueberry fruits. For fruits of the MYB-1 group, the left one is green fruit at 15 days post flowering, and the right one is green fruit at 20 days post flowering (C): Colour parameters (L*, a* and b* values) of fruit pericarps at three days post treatment. (D): Anthocyanin extract solution of CK group. (E): Anthocyanin extract solution of MYB-1 group. (F): Anthocyanin content in blueberry fruit pericarps. The ‘*’ above columns in C and F represents significant difference at p < 0.05 level.
Cimb 45 00027 g007
Table
Table 1. Information for the primers used in this study.
Table 1. Information for the primers used in this study.
Target GenePrimer NamePrimer SequenceTarget Length (bp)Annealing
Temperature (°C)		Applications
VcMYBVcMYB-FATGGACATAGTTCCATTGGGAGTGA79859Gene cloning
VcMYB-RTAAAATATCCCAAAGGTCCACATTGTC
VcMYB-InFACGGGGGACTCTAGAGGATCCATGGACATAGTTCCATTGGGAGTGA786/704/56860Vector construction
VcMYB-InRGCTCACCATCGCTGCACTAGTTAAAATATCCCAAAGGTCCACATTGTC
VcMYB-qFTCCATTGGGAGTGAGAAAGG11560qRT-PCR
VcMYB-qRCAATCCTGCCCTGTAAGGAA
VcMYB6VcMYB6-qFCTCTCCTCAGGTGGAGCATC16460qRT-PCR
VcMYB6-qRTTCCTCTTGAGCGTGGAGTT
VcMYB2VcMYBL2-qFTCAAAATCCACGTCCCTCTC9260qRT-PCR
VcMYBL2-qRCATTCTCCGCTAGCTTGGTC
VcMYB23VcMYB23-qFTGTTGGGAAACAGATGGTCA8960qRT-PCR
VcMYB23-qRTTTCAAGTGGGTGTGCCATA
GAPDHGAPDH-qFACTACCATCCACTCTATCACCG11659qRT-PCR
GAPHD-qRAACACCTTACCAACAGCCTTG
Table
Table 2. The identified blueberry ABRM proteins.
Table 2. The identified blueberry ABRM proteins.
Protein NameGene IDHomologous Protein NameHomologous Gene IDSimilarity (%)References
VcMYBVaccDscaff1486-snap-gene-0.3VcMYBAMH10505493.40[32]
AtMYB114At1G6638074.36[36]
HtMYB2MN88753662.25[37]
PELANKJ01114459.87[38]
EsMYB90XP_00639139359.35[39]
AtMYB90(PAP2)At1G6639058.97[36]
AtMYB75(PAP1)At1G5665058.71[36]
FhPAP1MT21009356.86[40]
MaAN2KY78116856.86[41]
AtMYB113At1G6637056.77[36]
MdMYB10EU51829.254.36[42]
VcMYB12VaccDscaff43-snap-gene-6.43AtMYB12At2G4746066.86[46]
AtMYB11At3G6261052.17[46]
AtMYB111At5G4933050.19[46]
VcMYB123VaccDscaff34-augustus-gene-10.31AcMYB123MH64377672.33[47]
MdMYB9MDP000021085171.43[48]
VcMYBL2VaccDscaff28-augustus-gene-197.19MdMYBL2NP_001281006.165.29[49]
SmelMYBL1MN85552551.61[50]
VcMYB6VaccDscaff31-processed-gene-75.6MdMYB6DQ07446155.26[51]
IbMYB44itf03g30290.t151.46[52]
VcPLVaccDscaff13-augustus-gene-110.26OsPLLOC_Os05g48010.175.19[53]
VcMYB24LVaccDscaff30-augustus-gene-338.25MdMYB24LXM_008343218.275.00[54]
VcRVE8VaccDscaff34-augustus-gene-308.23PbRVE8XP_009342285.168.22[55]
VcCPCVaccDscaff41-snap-gene-184.30AtCPCAt2G4641067.06[56]
VcMYBC1VaccDscaff32-augustus-gene-55.27AaMYBC1MN24917557.41[57]
VcMYB23VaccDscaff46-processed-gene-168.9MdMYB23MDP000023014155.15[58]
VcMYB340VaccDscaff16-snap-gene-84.41IbMYB340itf12g05820.t155.02[52]
VcPH4VaccDscaff39-augustus-gene-189.28CsPH4Cs9g0307054.14[59]
VcMYBATVVaccDscaff1069-augustus-gene-0.8SlMYBATVSolyc07g052490.4.153.57[60]
VcMYB85VaccDscaff36-augustus-gene-8.19SiMYB85Seita.4G08630050.72[61]
Table
Table 3. Basic physicochemical properties of the identified blueberry ABRMs. CDS: coding sequence; PI: isoelectric point; MW: molecular weight; PI: isoelectric point.
Table 3. Basic physicochemical properties of the identified blueberry ABRMs. CDS: coding sequence; PI: isoelectric point; MW: molecular weight; PI: isoelectric point.
Gene Name (ID)CDS Length/bp Protein Size/aa MW/DaPI Instability IndexGRAVYSubcellular Localization
VcMYB
(VaccDscaff1486-snap-gene-0.3)		82227331,294.226.0141.78−0.749Nucleus
VcMYB12
(VaccDscaff43-snap-gene-6.43)		108336039,534.646.6854.28−0.603Nucleus
VcMYB123
(VaccDscaff34-augustus-gene-10.31)		82827531,260.27.5552.05−0.705Nucleus
VcMYBL2
(VaccDscaff28-augustus-gene-197.19)		70223326,419.918.4051.94−0.779Nucleus
VcMYB6
(VaccDscaff31-processed-gene-75.6)		108035939,018.976.2661.47−0.498Nucleus
VcPL
(VaccDscaff13-augustus-gene-110.26)		90330033,807.745.9055.58−0.702Nucleus
VcMYB24L
(VaccDscaff30-augustus-gene-338.25)		57319021,953.616.1654.33−0.854Nucleus
VcRVE8
(VaccDscaff34-augustus-gene-308.23)		94231333,898.297.7846.57−0.462Chloroplast; Nucleus
VcCPC
(VaccDscaff41-snap-gene-184.30)		2979811,752.339.7279.67−1.014Nucleus
VcMYBC1
(VaccDscaff32-augustus-gene-55.27)		79826530,057.38.5758.02−0.68Nucleus
VcMYB23
(VaccDscaff46-processed-gene-168.9)		73824527,819.196.4136.10−0.668Nucleus
VcMYB340
(VaccDscaff16-snap-gene-84.41)		74424728,372.857.6654.91−0.855Nucleus
VcPH4
(VaccDscaff39-augustus-gene-189.28)		108636140,095.858.7248.94−0.719Nucleus
VcMYBATV
(VaccDscaff1069-augustus-gene-0.8)		222738407.084.3161.99−0.922Nucleus
VcMYB85
(VaccDscaff36-augustus-gene-8.19)		91230333,738.768.3760.02−0.775Nucleus
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, Y.; Huang, D.; Wang, B.; Yang, X.; Wu, H.; Qu, P.; Yan, L.; Li, T.; Cheng, C.; Qiu, D. Characterization of Highbush Blueberry (Vaccinium corymbosum L.) Anthocyanin Biosynthesis Related MYBs and Functional Analysis of VcMYB Gene. Curr. Issues Mol. Biol. 2023, 45, 379-399. https://doi.org/10.3390/cimb45010027

AMA Style

Zhang Y, Huang D, Wang B, Yang X, Wu H, Qu P, Yan L, Li T, Cheng C, Qiu D. Characterization of Highbush Blueberry (Vaccinium corymbosum L.) Anthocyanin Biosynthesis Related MYBs and Functional Analysis of VcMYB Gene. Current Issues in Molecular Biology. 2023; 45(1):379-399. https://doi.org/10.3390/cimb45010027

Chicago/Turabian Style

Zhang, Yongyan, Dingquan Huang, Bin Wang, Xuelian Yang, Huan Wu, Pengyan Qu, Li Yan, Tao Li, Chunzhen Cheng, and Dongliang Qiu. 2023. "Characterization of Highbush Blueberry (Vaccinium corymbosum L.) Anthocyanin Biosynthesis Related MYBs and Functional Analysis of VcMYB Gene" Current Issues in Molecular Biology 45, no. 1: 379-399. https://doi.org/10.3390/cimb45010027

APA Style

Zhang, Y., Huang, D., Wang, B., Yang, X., Wu, H., Qu, P., Yan, L., Li, T., Cheng, C., & Qiu, D. (2023). Characterization of Highbush Blueberry (Vaccinium corymbosum L.) Anthocyanin Biosynthesis Related MYBs and Functional Analysis of VcMYB Gene. Current Issues in Molecular Biology, 45(1), 379-399. https://doi.org/10.3390/cimb45010027

Article Metrics

Back to TopTop