BKTyper: Free Online Tool for Polyoma BK Virus VP1 and NCCR Typing
Abstract
:1. Introduction
2. Materials and Methods
3. Results
3.1. VP1 Genotyping
3.1.1. VP1 BKTGR (BK Typing and Grouping Region)
3.1.2. BKTGR Phylogeny
3.1.3. VP1 Genotyping Validation
3.2. NCCR Typing
3.2.1. Defining a Canon for the Archetypical OPQRS Blocks
3.2.2. NCCR Typing Based on Local Alignment
3.2.3. NCCR Typing Validation
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Appendix A
Open nucleotide sequence in fasta format: |
Locally align sequence against VP1 gene from BKPyV virus Dunlop strain using Needleman–Wunch algorithm: |
Gap open penalty of 10 |
Gap extension penalty of 0.5 |
Trim alignment: |
From beginning until first position without gap |
From end until first position without gap |
Reallocate Dunlop coordinates {1976, 1988, 1995, 2006, 2018, 2057, 2075} to alignment coordinates: |
For each Dunlop coordinate: |
Define specific motif in Dunlop sequence |
Store Dunlop coordinate and specific motif |
Search specific motifs by coordinate order in alignment: |
If match: |
Compare the query position of the first position in Dunlop motif match: |
If nucleotide in subject (Dunlop-motif-1988) is G: |
Then subgroup is Ic |
If nucleotide in subject (Dunlop-motif-2075) is C: |
Then subgroup is Ib-1 |
If nucleotide in subject (Dunlop-motif-1988) is A: |
Then subgroup is Ia |
If nucleotide in subject (Dunlop-motif-2018) is T AND |
nucleotide in subject (Dunlop-motif-2027) is T: |
Then subgroup is Ib-2 |
If nucleotide in subject (Dunlop-motif-1988) is T: |
Then subgroup is III |
If nucleotide in subject (Dunlop-motif-2006) is T: |
Then subgroup is II |
If nucleotide in subject (Dunlop-motif-2057) is G: |
Then subgroup is IVa-1 |
If nucleotide in subject (Dunlop-motif-2057) is C: |
Then subgroup is IVa-2 |
If nucleotide in subject (Dunlop-motif-1995) is G: |
Then subgroup is IVc-1 |
If nucleotide in subject (Dunlop-motif-1976) is A: |
Then subgroup is IVc-2 |
If not any of the above: |
Then subgroup is IVb-1 or IVb-2 |
Report BKPyV subgroup and nucleotide in subject (Dunlop-motif-1976, Dunlop-motif-1988, Dunlop-motif-1995, Dunlop-motif-2006, Dunlop-motif-2018, Dunlop-motif-2057, Dunlop-motif-2075). |
Appendix B
Open nucleotide sequence in fasta format: |
Locally align sequence against NCCR BK virus archetypes using blastn: |
Word size of 12 |
Minimum e-value of 0.05 |
Minimum percentage of identity of 75% |
Read alignment: |
Order ascendingly query start sequence position: |
By block type: |
By query start and end sequence positions: |
Keep the longest alignment |
Report the start and end block positions |
Report BK NCCR organization and coordinates of each block |
References
- Gardner, S.; Field, A.; Coleman, D.; Hulme, B. New human papovavirus (B.K.) isolated from urine after renal transplantation. Lancet 1971, 297, 1253–1257. [Google Scholar] [CrossRef]
- Krumbholz, A.; Bininda-Emonds, O.R.P.; Wutzler, P.; Zell, R. Evolution of four BK virus subtypes. Infect. Genet. Evol. 2008, 8, 632–643. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hirsch, H.H.; Knowles, W.; Dickenmann, M.; Passweg, J.; Klimkait, T.; Mihatsch, M.J.; Steiger, J. Prospective Study of Polyomavirus Type BK Replication and Nephropathy in Renal-Transplant Recipients. N. Engl. J. Med. 2002, 347, 488–496. [Google Scholar] [CrossRef] [PubMed]
- Bethge, T.; Hachemi, H.A.; Manzetti, J.; Gosert, R.; Schaffner, W.; Hirsch, H.H. Sp1 Sites in the Noncoding Control Region of BK Polyomavirus Are Key Regulators of Bidirectional Viral Early and Late Gene Expression. J. Virol. 2015, 89, 3396–3411. [Google Scholar] [CrossRef] [Green Version]
- Carr, M.J.; McCormack, G.P.; Mutton, K.J.; Crowley, B. Unique BK virus non-coding control region (NCCR) variants in hematopoietic stem cell transplant recipients with and without hemorrhagic cystitis. J. Med. Virol. 2006, 78, 485–493. [Google Scholar] [CrossRef] [PubMed]
- Barcena-Panero, A.; Echevarria, J.E.; Van Ghelue, M.; Fedele, G.; Royuela, E.; Gerits, N.; Moens, U. BK polyomavirus with archetypal and rearranged non-coding control regions is present in cerebrospinal fluids from patients with neurological complications. J. Gen. Virol. 2012, 93, 1780–1794. [Google Scholar] [CrossRef] [PubMed]
- Burger-Calderon, R.; Ramsey, K.J.; Dolittle-Hall, J.M.; Seaman, W.T.; Jeffers-Francis, L.K.; Tesfu, D.; Nickeleit, V.; Webster-Cyriaque, J. Distinct BK polyomavirus non-coding control region (NCCR) variants in oral fluids of HIV-associated Salivary Gland Disease patients. Virology 2016, 493, 255–266. [Google Scholar] [CrossRef]
- Gosert, R.; Rinaldo, C.H.; Funk, G.A.; Egli, A.; Ramos, E.; Drachenberg, C.B.; Hirsch, H.H. Polyomavirus BK with rearranged noncoding control region emerge in vivo in renal transplant patients and increase viral replication and cytopathology. J. Exp. Med. 2008, 205, 841–852. [Google Scholar] [CrossRef] [Green Version]
- Jin, L. Molecular Methods for Identification and Genotyping of BK Virus. In SV40 Protocols; Humana Press: New Jersey, NJ, USA, 2015; Volume 165, pp. 33–48. [Google Scholar]
- Ranjan, R.; Rani, A.; Brennan, D.C.; Finn, P.W.; Perkins, D.L. Complete Genome Sequence of BK Polyomavirus Subtype Ib-1 Detected in a Kidney Transplant Patient with BK Viremia Using Shotgun Sequencing. Genome Announc. 2017, 5. [Google Scholar] [CrossRef] [Green Version]
- Zhong, S.; Randhawa, P.S.; Ikegaya, H.; Chen, Q.; Zheng, H.-Y.; Suzuki, M.; Takeuchi, T.; Shibuya, A.; Kitamura, T.; Yogo, Y. Distribution patterns of BK polyomavirus (BKV) subtypes and subgroups in American, European and Asian populations suggest co-migration of BKV and the human race. J. Gen. Virol. 2009, 90, 144–152. [Google Scholar] [CrossRef]
- Nishimoto, Y.; Zheng, H.-Y.; Zhong, S.; Ikegaya, H.; Chen, Q.; Sugimoto, C.; Kitamura, T.; Yogo, Y. An Asian Origin for Subtype IV BK Virus Based on Phylogenetic Analysis. J. Mol. Evol. 2007, 65, 103–111. [Google Scholar] [CrossRef] [PubMed]
- Morel, V.; Martin, E.; François, C.; Helle, F.; Faucher, J.; Mourez, T.; Choukroun, G.; Duverlie, G.; Castelain, S.; Brochot, E. A Simple and Reliable Strategy for BK Virus Subtyping and Subgrouping. J. Clin. Microbiol. 2017, 55, 1177–1185. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bhattacharjee, S.; Chakraborty, T. High Reactivation of BK Virus Variants in Asian Indians with Renal Disorders and During Pregnancy. Virus Genes 2004, 28, 157–168. [Google Scholar] [CrossRef] [PubMed]
- Egli, A.; Infanti, L.; Dumoulin, A.; Buser, A.; Samaridis, J.; Stebler, C.; Gosert, R.; Hirsch, H.H. Prevalence of Polyomavirus BK and JC Infection and Replication in 400 Healthy Blood Donors. J. Infect. Dis. 2009, 199, 837–846. [Google Scholar] [CrossRef] [Green Version]
- Helle, F.; Brochot, E.; Handala, L.; Martin, E.; Castelain, S.; Francois, C.; Duverlie, G. Biology of the BKPyV: An Update. Viruses 2017, 9, 327. [Google Scholar] [CrossRef] [Green Version]
- Wang, R.Y.L.; Li, Y.-J.; Lee, W.-C.; Wu, H.-H.; Lin, C.-Y.; Lee, C.-C.; Chen, Y.-C.; Hung, C.-C.; Yang, C.-W.; Tian, Y.-C. The association between polyomavirus BK strains and BKV viruria in liver transplant recipients. Sci. Rep. 2016, 6, 28491. [Google Scholar] [CrossRef]
- Sharma, P.M.; Gupta, G.; Vats, A.; Shapiro, R.; Randhawa, P.S. Polyomavirus BK non-coding control region rearrangements in health and disease. J. Med. Virol. 2007, 79, 1199–1207. [Google Scholar] [CrossRef]
- Anzivino, E.; Bellizzi, A.; Mitterhofer, A.; Tinti, F.; Barile, M.; Colosimo, M.; Fioriti, D.; Mischitelli, M.; Chiarini, F.; Ferretti, G.; et al. Early monitoring of the human polyomavirus BK replication and sequencing analysis in a cohort of adult kidney transplant patients treated with basiliximab. Virol. J. 2011, 8, 407. [Google Scholar] [CrossRef] [Green Version]
- Liimatainen, H.; Weseslindtner, L.; Strassl, R.; Aberle, S.W.; Bond, G.; Auvinen, E. Next-generation sequencing shows marked rearrangements of BK polyomavirus that favor but are not required for polyomavirus-associated nephropathy. J. Clin. Virol. 2020, 122, 104215. [Google Scholar] [CrossRef]
- Cock, P.J.A.; Antao, T.; Chang, J.T.; Chapman, B.A.; Cox, C.J.; Dalke, A.; Friedberg, I.; Hamelryck, T.; Kauff, F.; Wilczynski, B.; et al. Biopython: Freely available Python tools for computational molecular biology and bioinformatics. Bioinformatics 2009, 25, 1422–1423. [Google Scholar] [CrossRef]
- Pritchard, L.; White, J.A.; Birch, P.R.J.; Toth, I.K. GenomeDiagram: A python package for the visualization of large-scale genomic data. Bioinformatics 2006, 22, 616–617. [Google Scholar] [CrossRef] [Green Version]
- van der Walt, S.; Colbert, S.C.; Varoquaux, G. The NumPy Array: A Structure for Efficient Numerical Computation. Comput. Sci. Eng. 2011, 13, 22–30. [Google Scholar] [CrossRef] [Green Version]
- McKinney, W. Data Structures for Statistical Computing in Python. In Proceedings of the 9th Python in Science Conference, Austin, TX, USA, 28 June–3 July 2010; 445, pp. 56–61. [Google Scholar]
- Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Camacho, C.; Coulouris, G.; Avagyan, V.; Ma, N.; Papadopoulos, J.; Bealer, K.; Madden, T.L. BLAST plus: Architecture and applications. BMC Bioinform. 2009, 10, 1. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Minh, B.Q.; Schmidt, H.A.; Chernomor, O.; Schrempf, D.; Woodhams, M.D.; von Haeseler, A.; Lanfear, R. IQ-TREE 2: New Models and Efficient Methods for Phylogenetic Inference in the Genomic Era. Mol. Biol. Evol. 2020, 37, 1530–1534. [Google Scholar] [CrossRef] [Green Version]
- Needleman, S.B.; Wunsch, C.D. A general method applicable to the search for similarities in the amino acid sequence of two proteins. J. Mol. Biol. 1970, 48, 443–453. [Google Scholar] [CrossRef]
- Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.K.F.; von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat. Methods 2017, 14, 587–589. [Google Scholar] [CrossRef] [Green Version]
- Hoang, D.T.; Chernomor, O.; von Haeseler, A.; Minh, B.Q.; Vinh, L.S. UFBoot2: Improving the Ultrafast Bootstrap Approximation. Mol. Biol. Evol. 2018, 35, 518–522. [Google Scholar] [CrossRef]
- Markowitz, R.B.; Dynan, W.S. Binding of cellular proteins to the regulatory region of BK virus DNA. J. Virol. 1988, 62, 3388–3398. [Google Scholar] [CrossRef] [Green Version]
- Moens, U.; Van Ghelue, M. Polymorphism in the genome of non-passaged human polyomavirus BK: Implications for cell tropism and the pathological role of the virus. Virology 2005, 331, 209–231. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Moens, U.; Johansen, T.; Johnsen, J.I.; Seternes, O.M.; Traavik, T. Noncoding control region of naturally occurring BK virus variants: Sequence comparison and functional analysis. Virus Genes 1995, 10, 261–275. [Google Scholar] [CrossRef] [PubMed]
- Burger-Calderon, R.; Madden, V.; Hallett, R.A.; Gingerich, A.D.; Nickeleit, V.; Webster-Cyriaque, J. Replication of Oral BK Virus in Human Salivary Gland Cells. J. Virol. 2014, 88, 559–573. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, R.; Wu, R. BK virus DNA: Complete nucleotide sequence of a human tumor virus. Science 1979, 206, 456–462. [Google Scholar] [CrossRef]
NCCR Block | Sequence |
---|---|
O | TTTTGCAAAAATTGCAAAAGAATAGGGATTTCCCCAAATAGTTTTGCTAGGCCTCAGAAAAAGCCTCCACACCCTTACTACTTGAGAGAAAGGGTGGAGGCAGAGGCGGCCTCGGCCTCTTATATATTATAAAAAAAAAGGC |
P | CACAGGGAGGAGCTGCTTACCCATGGAATGCAGCCAAACCATGACCTCAGGAAGGAAAGTGCATGACT |
Q | GGGCAGCCAGCCAGTGGCAGTTAATAGTGAAACCCCGCC |
R | CCTGAAATTCTCAAATAAACACAAGAGGAAGTGGAAACTGGCCAAAGGAGTGGAAAGCAGCCA |
S | GACAGACATGTTTTGCGAGCCTAGGAATCTTGGCCTTGTCCCCAGTTAAACTGGACAAAGGCC |
Genome Coordinates | VP1 Coordinates | Conserved Motif |
---|---|---|
1989 | 426 | AAAACCTAT |
2076 | 513 | AAGTAC |
2019 | 456 | CTTTGCTG |
2028 | 465 | AGGTGGAGAA |
2007 | 444 | TAATTTCCACTTCTTTG |
2058 | 495 | GCTAATGAATTACAG |
1996 | 433 | ATTCAAGGCAGTAATTT |
1977 | 414 | GCATGGTGGAGGAAA |
Transcriptional Binding Sites | Motif |
---|---|
Promoter IL-6 gene | TTCC |
T-Antigen | GCCTC or GCCCC |
NF-1 | TCCA or TGGCCTTGTCCCCAG |
Polyomavirus enhancer B | AGAGG |
SP-1 | AGGCGG |
Unknown JC polyomavirus binding factor (JVC) | GGGAGGAG |
Cytomegalovirus immediate early promoter (CMV IE-1) | GGAAAG |
NFkB | GTGAAACCCC |
SV40 enhancer-core | TGGAAAG |
CRE | TGACCTCA |
GRE | TGTCCC |
Murine Thy-1 | AGGC |
TATA box | TATAA |
Transcription factor Late SV40 (LSF) | CCCGCC |
Percentage | N | NCCR | VP1 |
---|---|---|---|
24.53 | 78 | OPQRS | Ic |
16.04 | 51 | OPQRS | Ib-2 |
12.26 | 39 | OPQRS | Ib-1 |
9.12 | 29 | OPQRS | IVc-2 |
5.35 | 17 | OPQRS | IVc-1 |
5.35 | 17 | OPQRS | IVb-1,2 |
4.09 | 13 | NA | Ib-2 |
3.14 | 10 | OPQRS | Ia |
2.52 | 8 | OPQRS | III |
2.52 | 8 | OPPQRS | Ic |
2.20 | 7 | OPQRS | IVa-2 |
1.57 | 5 | OPQRS | IVa-1 |
1.57 | 5 | OPQRS | II |
1.26 | 4 | OPQROPQRS | Ic |
1.26 | 4 | OPQPQS | Ia |
1.26 | 4 | OPOPQRS | Ic |
1.26 | 4 | NA | Ia |
0.94 | 3 | NA | Ib-1 |
0.63 | 2 | OPPQRS | Ib-1 |
0.63 | 2 | OPPPS | Ia |
0.31 | 1 | OPS | Ia |
0.31 | 1 | OPQSPQS | Ia |
0.31 | 1 | OPQRSRS | IVb-1.2 |
0.31 | 1 | OPQQRS | Ib-1 |
0.31 | 1 | OPQPQPQS | Ia |
0.31 | 1 | OPQOPQRS | Ic |
0.31 | 1 | OPPQR | IVb-1.2 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Martí-Carreras, J.; Mineeva-Sangwo, O.; Topalis, D.; Snoeck, R.; Andrei, G.; Maes, P. BKTyper: Free Online Tool for Polyoma BK Virus VP1 and NCCR Typing. Viruses 2020, 12, 837. https://doi.org/10.3390/v12080837
Martí-Carreras J, Mineeva-Sangwo O, Topalis D, Snoeck R, Andrei G, Maes P. BKTyper: Free Online Tool for Polyoma BK Virus VP1 and NCCR Typing. Viruses. 2020; 12(8):837. https://doi.org/10.3390/v12080837
Chicago/Turabian StyleMartí-Carreras, Joan, Olga Mineeva-Sangwo, Dimitrios Topalis, Robert Snoeck, Graciela Andrei, and Piet Maes. 2020. "BKTyper: Free Online Tool for Polyoma BK Virus VP1 and NCCR Typing" Viruses 12, no. 8: 837. https://doi.org/10.3390/v12080837
APA StyleMartí-Carreras, J., Mineeva-Sangwo, O., Topalis, D., Snoeck, R., Andrei, G., & Maes, P. (2020). BKTyper: Free Online Tool for Polyoma BK Virus VP1 and NCCR Typing. Viruses, 12(8), 837. https://doi.org/10.3390/v12080837