Cinnamyl Alcohol Dehydrogenase Gene Regulates Bursaphelenchus xylophilus Reproduction and Development

Abstract

Pine wilt disease (PWD) caused by the pine wood nematode (PWN), Bursaphelenchus xylophilus, is a globally distributed destructive disease of pine forest. To study the PWD pathogenic mechanism, the cinnamyl alcohol dehydrogenase gene (BxCAD-1) from B. xylophilus was selected. The BxCAD-1 gene was amplified by PCR from the cDNA library of B. xylophilus and cloned into the expression vector pET-15b to construct the recombinant vector pET-15b-BxCAD-1. The recombinant cinnamyl alcohol dehydrogenase protein was purified by Ni-NTA affinity chromatography from Escherichia coli BL21 (DE3) harboring pET-15b-BxCAD-1 induced by IPTG. The effects of pH, temperature, metal ions and substrates on the activity of BxCAD-1 were determined, showing the highest catalytic activity at pH 8.0 and 40 °C with cinnamyl alcohol as substrate and Zn²⁺ as an activator. To elucidate the functions of BxCAD-1 in B. xylophilus, the expression of the gene was down-regulated by RNA interference. Results showed that the movement, feeding, reproduction, spawning rate, hatching rate, lifespan, infectivity and sensitivity to ethanol decreased compared with negative controls. RNA interference also affected the development of B. xylophilus from the larval stage to the adult stage. In situ hybridization showed that the gene was expressed in the digestive tract of male and female adults. This study revealed a promising target for PWD control.

1. Introduction

Pine wilt disease (PWD) is a devastating disease leading to the rapid death of pine trees and the large-scale destruction of pine forests. It is characterized by rapid transmission, a short onset cycle and difficult control [1]. The disease is caused by the pine wood nematode (PWN) (Bursaphelenchus xylophilus) through insect vectors such as Monochamus alternatus and other cerambycid beetles [2]. Although the pine trees have no visible symptoms at the initial stage of infection, PWD causes a decrease in resin secretion, lipid peroxidation and exudation of cell contents. As the disease progresses, the pine needles turn yellowish brown or reddish brown, wilt and droop until the trees wither and die [3,4,5]. Pine trees in North America, where PWD originated, are not severely affected [6,7]. In Asia, the PWN was first discovered in Nagasaki on Kyushu Island in Japan in 1905 and then rapidly spread to other countries in East Asia and Europe, resulting in huge losses to the local ecological environment and economy [8,9,10].

Pine wilt disease is related to complex interactions among B. xylophilus, insect vectors and host pines. The PWN pathogenic mechanism has not been fully understood [11]. The enzyme hypothesis suggests that B. xylophilus invades the pine tree by secreting a large number of enzymes such as cellulase, lipase, glycoside hydrolase and peptidase, which attack the cell wall and membrane of the parenchyma tissue of the pine tree, resulting in the leakage of oil and the obstruction of water transmission [12,13,14,15,16]. The cavitation hypothesis proposes that tracheid cavitation occurs in the xylem at the early stage of infection before the symptoms of PWD appear, which is caused by the production of hydrophobic terpenes in B. xylophilus infected pine trees and blocks water transport [17,18,19,20]. The toxin hypothesis suggests that the pathogenicity of B. xylophilus alone is not strong or even unable to cause disease in pine trees, but the symbiosis with toxin-producing bacteria can lead to the death of pine trees [21,22,23,24].

Cinnamyl alcohol dehydrogenase (CAD) (EC1.1.1.195) was first found in soybean [25]. This enzyme exists in plants and participates in the final step of cell wall synthesis, containing a highly conserved NAD(P)H/NAD(P)⁺ binding domain, which is also dependent on the activation of Zn²⁺ [26,27]. Studies have shown that CAD is involved in lignin synthesis in Artemisia annua [28], Oryza sativa [29], Arabidopsis [30], Triticum aestivum [31] and Populus tomentosa [32]. In Saccharomyces cerevisiae, CADs may be involved in fusel synthesis, lignin decomposition and NADP(H) dynamic balance [33,34]. In Sclerotinia sclerotiorum, CAD regulates its development through the reactive oxygen species (ROS) pathway [35]. Moreover, CAD is involved in the lipid biosynthesis of cell membranes in Mycobacterium bovis BCG [36], and it can disproportionate benzaldehyde to produce benzyl alcohol and benzoic acid in Helicobacter pylori [37].

RNA interference (RNAi) is an effective method to study the biological function of genes. It utilizes homologous double-stranded RNA (dsRNA) to silence gene function at the post-transcriptional level, resulting in the degradation of the target mRNA sequence [38,39,40,41]. Xue et al. [42] found three cathepsin L-like cysteine proteinase (CPL) genes, Bx-Cpls-1, Bx-Cpls-2 and Bx-Cpls-3 of B. xylophilus. Silencing Bx-Cpl gene can reduce the feeding energy, reproductive ability and pathogenicity of B. xylophilus. Qiu et al. [43] and Qiu et al. [44] inhibited the expression of cytochrome P450 gene, CYP-33C9 and pectin lyase gene, Bxpel1 in B. xylophilus by RNAi technology, respectively, and effectively slowed B. xylophilus migration. Hu et al. [45] found that the expression level of BxSapB1, an effector factor of B. xylophilus, was upregulated in the highly virulent strain. Silencing this gene significantly reduced B. xylophilus virulence.

4-Methylpyrazole is a competitive inhibitor of alcohol dehydrogenase [46,47,48]. In a previous study on the transcriptome of B. xylophilus treated with 4-Methylpyrazole, an up-regulated gene BxCAD-1 coding cinnamyl alcohol dehydrogenase was identified [49]. At present, there are few studies on cinnamyl alcohol dehydrogenase in animals, and cinnamyl alcohol dehydrogenase has never been reported in B. xylophilus. The data from this study will support the understanding of BxCAD-1 in the reproduction and development of B. xylophilus, which may be an important pathogenic factor of B. xylophilus and provide a new molecular target for the exploration of nematicides and control of PWD. If it is universal, it can provide some data support for the control of other nematodes.

2. Materials and Methods

2.1. Materials

Bursaphelenchus xylophilus were collected from infected Pinus thunbergii by the Baermann funnel method [1] from Muping District, Yantai City, Shandong Province, China. Botrytis cinerea was kept in our laboratory. The products and manufacturers used in this experiment are listed in

Table 1. The products and manufacturers used in this experiment.

Products	Manufacturers
Escherichia coli DH5α, BL21 (DE3), vector pET-15b	Invitrogen Co. (Carlsbad, CA, USA)
RNA Easy Fast Tissue/Cell Kit	Tiangen Biotech (Beijing, China)
PrimeScriptTM II First Strand cDNA Synthesis Kit	Takara Biomedical Technology (Beijing, China)
pEASY®-T1 Cloning Kit	TransGen Biotech Co., Ltd. (Beijing, China)
T4 DNA ligase, restriction endonuclease NdeI, XhoI	New England Biolabs (Beijing, China)
Extraction Mini Kit, HiScript III RT SuperMix for qPCR, ChanQ Universal SYBR qPCR Master Mix	Vazyme Biotech Co., Ltd. (Nanjing, Jiangsu, China)
MEGAscriptTM RNAi Kit	Thermo Fisher Scientific (Waltham, MA, USA)
Reactive oxygen species Assay Kit	Nanjing Jiancheng Bioengineering Institute (Nanjing, Jiangsu, China)
RNA Free paraformaldehyde fixative, FISH in situ hybridization kit	Shanghai Gefan Biotechnology Co., Ltd. (Shanghai, China)

.

Mature cones of P. thunbergii on the campus of Qingdao University were collected, and the seeds were soaked overnight and placed in the seedling substrate. The seedlings were cultured at 25 °C in greenhouse for about 30 days to obtain P. thunbergii seedlings.

2.2. Isolation and Culture of B. xylophilus

B. xylophilus extracted from infected P. thunbergii were inoculated in B. cinerea cultures on Potato Dextrose Agar (PDA) medium at 25 °C in the dark for 9 days [50]. B. xylophilus were collected from B. cinerea cultures by the Baermann funnel method.

2.3. Construction of cDNA Library of B. xylophilus

Approximately one thousand PWNs (mixed developmental stages) were used to extract the total RNA following the instruction of the RNA Easy Fast Tissue/Cell Kit. The construction of cDNA library was performed using the PrimeScript^TM II First Strand cDNA Synthesis Kit following the manufacturer’s instructions.

2.4. Cloning of BxCAD-1 Gene

A pair of specific primers, CAD-F and CAD-R (

Table 2. PCR primers used in this study.

Primer	Sequence (5′→3′)
CAD-F	ATGGTGGTATATTTCAGACATTTTG
CAD-R	TTAGTTCCACATGTCCAGAAC
CAD-1-F	ATGGTGGTATATTTCAGACATTTTG
CAD-1-R	TACAAGCGGCATATTGTTGG
CAD-2-F	TCCGATCAAGAGCCCACC
CAD-2-R	CGTAGGCATCAACGAACC
CAD-3-F	TATGCCAAAGCTATGGGAATG
CAD-3-R	TCAAGGGTTGCATCTCCAC
CAD-1T7-F	TAATACGACTCACTATAGGGATGGTGGTATATTTCAGACATTTTG
CAD-1T7-R	TAATACGACTCACTATAGGGTACAAGCGGCATATTGTTGG
CAD-2T7-F	TAATACGACTCACTATAGGGTCCGATCAAGAGCCCACC
CAD-2T7-R	TAATACGACTCACTATAGGGCGTAGGCATCAACGAACC
CAD-3T7-F	TAATACGACTCACTATAGGGTATGCCAAAGCTATGGGAATG
CAD-3T7-R	TAATACGACTCACTATAGGGTCAAGGGTTGCATCTCCAC
GFP-F	TAATACGACTCACTATAGGGCAAAGATGACGGGAACTAC
GFP-R	TAATACGACTCACTATAGGGGATAATGGTCTGCTAGTTG
Q1R	CAGACATTTTGATATGTCCGACG
Q1F	GGCAGACACCTGAATACAAAATC
Q2R	GTACTGCAAACGGGGCTATG
Q2F	CCTTCAACGCCTTATAAACCG
Q3R	CCTACGGCAAGACTGATGTGG
Q3F	CTTCAATGTGACCGTGGCATC
CTR	CTGCTGAGCGTGAAATCGT
CTF	GTTGTAGGTGGTCTCGTGGA

), were generated from the gene sequence of BxCAD-1 gene and designed using Primer Premier 5.0 software (Premier, Canada). PCR amplification was carried out with the cDNA library as the template. The amplification program included one cycle at 94 °C for 5 min, 35 cycles at 94 °C for 40 s, 56 °C for 42 s and 72 °C for 90 s respectively, followed by one cycle at 72 °C for 10 min. The PCR amplification products were analyzed by 1% agarose gel electrophoresis, and the target gene was recovered by Extraction Mini Kit. The BxCAD-1 gene was cloned into vector pEASY-T1 to obtain pEASY-T1-BxCAD-1, which was amplified in E. coli DH5α and sequenced at Sangon Biotech Co., Ltd. (Shanghai, China).

2.5. Biological Information Analysis of BxCAD-1 Gene

The domain (https://www.ebi.ac.uk/interpro/result/InterProScan/iprscan5-R20220307-030447-0221-57005514-p2m/) (accessed on 14 May 2021), signal peptide (https://services.healthtech.dtu.dk/service.php?SignalP-5.0) (accessed on 14 May 2021), transmembrane domain (https://services.healthtech.dtu.dk/service.php?TMHMM-2.0) (accessed on 14 May 2021) and three-dimensional structure (https://swissmodel.expasy.org/) (accessed on 14 May 2021) of the amino acid residue sequence encoded by BxCAD-1 gene were predicted and analyzed. The BxCAD-1 gene was entered into NCBI database for homology analysis. The DNAMAN software (6.0.3.99) was used for sequence alignment, and phylogenetic tree of amino acids was constructed by MEGA software (X-10) [51].

2.6. Construction of Engineered Bacteria

The recombinant cloning vector pEASY-T1-BxCAD-1 and expression vector pET-15b were double digested by restriction endonuclease NdeI, XhoI. The BxCAD-1 gene was recovered after agarose gel electrophoresis and cloned into the expression vector pET-15b by T4 DNA ligase, and the recombinant pET-15b-BxCAD-1 was transformed into E. coli BL21 (DE3) to construct the engineered bacteria [52].

2.7. Expression and Purification of Recombinant BxCAD-1

A single colony of engineered bacteria was cultured in 100 mL of Luria–Bertani (LB) medium with ampicillin (100 μg/mL) at 37 °C for 12 h, and 60 mL culture was transferred to 3 L of LB medium with ampicillin (100 μg/mL) for further incubation at 37 °C for 5 h. Next, IPTG was added into the culture to a final concentration of 1.0 mmol/L, and incubation lasted for another 5 h. The fermentation broth was centrifuged at 16,500× g for 40 min. The bacterial pellet was resuspended with 20 mL of binding buffer (10% glycerol, 0.5 mol/L NaCl, 20 mmol/L Tris-Cl pH 8.0, 5.0 mmol/L imidazole) and lyzed by intermittent sonication (sonication for 5 s and intermission for 15 s) on ice at 400 W for 2 h. The cell lysates were centrifuged at 4140× g for 15 min at 4 °C; inclusion bodies were collected and washed three times with 6 mL of washing buffer (0.5 mol/L NaCl, 2.0 mol/L Urea, 0.1 mmol/L PMSF, 0.5% TritonX-100, 20 mmol/L Tris-Cl pH 8.0) followed by centrifugation at 4140× g for 15 min at 4 °C. The final inclusion bodies were resuspended in 3 mL of denaturing buffer (0.5 mol/L NaCl, 8.0 mol/L Urea, 0.1 mmol/L phenylmethanesulfonyl fluoride, 20 mmol/L Tris-Cl pH 8.0). The suspension was serially diluted using refolding buffer (0.5 mol/L NaCl, 0.1 mmol/L phenylmethanesulfonyl fluoride, 20 mmol/L Tris-Cl pH 8.0) to reach a final urea concentration of less than 1.0 mol/L. Next, the refolded recombinant protein was purified by Ni-NTA affinity chromatography and identified by SDS-PAGE (12% gel) [53].

2.8. Determination of Physical and Chemical Properties of BxCAD-1

The reaction system for enzyme activity determination includes 100 mmol/L Tris-Cl (pH 8.0), 5 mmol/L NAD, 92.4 μg/mL enzyme solution, 100 mmol/L ethanol and 0.1 mmol/L Zn²⁺. The reaction was performed at 40 °C for 1 h, followed by the measurement of optical density at 340 nm (A₃₄₀). One unit (U) of enzyme activity was defined as the amount of enzyme that increases by 0.001 at A₃₄₀ per minute. The specific activity (U/mg) of the enzyme was defined as the units of enzyme activity per mg protein. The enzyme activity assay was carried out in three replications [53].

The effects of different temperatures (10 °C, 20 °C, 30 °C, 40 °C and 50 °C), pH (6.0, 7.0, 8.0, 9.0 and 10.0), metal ions (Zn²⁺, Fe²⁺, Ni²⁺, Mg²⁺ and K⁺), and substrates (methanol, ethanol, isopropanol, sorbitol, cinnamyl alcohol, D-pinitol and 2-methoxyphenol) on BxCAD-1 activity were determined.

2.9. RNA Interference for BxCAD-1 Gene

2.9.1. Synthesis of dsRNA

Three fragments of BxCAD-1 for RNA interference were selected, which included fragment 1 (1 to 430 bp of ORF, with a total length of 430 bp), fragment 2 (200 to 700 bp of ORF, with a total length of 500 bp) and fragment 3 (600 to 1000 bp of ORF, with a total length of 400 bp). PCR amplification was carried out with three pairs of specific primers: CAD-1-F and CAD-1-R, CAD-2-F and CAD-2-R, CAD-3-F and CAD-3-R, respectively (Table 2), and pET-15b-BxCAD-1 was used as the template. The amplifications of the three fragments were finished according to the program: one cycle at 94 °C for 5 min, 35 cycles at 94 °C for 40 s, 56 °C for 42 s, 72 °C for 40 s. The three fragments were further amplified using specific primers CAD-1T7-F, CAD-1T7-R; CAD-2T7-F, CAD-2T7-R and CAD-3T7-F, CAD-3T7-R (Table 2), respectively, to add T7 promoter to the up-stream of three fragments. A pair of specific primers GFP-F and GFP-R (Table 2) with T7 promoter were used for PCR amplification with pET-15b-GFP as template; the amplification conditions were as described above. DsRNA was synthesized by using the amplified product as template, and the synthesis method was referred to the instructions of the MEGAscript^TM RNAi Kit [53].

2.9.2. Efficiency Assessment of RNAi

QRT-PCR was used to verify the effect of BxCAD-1 silencing through RNAi on mRNA levels. Approximately 3000 B. xylophilus (mixed developmental stages) were soaked in 50 μL dsRNA solution (1.0 μg/μL) and cultured in the dark at 20 °C at 180 rpm for 72 h [53]. B. xylophilus soaked in distilled H₂O and gfp dsRNA solution (1.0 μg/μL) were used as control. B. xylophilus were washed with sterile water 4 times, and the extraction of total RNA and construction of cDNA library was performed using the RNA Easy Fast Tissue/Cell Kit and HiScript III RT SuperMix for qPCR, respectively. QRT-PCR has used the ChanQ Universal SYBR qPCR Master Mix. The three fragments were further amplified using specific primers Q1F, Q1R; Q2F, Q2R and Q3F, Q3R (Table 2), respectively. The actin gene amplified was used as the internal control using specific primers CTF and CTR [51]. The PCR program was set as follows: 30 s at 95 °C, followed by 20 cycles of 5 s at 95 °C and 30 s at 58 °C. Each experiment was performed with three biological and three technical replicates.

2.9.3. Effect of RNAi on Movement

Approximately 3000 B. xylophilus (mixed developmental stages) were soaked in 50 μL dsRNA solution (1.0 μg/μL) and cultured in the dark at 20 °C at 180 rpm for 72 h, and all B. xylophilus used in this study were interfered in this way [53]. Fifty B. xylophilus were randomly selected for optical microscope observation. The head thrashing frequency in 1 min was monitored as an indicator of vitality [54]. B. xylophilus soaked in distilled H₂O, gfp dsRNA solution (1.0 μg/μL) and 0.02 mmol/L 4-methylpyrazole solution were used as control.

2.9.4. Effect of RNAi on Feeding and Reproduction

Approximately 200 B. xylophilus with ratio of female to male of 1:1 were inoculated on PDA plates full of B. cinerea and cultured in the dark at 25 °C. The feeding situation was observed every day. After 9 days of culture, B. xylophilus were isolated from PDA plates by the Baermann funnel method and counted under an optical microscope [51]. B. xylophilus soaked in distilled H₂O, gfp dsRNA solution (1.0 μg/μL) and 0.02 mmol/L 4-methylpyrazole solution were used as control. The experiment was repeated five times.

2.9.5. Effect of RNAi on Spawning Rate and Hatching Rate

One hundred microliters of B. xylophilus suspension (approximately 400 B. xylophilus with ratio of female to male of 1:1) were transferred into a 96-well plate in the dark at 25 °C for 12 h, and the number of eggs was counted under an optical microscope. Eggs were separated and incubated in the dark at 25 °C for 24 h for hatching. The number of total eggs at the beginning of assay and the remaining eggs after 24 h was recorded to calculate the number of hatched eggs and the hatching rate [51]. Bursaphelenchus xylophilus soaked in distilled H₂O, gfp dsRNA solution (1.0 μg/μL) and 0.02 mmol/L 4-methylpyrazole solution were used as control, respectively. The experiment was repeated three times.

2.9.6. Effect of RNAi on Lifespan of PWN

One hundred microliters of B. xylophilus suspension (approximately 200 mixed developmental stages B. xylophilus) were transferred into a 96-well plate in the dark at 25 °C for 72 h; the number of surviving B. xylophilus were counted under an optical microscope and observed every 24 h [55]. Bursaphelenchus xylophilus soaked in distilled H₂O, gfp dsRNA solution (1 μg/μL) and 0.02 mmol/L 4-methylpyrazole solution were used as control, respectively. The experiment was repeated three times.

2.9.7. Effect of RNAi on Infectivity

Approximately 200 B. xylophilus (mixed developmental stages) were inoculated into Pinus thunbergii seedlings. A small wound was made at the top of the seeding and B. xylophilus were inoculated into the wound [56]. The wilting of pine needles of the Pinus thurnbergii seedlings was observed every day [56]. And the seedling mortality was recorded at 0, 9 and 21 days, respectively. Inoculation of distilled water without B. xylophilus (negative control), B. xylophilus soaked in distilled H₂O, gfp dsRNA solution (1 μg/μL) and 0.02 mmol/L 4-methylpyrazole solution were used as compared controls, respectively. The experiment was repeated eight times.

2.9.8. Effect of RNAi on Development

The B. xylophilus at J2 stages were collected according to the method described by Wang et al., Shinya et al. and Xue et al. with some modifications [42,51,57]. Approximately 10,000 B. xylophilus (mixed developmental stages) were inoculated in B. cinerea cultures on PDA medium at 25 °C in the dark for 9 h. The eggs were collected by the Baermann funnel method. The eggs were inoculated in B. cinerea cultures on PDA medium in the dark at 25 °C for 24 h. The J2 stage larvae were collected by Baermann funnel method. Approximately 3000 J2 stage larvae were soaked in dsRNA solution (1.0 μg/μL) as described above, and the development of the larvae was observed. B. xylophilus soaked in distilled H₂O and gfp dsRNA (1.0 μg/μL) were used as control, respectively. The experiment was repeated three times.

2.9.9. Effect of RNAi on Sensitivity to Ethanol

One hundred microliters of B. xylophilus suspension (approximately 300 B. xylophilus with ratio of female to male of 1:1) were transferred into a 96-well plate, absolute ethanol was added to a final concentration of 1%, and nematodes were observed every 24 h for a total of 72 h. B. xylophilus soaked in distilled H₂O and gfp dsRNA solution (1.0 μg/μL) were used as control, respectively. The experiment was repeated three times.

2.9.10. Effect of RNAi on the Reactive Oxygen Species and Activities of Antioxidant Enzymes

Approximately 3000 B. xylophilus (mixed developmental stages) were soaked in 50 μL dsRNA solution (1.0 μg/μL) and cultured in the dark at 20 °C at 180 rpm for 72 h [53]. The reactive oxygen species were detected following the instructions of the reactive oxygen species Assay Kit.

For superoxide dismutase (SOD) analysis, 2 mL reaction system contained 50 mmol/L PBS (pH 7.8), 13 mmol/L Met, 75 μmol/L NBT, 1 mmol/L EDTA, 20 μmol/L riboflavin and 100 μL enzyme solution. The added reaction system was placed under 4000 LX light source to react at 25 °C for 15 min, then the reaction was terminated immediately in the dark, and the absorbance was determined under 560 nm [58]. The amount of enzyme required when the inhibition rate reached 50% was defined as one unit of enzyme activity (U). The calculation formula of SOD activity was referred to in Formula (1) in

Table 3. Formulas used for calculating superoxide dismutase (SOD), peroxidase (POD) and catalase (CAT) activities of Bursaphelenchus xylophilus.

Name	Formula	Remarks
Formula (1)	$\mathrm{S}\mathrm{O}\mathrm{D}(\mathrm{U}/\mathrm{g}\mathrm{p}\mathrm{r}\mathrm{o}\mathrm{t})=\frac{\left(Ack-AE\right)\ast V}{Ack\ast 0.5\ast w\ast v}$	Ack: absorbance of sample AE: absorbance of control V: total volume of enzyme solution of the sample w: total protein content of sample v: volume of enzyme solution during measurement
Formula (2)	$\mathrm{P}\mathrm{O}\mathrm{D}(\mathrm{U}/\mathrm{g}\mathrm{p}\mathrm{r}\mathrm{o}\mathrm{t})=\frac{△A470\ast V}{0.01\ast w\ast v\ast t}$	ΔA470: difference in absorbance V: total volume of enzyme solution of the sample w: total protein content of sample v: volume of enzyme solution during measurement t: reaction time
Formula (3)	$\mathrm{C}\mathrm{A}\mathrm{T}(\mathrm{U}/\mathrm{g}\mathrm{p}\mathrm{r}\mathrm{o}\mathrm{t})=\frac{△A240\ast V}{0.01\ast w\ast v\ast t}$	ΔA240: difference in absorbance V: total volume of enzyme solution of the sample w: total protein content of sample v: volume of enzyme solution during measurement t: reaction time

. The experiment was repeated three times.

To detect peroxidase (POD), 2 mL reaction system contained 50 mmol/L PBS (pH 7.8), 0.005% H₂O₂, 0.001% guaiacol and 100 μL enzyme solution. The change of absorbance at 470 nm in 10 min was measured [58]. The value of A₄₇₀ reduced by 0.01 per minute was defined as one unit of enzyme activity (U). The calculation formula of POD activity was referred to in Formula (2) in Table 3. To measure the activity of catalase (CAT), 2 mL reaction system contained 50 mmol/L PBS (pH 7.8), 0.001% H₂O₂, and 100 μL enzyme solution. The change of absorbance in 10 min was measured at 240 nm [58]. The value of A₂₄₀ reduced by 0.01 per minute was defined as one unit of enzyme activity (U). The calculation formula of CAT activity is referred to in Table 3, Formula (3). The experiment was repeated three times.

2.10. Fluorescence In Situ Hybridization of BxCAD-1 Gene

Fluorescence in situ hybridization technology was performed to determine the spatial expression patterns of BxCAD-1 gene at different developmental stages of B. xylophilus. A red fluorescence-labeled probe (5′-CAACGATTTGACCGGGCTTCACATCCGCCTCCTTCAACGCCTTAT-3′) was generated from the cloned sequence of BxCAD-1 gene and designed using Primer Premier 5.0 software (Premier, Canada). Approximately three thousand B. xylophilus (mixed developmental stages) were fixed with 1.0 mL RNA-free paraformaldehyde fixative at 25 °C for 30 min. The method of in situ hybridization was referred to in the instruction of FISH in situ hybridization kit. The sense probe (5′-TTGTACTACACAAAAGTACTG-3′) was used as a negative control [59].

2.11. Analysis of KEGG Pathway of BxCAD-1 Gene

Analysis of the pathway involved in BxCAD-1 gene in the transcriptome of B. xylophilus treated with methylpyrazole was performed with KEGG ORTHOLOGY: K13953 (genome.jp).

2.12. Data Analysis

All of the experiments were performed at least three times. Data from repeated experiments were represented as means ± standard deviation (S.D.), and all statistical analyses were performed using SPSS 19.0 software (SPSS, Chicago, IL, USA). The independent sample t-test and one-way analysis of variance were used to assess differences between the groups. A p value of <0.05 was considered to denote statistical significance.

3. Results

3.1. Sequence Analysis of BxCAD-1 Gene

The full-length ORF of BxCAD-1 gene is 1077 bp (GenBank accession no: ON540735), which encodes 358 amino acid residues (Figure 1) with a molecular mass of 38.93 kDa and a theoretical pI of 8.27. The major amino acids of BxCAD-1 protein are Val (11.2%), Ala (9.5%), Gly (8.9%), Leu (7.0%) and Lys (6.7%). The predicted structure includes one NAD binding domain (156–327 bp), two substrate binding domains (41–150 and 193–320 bp), one molecular chaperone binding domain (10–187 bp), and one Zn²⁺ binding domain (77–91 bp). Based on the analysis of a three-dimensional structure diagram, four polypeptide chains can form a highly symmetrical tetramer complex. One subunit can bind two Zn²⁺ and one NAD, with one Zn²⁺ participating in the catalytic reaction and the other stabilizing the structure (Figure 2). It is predicted that the protein has no signal peptide and transmembrane domain.

The alignment of amino acid sequences showed that the BxCAD-1 protein of B. xylophilus had the closest evolutionary relationship with cinnamyl alcohol dehydrogenase (GenBank accession no: CAD5217100.1) in B. xylophilus, with the highest homology of 98%. It also had strong homology of 96% with alcohol dehydrogenase (GenBank accession no: ARA71334.1) (Figure 3). The gene cloned in this study was named BxCAD-1.

3.2. Induced Expression and Purification of Recombinant BxCAD-1

The protein encoded by BxCAD-1 was over-expressed in E. coli BL21 (DE3) upon IPTG induction and appeared mainly in inclusion bodies. After the recombinant protein in inclusion bodies was resolved in urea solution and refolded by a series of dilutions, it was purified by affinity chromatography on nickel-binding resin. The recombinant protein was purified to homogeneity with a relative molecular weight of 38 kDa as analyzed by SDS-PAGE (Figure 4), which was consistent with that of cinnamyl alcohol dehydrogenase encoded by BxCAD-1.

3.3. Determination of Cinnamyl Alcohol Dehydrogenase Activity

The effects of pH, temperature, metal ions and substrates on the activity of cinnamyl alcohol dehydrogenase were determined. The recombinant cinnamyl alcohol dehydrogenase showed the highest catalytic activity at pH 8.0, and the optimal temperature for this enzyme was 40 °C. The Zn²⁺ achieved the highest enzyme activity compared to other metal ions (p < 0.05), and Fe²⁺, Mg²⁺ and Ni²⁺ had a similar activating effect, whereas K⁺ showed no effect on its activity (p > 0.05). The optimal substrate for this enzyme was cinnamyl alcohol, followed by sorbitol and ethanol (Figure 5).

3.4. RNAi of BxCAD-1

3.4.1. Efficiency Assessment of RNAi

The RNAi efficiency on the BxCAD-1 expression level was evaluated through qRT-PCR. The results showed that compared with the expression level of BxCAD-1 in the B. xylophilus soaked in sterilized water, that in the B. xylophilus soaked in fragment 1, 2 and 3 dsRNA solution decreased. Fragment 2 had the greatest impact on gene expression level. This result indicated that the expression of BxCAD-1 could be strongly inhibited by soaking the B. xylophilus in BxCAD-1 dsRNA. The gfp dsRNA, as one of the negative controls, demonstrated no significant effects on the expression level of BxCAD-1 compared with distilled water (Figure 6).

The markers labeled gfp, fragment 1, fragment 2 and fragment 3 were B. xylophilus treated with dsRNA of gfp, fragment 1, fragment 2 and fragment 3 of BxCAD-1, respectively.

3.4.2. B. xylophilus Movement and Reproduction

The B. xylophilus in distilled H₂O and dsRNA from gfp had the highest head thrashing frequency of 95.62 ± 6.26 and 94.34 ± 7.58, respectively (p > 0.05). The thrashes of nematodes treated with interfering fragments 1, 2 and 3 were 67.86 ± 5.40, 47.82 ± 5.71 and 67.96 ± 6.38, respectively. Notably, the inhibitory effect of fragment 2 was significantly higher than fragments 1 and 3. The thrashes of nematodes treated with 4-methylpyrazole were 43.54 ± 4.35, which was similar to the effect of fragment 2 (Figure 7A).

The number of B. xylophilus treated differently after 9 days of inoculation was recorded. The number of B. xylophilus in distilled H₂O and dsRNA from gfp was the largest, with 18,450 ± 1556.44 and 17,916.67 ± 1973.50, respectively (p > 0.05). The number of PWN treated with interfering fragments 1, 2 and 3 were 7516.67 ± 371.56, 2983.33 ± 279.38 and 6650 ± 262.99, respectively, and the inhibitory effect of fragment 2 was the best. The PWN treated with 4-methylpyrazole was 2050 ± 298.61, which had a similar effect to fragment 2 (Figure 7B).

3.4.3. Spawning and Hatching Rate of B. xylophilus

The number of eggs for B. xylophilus in distilled H₂O and dsRNA from gfp was 77.6 ± 5 and 74.6 ± 3.2, respectively (p > 0.05). The egg number for B. xylophilus treated with fragments 1, 2 and 3 were 49.2 ± 8.4, 31 ± 4.86 and 52.4 ± 5.85, respectively, and the inhibitory effect of fragment 2 was the best, which was significantly lower than that of fragments 1 and 3. The egg number for PWN treated with 4-methylpyrazole was 21.4 ± 3.26, which was significantly lower than that of fragment 2 (Figure 7C).

The hatching rate of eggs laid by B. xylophilus in distilled H₂O and dsRNA from gfp were 87.37 ± 2.99% and 86.33 ± 3.31%, respectively, and 4-Methylpyrazole was 27.10 ± 3.61%, which is significantly lower than that of fragment 2 (Figure 7D).

3.4.4. Feeding and Infectivity Ability of B. xylophilus

The feeding ability of B. xylophilus treated differently was recorded from day 1 to day 9 after B. xylophilus was inoculated on Botrytis cinerea cultures on PDA plates. The Botrytis cinerea inoculated with B. xylophilus in distilled H₂O and dsRNA from gfp were depleted, approximately 1/2 and 1/4 of mycelia were ingested, and more than 3/4 mycelia was left for methylpyrazole-treated B. xylophilus on day 9. The feeding of fragment 1 and fragment 3 were similar, with a feeding area of 1/2, fragment 2 was 1/4, and 4-Methylpyrazole was the smallest, which was less than 1/4 (Figure 8A).

To investigate the infectivity of PWN treated differently, the seedlings of P. thunbergii were inoculated with different PWNs. The growth status of seedlings at 0, 9 and 21 days after infection were recorded, respectively. On the ninth day after infection, the seedlings treated with B. xylophilus in distilled H₂O and dsRNA from gfp began to wither, and those in the negative control group, inoculated with B. xylophilus in dsRNA from BxCAD-1 and 4-methylpyrazole had no significant changes. On the twenty-first day after infection, all seedlings had completely withered and died, except those in the negative control group (Figure 8B).

3.4.5. Lifespan and Development of B. xylophilus

The survival rate of B. xylophilus per day was recorded. No significant difference was observed in the first three days, but the mortality of B. xylophilus treated with 4-methylpyrazole and dsRNA from three fragments of BxCAD-1 increased from the fourth day. Until the seventh day, the survival rate of PWN in distilled H₂O, dsRNA from gfp and 4-methylpyrazole was 63 ± 4.64%, 61.33 ± 5.31% and 32 ± 4.19%, respectively, while the survival rate of PWN treated with interfering fragment 1, 2 and 3 was 46 ± 5.73%, 37.33 ± 3.09% and 42.33 ± 7.13%, respectively (p > 0.05) (Figure 9A).

After RNAi by dsRNA of fragment 2 of BxCAD-1, the proportion of larvae increased significantly, accounting for 28.33 ± 2.34%, while that in distilled H₂O and dsRNA from gfp were 17.33 ± 2.05% and 17.17 ± 2.11%, respectively. The proportion of male PWN accounted for 4.67 ± 1.11%, and female PWN accounted for 66.33 ± 1.97%, whereas male PWN in distilled H₂O and gfp were 9.5 ± 1.71% and 9.17 ± 1.34%, and female PWN were 72.67 ± 1.37% and 73.67 ± 1.97%, respectively (Figure 9B).

3.4.6. Sensitivity to Ethanol and Oviposition of B. xylophilus

The B. xylophilus in the distilled H₂O and dsRNA from gfp control groups showed obvious clumping behavior 24 h after providing ethanol of 1%, and approximately one hundred B. xylophilus were cuddled together (Figure 9). After 72 h, the B. xylophilus scattered and began to lay eggs; the number of eggs laid for B. xylophilus in distilled H₂O and dsRNA from gfp were 13.33 ± 1.25, 14.33 ± 1.24, respectively (p > 0.05) (Figure 9C). The B. xylophilus had no obvious clumping behavior after RNAi by dsRNA of fragment 2 of BxCAD-1, and the number of eggs laid after 72 h was only 3.33 ±1.25 (Figure 9C and Figure 10).

3.4.7. Reactive Oxygen Species and Activities of Antioxidant Enzymes

After RNAi by dsRNA of fragment 2 of BxCAD-1, the fluorescence value of reactive oxygen species of B. xylophilus was the highest, which was significantly different from the value of B. xylophilus in distilled H₂O and dsRNA from gfp treatment groups (p < 0.05). (

Table 4. The fluorescence intensity of reactive oxygen species of Bursaphelenchus xylophilus after RNAi.

Group	Fluorescence Intensity (OD)
distilled H2O	22,935.33 ± 523.15
GFP	28,191.33 ± 619.84
fragment 2	56,021.67 ± 1262.13
negative control	1732.00 ± 10.20
positive control	32,641.33 ± 479.17

) (Figure 11). The activity of SOD, POD and CAT decreased to 43.72%, 79.89% and 58.74% of that of B. xylophilus in distilled H₂O, which were also significantly lower (p < 0.05) (Figure 9D).

3.5. In Situ Hybridization

The in situ hybridization indicated that the BxCAD-1 gene was mainly expressed in the digestive tract of male and female adults. No obvious expression was observed in eggs and larvae at various stages (Figure 12).

3.6. Analysis of KEGG Pathway of BxCAD-1 Gene

The pathway that the BxCAD-1 gene is involved in includes glycolysis/gluconeogenesis, fatty acid degradation, tyrosine metabolism, pyruvate metabolism, chloroalkane and chloroalkene degradation, naphthalene degradation, retinol metabolism and metabolism of xenobiotics by cytochrome P450. Its function is mainly to participate in the catalytic reaction between various alcohols and aldehydes, such as ethanol and ethanol, retinol and retinal, 3-chloroallyl alcohol and 3-chloroallyl aldehyde, 1-naphthalenemethanol and 1-naphthaldehyde as well as trichloroethanol and chloral hydrate.

4. Discussion

Pine wilt disease causes severe damage to pine forests and the environment. Currently, the major preventive measures against PWD include cutting out disease trees, breeding PWN-resistant pine trees, managing vector insects and performing trunk injection of pesticides. However, the implementation of these procedures cannot eliminate PWD. Therefore, it is an economical and efficient method to find specific gene targets of PWN and design effective pesticides to control this disease.

As a pathogenic organism, PWN can activate the defense mechanism of an infected pine tree, including the production of toxic secondary metabolites, activation of defense genes, and cell structure changes [60,61,62,63]. In order to break through the defense system barrier of the host, PWN produces a variety of enzymes and secondary metabolites for reaction, such as peroxidase, aldehyde dehydrogenase, cellulase and toxic factor [64,65]. In this study, the cDNA coding cinnamyl alcohol dehydrogenase from pine wood nematode was cloned and overexpressed. The characteristics of the recombinant BxCAD-1 were studied, and the effects of RNAi of BxCAD-1 were investigated thoroughly. Additionally, the main expression pattern of BxCAD-1 was also investigated through in situ hybridization.

From the results of homology analysis, BxCAD-1 is most similar to the possible cinnamyl alcohol dehydrogenase and alcohol dehydrogenase in B. xylophilus, which is also confirmed by bioassay of BxCAD-1 with different substrates in this study. BxCAD-1 can catalyze seven substrates with cinnamyl alcohol as its optimal substrate, and show an optimal temperature of 40 °C, whereas the optimal temperature of alcohol dehydrogenase from PWN was reported to be 30 °C [53]. Considering the above factors, we assume BxCAD-1 is a cinnamyl alcohol dehydrogenase and speculate that BxCAD-1 and alcohol dehydrogenase are a group of isoenzymes, but their optimal reaction temperature and substrate are not the same. Therefore, further study of BxCAS-1 is warranted.

Cinnamyl alcohol dehydrogenase is mainly involved in the formation of lignin in plants but plays other roles in microorganisms [28,29,30,31,32,33,34,35,36,37]. According to the results of in situ hybridization, the BxCAD-1 gene is highly expressed in the digestive tract. The obvious fluoresce signal in the spicules of male adults might contribute to its tissue structure since in situ hybridization analysis of UGT440A1 expression patterns also indicated the aggregation of fluorescent probes in spicules [51]. Considering other phenomena caused by RNAi of BxCAD-1, we speculate that BxCAD-1 is mainly associated with the feeding and reproduction of pine wood nematode. The cytochrome P450 gene and pectin lyase gene of B. xylophilus can destroy plant cell tissues and help B. xylophilus to migrate. The slower migration rate of B. xylophilus can be observed by RNAi with gene expression [43,44]. Silencing of effector BxSapB1 can also reduce the pathogenicity of B. xylophilus [45]. Through RNAi of the BxCAD-1 gene, the motor ability, feeding, reproduction, infection, lifespan, spawning rate and hatching rate of B. xylophilus are all decreased. To further study the role of this gene in the development of B. xylophilus, we selected synchronous B. xylophilus to observe their development. After RNAi of BxCAD-1, the proportion of larvae increased, and the number of male adults decreased significantly. We speculate that the BxCAD-1 gene is related to the formation and function of spicules of male B. xylophilus, which further affects the transition from the larval stage to the adult stage.

Pine trees infected with PWD can produce a large amount of volatiles, including ethanol, the mechanism of which is still unknown [66]. A large number of studies have shown that ethanol can promote the reproduction and expansion of B. xylophilus in pine trees. There was a report that ethanol was produced and released in a large amount 10 d after the resin ceased to secrete in the PWN-infected pine trees. The number of PWN increased dramatically two weeks after infection [66]. Studies also showed that low concentrations of ethanol could promote the oviposition of B. xylophilus, whereas higher concentrations of ethanol could reduce the oviposition of B. xylophilus [67,68]. A low concentration of dihydroconiferylalcohol was also reported to cause serious pine wilt by promoting the reproduction of B. xylophilus [69]. By silencing the BxCAD-1 gene through RNAi, the sensitivity of B. xylophilus to ethanol decreased and B. xylophilus tended to lay fewer eggs, which indicated that BxCAD-1 participated in alcohol-induced regulation of reproduction. Additionally, we observed an interesting phenomenon that ethanol could promote the clumping behavior of PWNs. Pine wood nematodes began to clump after providing 1% ethanol for 1 h, and this aggregation with a large number might last for 3 d followed by redispersing and laying eggs, while B. xylophilus without ethanol did not appear to have clumping behavior. In contrast, PWNs of RNAi for BxCAD-1 did not show obvious massive aggregation behavior, and there was no significant change in behavior even after providing 1% ethanol. Small chemical signals, such as ascarosides with hydroxyls, have been reported to attract potential mates of B. xylophilus [70]. Considering that cinnamyl alcohol dehydrogenase could catalyze the reaction of various substrates containing hydroxyls such as D-pinitol, sorbitol and 2-methoxyphenol, we speculated that B. xylophilus might be stimulated to mate by hydroxyl-oxidated aldehyde group-containing substances catalyzed by BxCAD-1.

The increase of active oxygen species in PWN after RNAi of BxCAD-1 might be one of the reasons for the shortened lifespan of B. xylophilus. Combined with the analysis of the KEGG pathway, the BxCAD-1 gene could participate in the metabolic pathway of cytochrome P450 and the metabolism of reactive oxygen species. In addition, through KEGG pathway analysis, the BxCAD-1 gene is involved in a variety of energy metabolism pathways, which is consistent with the results of in situ hybridization.

5. Conclusions

In summary, BxCAD-1 coding cinnamyl alcohol dehydrogenase was found to participate in the reproduction and development of B. xylophilus. The movement ability, feeding ability, reproductive ability, spawning rate, hatching rate, lifespan, infectivity and sensitivity to ethanol could be suppressed, and reactive oxygen species could accumulate through down-regulation of BxCAD-1 expression, which makes BxCAD-1 a promising target for exploring pesticides to control B. xylophilus. Additional investigations are needed to elucidate the roles of BxCAD-1.