Construction, Characterization and Application of Recombinant Porcine Deltacoronavirus Expressing Nanoluciferase
Abstract
:1. Introduction
2. Materials and Methods
2.1. Viruses, Cells and Antibodies
2.2. Assembly of an Infectious cDNA Clone of PDCoV CHN-HN-2014
2.3. Recovery of Recombinant Virus
2.4. Indirect Immunofluorescence Assay (IFA)
2.5. Plaque Assay
2.6. Viral Growth Curves
2.7. Western Blot Analysis
2.8. Quantitative Real-Time RT-PCR
2.9. Generation of Recombinant Virus Expressing Nluc
2.10. Cell Viability Analysis
2.11. Statistical Analysis
3. Results
3.1. Recovery and Identification of Recombinant Virus
3.2. Characterization of Growth Kinetics of CHN-HN-2014 and rCHN-HN-2014
3.3. Recovery of PDCoV Reporter Virus Expressing Nluc
3.4. Characterization of Growth Kinetics of Nluc Reporter Virus In Vitro
3.5. Application of Nluc Reporter VIruses in Drugs Screening
3.6. Application of Nluc Reporter Virus in Identifying Permissive Cell Lines
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Yang, Y.L.; Liang, Q.Z.; Xu, S.Y.; Mazing, E.; Xu, G.H.; Peng, L.; Qin, P.; Wang, B.; Huang, Y.W. Characterization of a novel bat-HKU2-like swine enteric alphacoronavirus (SeACoV) infection in cultured cells and development of a SeACoV infectious clone. Virology 2019, 536, 110–118. [Google Scholar] [CrossRef]
- Dong, N.; Fang, L.; Yang, H.; Liu, H.; Du, T.; Fang, P.; Wang, D.; Chen, H.; Xiao, S. Isolation, genomic characterization, and pathogenicity of a Chinese porcine deltacoronavirus strain CHN-HN-2014. Vet. Microbiol. 2016, 196, 98–106. [Google Scholar] [CrossRef]
- Fung, T.S.; Liu, D.X. Similarities and Dissimilarities of COVID-19 and Other Coronavirus Diseases. Annu. Rev. Microbiol. 2021, 75, 19–47. [Google Scholar] [CrossRef]
- Woo, P.C.; Lau, S.K.; Lam, C.S.; Lau, C.C.; Tsang, A.K.; Lau, J.H.; Bai, R.; Teng, J.L.; Tsang, C.C.; Wang, M.; et al. Discovery of seven novel Mammalian and avian coronaviruses in the genus deltacoronavirus supports bat coronaviruses as the gene source of alphacoronavirus and betacoronavirus and avian coronaviruses as the gene source of gammacoronavirus and deltacoronavirus. J. Virol. 2012, 86, 3995–4008. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hu, H.; Jung, K.; Vlasova, A.N.; Saif, L.J. Experimental infection of gnotobiotic pigs with the cell-culture-adapted porcine deltacoronavirus strain OH-FD22. Arch. Virol. 2016, 161, 3421–3434. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, J.; Chen, J.; Liu, Y.; Da, S.; Shi, H.; Zhang, X.; Liu, J.; Cao, L.; Zhu, X.; Wang, X.; et al. Pathogenicity of porcine deltacoronavirus (PDCoV) strain NH and immunization of pregnant sows with an inactivated PDCoV vaccine protects 5-day-old neonatal piglets from virulent challenge. Transbound. Emerg. Dis. 2020, 67, 572–583. [Google Scholar] [CrossRef] [PubMed]
- Janetanakit, T.; Lumyai, M.; Bunpapong, N.; Boonyapisitsopa, S.; Chaiyawong, S.; Nonthabenjawan, N.; Kesdaengsakonwut, S.; Amonsin, A. Porcine Deltacoronavirus, Thailand, 2015. Emerg. Infect. Dis. 2016, 22, 757–759. [Google Scholar] [CrossRef] [Green Version]
- Ma, Y.; Zhang, Y.; Liang, X.; Lou, F.; Oglesbee, M.; Krakowka, S.; Li, J. Origin, evolution, and virulence of porcine deltacoronaviruses in the United States. mBio 2015, 6, e00064. [Google Scholar] [CrossRef] [Green Version]
- Fang, P.; Fang, L.; Liu, X.; Hong, Y.; Wang, Y.; Dong, N.; Ma, P.; Bi, J.; Wang, D.; Xiao, S. Identification and subcellular localization of porcine deltacoronavirus accessory protein NS6. Virology 2016, 499, 170–177. [Google Scholar] [CrossRef]
- Fang, P.; Fang, L.; Hong, Y.; Liu, X.; Dong, N.; Ma, P.; Bi, J.; Wang, D.; Xiao, S. Discovery of a novel accessory protein NS7a encoded by porcine deltacoronavirus. J. Gen. Virol. 2017, 98, 173–178. [Google Scholar] [CrossRef]
- Wang, L.; Byrum, B.; Zhang, Y. Detection and genetic characterization of deltacoronavirus in pigs, Ohio, USA, 2014. Emerg. Infect. Dis. 2014, 20, 1227–1230. [Google Scholar] [CrossRef] [PubMed]
- Li, G.; Chen, Q.; Harmon, K.M.; Yoon, K.J.; Schwartz, K.J.; Hoogland, M.J.; Gauger, P.C.; Main, R.G.; Zhang, J. Full-Length Genome Sequence of Porcine Deltacoronavirus Strain USA/IA/2014/8734. Genome Announc. 2014, 2. [Google Scholar] [CrossRef] [Green Version]
- Wang, L.; Byrum, B.; Zhang, Y. Porcine coronavirus HKU15 detected in 9 US states, 2014. Emerg. Infect. Dis. 2014, 20, 1594–1595. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.; Lee, C. Complete Genome Characterization of Korean Porcine Deltacoronavirus Strain KOR/KNU14-04/2014. Genome Announc. 2014, 2. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jang, G.; Lee, K.K.; Kim, S.H.; Lee, C. Prevalence, complete genome sequencing and phylogenetic analysis of porcine deltacoronavirus in South Korea, 2014–2016. Transbound. Emerg. Dis. 2017, 64, 1364–1370. [Google Scholar] [CrossRef] [PubMed]
- Dong, N.; Fang, L.; Zeng, S.; Sun, Q.; Chen, H.; Xiao, S. Porcine Deltacoronavirus in Mainland China. Emerg. Infect. Dis. 2015, 21, 2254–2255. [Google Scholar] [CrossRef]
- Xu, Z.; Zhong, H.; Zhou, Q.; Du, Y.; Chen, L.; Zhang, Y.; Xue, C.; Cao, Y. A Highly Pathogenic Strain of Porcine Deltacoronavirus Caused Watery Diarrhea in Newborn Piglets. Virol. Sin. 2018, 33, 131–141. [Google Scholar] [CrossRef] [Green Version]
- Mai, K.; Feng, J.; Chen, G.; Li, D.; Zhou, L.; Bai, Y.; Wu, Q.; Ma, J. The detection and phylogenetic analysis of porcine deltacoronavirus from Guangdong Province in Southern China. Transbound. Emerg. Dis. 2018, 65, 166–173. [Google Scholar] [CrossRef] [PubMed]
- Saeng-Chuto, K.; Lorsirigool, A.; Temeeyasen, G.; Vui, D.T.; Stott, C.J.; Madapong, A.; Tripipat, T.; Wegner, M.; Intrakamhaeng, M.; Chongcharoen, W.; et al. Different Lineage of Porcine Deltacoronavirus in Thailand, Vietnam and Lao PDR in 2015. Transbound. Emerg. Dis. 2017, 64, 3–10. [Google Scholar] [CrossRef]
- Lorsirigool, A.; Saeng-Chuto, K.; Madapong, A.; Temeeyasen, G.; Tripipat, T.; Kaewprommal, P.; Tantituvanont, A.; Piriyapongsa, J.; Nilubol, D. The genetic diversity and complete genome analysis of two novel porcine deltacoronavirus isolates in Thailand in 2015. Virus Genes 2017, 53, 240–248. [Google Scholar] [CrossRef]
- Le, V.P.; Song, S.; An, B.H.; Park, G.N.; Pham, N.T.; Le, D.Q.; Nguyen, V.T.; Vu, T.T.H.; Kim, K.S.; Choe, S.; et al. A novel strain of porcine deltacoronavirus in Vietnam. Arch. Virol. 2018, 163, 203–207. [Google Scholar] [CrossRef] [Green Version]
- Suzuki, T.; Shibahara, T.; Imai, N.; Yamamoto, T.; Ohashi, S. Genetic characterization and pathogenicity of Japanese porcine deltacoronavirus. Infect. Genet. Evol. 2018, 61, 176–182. [Google Scholar] [CrossRef]
- Liang, Q.; Zhang, H.; Li, B.; Ding, Q.; Wang, Y.; Gao, W.; Guo, D.; Wei, Z.; Hu, H. Susceptibility of Chickens to Porcine Deltacoronavirus Infection. Viruses 2019, 11, 573. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Boley, P.A.; Alhamo, M.A.; Lossie, G.; Yadav, K.K.; Vasquez-Lee, M.; Saif, L.J.; Kenney, S.P. Porcine Deltacoronavirus Infection and Transmission in Poultry, United States(1). Emerg. Infect. Dis. 2020, 26, 255–265. [Google Scholar] [CrossRef] [Green Version]
- Jung, K.; Hu, H.; Saif, L.J. Calves are susceptible to infection with the newly emerged porcine deltacoronavirus, but not with the swine enteric alphacoronavirus, porcine epidemic diarrhea virus. Arch. Virol. 2017, 162, 2357–2362. [Google Scholar] [CrossRef]
- Liu, Y.; Wang, B.; Liang, Q.Z.; Shi, F.S.; Ji, C.M.; Yang, X.L.; Yang, Y.L.; Qin, P.; Chen, R.; Huang, Y.W. The roles of two major domains of the porcine deltacoronavirus spike subunit 1 in receptor binding and neutralization. J. Virol. 2021. [Google Scholar] [CrossRef]
- Iseki, H.; Watanabe, S.; Mase, M. A potential system for the isolation and propagation of porcine deltacoronavirus using embryonated chicken eggs. J. Virol. Methods 2021, 290, 114068. [Google Scholar] [CrossRef]
- Lednicky, J.A.; Tagliamonte, M.S.; White, S.K.; Elbadry, M.A.; Alam, M.M.; Stephenson, C.J.; Bonny, T.S.; Loeb, J.C.; Telisma, T.; Chavannes, S.; et al. Emergence of porcine delta-coronavirus pathogenic infections among children in Haiti through independent zoonoses and convergent evolution. medRxiv 2021. [Google Scholar] [CrossRef]
- Wang, B.; Liu, Y.; Ji, C.M.; Yang, Y.L.; Liang, Q.Z.; Zhao, P.; Xu, L.D.; Lei, X.M.; Luo, W.T.; Qin, P.; et al. Porcine Deltacoronavirus Engages the Transmissible Gastroenteritis Virus Functional Receptor Porcine Aminopeptidase N for Infectious Cellular Entry. J. Virol. 2018, 92, e00318-18. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhu, X.; Liu, S.; Wang, X.; Luo, Z.; Shi, Y.; Wang, D.; Peng, G.; Chen, H.; Fang, L.; Xiao, S. Contribution of porcine aminopeptidase N to porcine deltacoronavirus infection. Emerg. Microbes Infect. 2018, 7, 65. [Google Scholar] [CrossRef]
- Stoian, A.; Rowland, R.R.R.; Petrovan, V.; Sheahan, M.; Samuel, M.S.; Whitworth, K.M.; Wells, K.D.; Zhang, J.; Beaton, B.; Cigan, M.; et al. The use of cells from ANPEP knockout pigs to evaluate the role of aminopeptidase N (APN) as a receptor for porcine deltacoronavirus (PDCoV). Virology 2020, 541, 136–140. [Google Scholar] [CrossRef]
- Xu, K.; Zhou, Y.; Mu, Y.; Liu, Z.; Hou, S.; Xiong, Y.; Fang, L.; Ge, C.; Wei, Y.; Zhang, X.; et al. CD163 and pAPN double-knockout pigs are resistant to PRRSV and TGEV and exhibit decreased susceptibility to PDCoV while maintaining normal production performance. Elife 2020, 9, e57132. [Google Scholar] [CrossRef] [PubMed]
- Almazan, F.; Sola, I.; Zuniga, S.; Marquez-Jurado, S.; Morales, L.; Becares, M.; Enjuanes, L. Coronavirus reverse genetic systems: Infectious clones and replicons. Virus Res. 2014, 189, 262–270. [Google Scholar] [CrossRef] [PubMed]
- Xie, X.; Muruato, A.E.; Zhang, X.; Lokugamage, K.G.; Fontes-Garfias, C.R.; Zou, J.; Liu, J.; Ren, P.; Balakrishnan, M.; Cihlar, T.; et al. A nanoluciferase SARS-CoV-2 for rapid neutralization testing and screening of anti-infective drugs for COVID-19. Nat. Commun. 2020, 11, 5214. [Google Scholar] [CrossRef]
- Liu, F.; Wang, Q.; Huang, Y.; Wang, N.; Shan, H. Rescue of NanoLuc luciferase-expressing Senecavirus A with oncolytic activity. Virus Res. 2021, 292, 198232. [Google Scholar] [CrossRef]
- Chiem, K.; Morales Vasquez, D.; Park, J.G.; Platt, R.N.; Anderson, T.; Walter, M.R.; Kobie, J.J.; Ye, C.; Martinez-Sobrido, L. Generation and Characterization of recombinant SARS-CoV-2 expressing reporter genes. J. Virol. 2021, 95, e02209-20. [Google Scholar] [CrossRef]
- Terada, Y.; Kuroda, Y.; Morikawa, S.; Matsuura, Y.; Maeda, K.; Kamitani, W. Establishment of a Virulent Full-Length cDNA Clone for Type I Feline Coronavirus Strain C3663. J. Virol. 2019, 93, e01208-19. [Google Scholar] [CrossRef] [Green Version]
- Deng, X.; Buckley, A.C.; Pillatzki, A.; Lager, K.M.; Baker, S.C.; Faaberg, K.S. Development and utilization of an infectious clone for porcine deltacoronavirus strain USA/IL/2014/026. Virology 2021, 553, 35–45. [Google Scholar] [CrossRef] [PubMed]
- Zhou, X.; Zhou, L.; Zhang, P.; Ge, X.; Guo, X.; Han, J.; Zhang, Y.; Yang, H. A strain of porcine deltacoronavirus: Genomic characterization, pathogenicity and its full-length cDNA infectious clone. Transbound. Emerg. Dis. 2020, 68, 2130–2146. [Google Scholar] [CrossRef]
- Luo, J.; Fang, L.; Dong, N.; Fang, P.; Ding, Z.; Wang, D.; Chen, H.; Xiao, S. Porcine deltacoronavirus (PDCoV) infection suppresses RIG-I-mediated interferon-beta production. Virology 2016, 495, 10–17. [Google Scholar] [CrossRef] [PubMed]
- Peng, Q.; Fang, L.; Ding, Z.; Wang, D.; Peng, G.; Xiao, S. Rapid manipulation of the porcine epidemic diarrhea virus genome by CRISPR/Cas9 technology. J. Virol. Methods 2020, 276, 113772. [Google Scholar] [CrossRef] [PubMed]
- Reed, L.J.; Muench, H. A simple method of estimating fifty percent endpoints. Am. J. Hyg. 1938, 27, 493–497. [Google Scholar]
- Jin, Y.H.; Min, J.S.; Jeon, S.; Lee, J.; Kim, S.; Park, T.; Park, D.; Jang, M.S.; Park, C.M.; Song, J.H.; et al. Lycorine, a non-nucleoside RNA dependent RNA polymerase inhibitor, as potential treatment for emerging coronavirus infections. Phytomedicine 2020, 86, 153440. [Google Scholar] [CrossRef]
- Ter Ellen, B.M.; Dinesh Kumar, N.; Bouma, E.M.; Troost, B.; van de Pol, D.P.I.; van der Ende-Metselaar, H.H.; Apperloo, L.; van Gosliga, D.; van den Berge, M.; Nawijn, M.C.; et al. Resveratrol and Pterostilbene Inhibit SARS-CoV-2 Replication in Air-Liquid Interface Cultured Human Primary Bronchial Epithelial Cells. Viruses 2021, 13, 1335. [Google Scholar] [CrossRef]
- Luker, K.E.; Luker, G.D. Applications of bioluminescence imaging to antiviral research and therapy: Multiple luciferase enzymes and quantitation. Antiviral Res. 2008, 78, 179–187. [Google Scholar] [CrossRef] [Green Version]
- Stacer, A.C.; Nyati, S.; Moudgil, P.; Iyengar, R.; Luker, K.E.; Rehemtulla, A.; Luker, G.D. NanoLuc reporter for dual luciferase imaging in living animals. Mol. Imaging 2013, 12, 1–13. [Google Scholar] [CrossRef]
- Czako, R.; Vogel, L.; Lamirande, E.W.; Bock, K.W.; Moore, I.N.; Ellebedy, A.H.; Ahmed, R.; Mehle, A.; Subbarao, K. In Vivo Imaging of Influenza Virus Infection in Immunized Mice. mBio 2017, 8, e00714-17. [Google Scholar] [CrossRef] [Green Version]
- Hall, M.P.; Unch, J.; Binkowski, B.F.; Valley, M.P.; Butler, B.L.; Wood, M.G.; Otto, P.; Zimmerman, K.; Vidugiris, G.; Machleidt, T.; et al. Engineered luciferase reporter from a deep sea shrimp utilizing a novel imidazopyrazinone substrate. ACS Chem. Biol. 2012, 7, 1848–1857. [Google Scholar] [CrossRef] [PubMed]
- Nogales, A.; Avila-Perez, G.; Rangel-Moreno, J.; Chiem, K.; DeDiego, M.L.; Martinez-Sobrido, L. A Novel Fluorescent and Bioluminescent Bireporter Influenza A Virus To Evaluate Viral Infections. J. Virol. 2019, 93, e00032-19. [Google Scholar] [CrossRef] [Green Version]
- Saade, G.; Menard, D.; Hervet, C.; Renson, P.; Hue, E.; Zhu, J.; Dubreil, L.; Paillot, R.; Pronost, S.; Bourry, O.; et al. Porcine Reproductive and Respiratory Syndrome Virus Interferes with Swine Influenza A Virus Infection of Epithelial Cells. Vaccines 2020, 8, 508. [Google Scholar] [CrossRef] [PubMed]
- Jung, K.; Miyazaki, A.; Hu, H.; Saif, L.J. Susceptibility of porcine IPEC-J2 intestinal epithelial cells to infection with porcine deltacoronavirus (PDCoV) and serum cytokine responses of gnotobiotic pigs to acute infection with IPEC-J2 cell culture-passaged PDCoV. Vet. Microbiol. 2018, 221, 49–58. [Google Scholar] [CrossRef]
- Wang, X.; Fang, L.; Liu, S.; Ke, W.; Wang, D.; Peng, G.; Xiao, S. Susceptibility of porcine IPI-2I intestinal epithelial cells to infection with swine enteric coronaviruses. Vet. Microbiol. 2019, 233, 21–27. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.L.; Mai, K.J.; Li, D.; Wu, R.T.; Wu, Z.X.; Tang, X.Y.; Li, Q.N.; Sun, Y.; Lan, T.; Zhang, X.B.; et al. Expression profile analysis of 5-day-old neonatal piglets infected with porcine Deltacoronavirus. BMC Vet. Res. 2019, 15, 117. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, W.; Hulswit, R.J.G.; Kenney, S.P.; Widjaja, I.; Jung, K.; Alhamo, M.A.; van Dieren, B.; van Kuppeveld, F.J.M.; Saif, L.J.; Bosch, B.J. Broad receptor engagement of an emerging global coronavirus may potentiate its diverse cross-species transmissibility. Proc. Natl. Acad. Sci. USA 2018, 115, E5135–E5143. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Primer | Nucleotide Sequence (5′-3′) |
---|---|
CMV-F: | GGCGTGCACTTGACATTGATTATTGACTAGTTAT |
CMV-R | TAATTTTTATCTTTAGTCCCCATGTACGGTTCACTAAACGAGCTCTGCTTATATAGACC |
PDCoV-5′-F | ACATGGGGACTAAAGATAAAAATTATAGCATTAGTCT |
PDCoV-5′-R | CTACCTAGGCTCGGTGCAAGG |
PDCoV-3′-F | CTTGCACCGAGCCTAGGTAGCTTGCAGGGATTATGGATCCAATGGGTACATG |
PDCoV-3′-R | TTGCTCCATCCCCCCTATAAGCCAATTTAATTTCCCC |
HDV-F | ATAGGGGGGATGGAGCAAAAAAAAAAAAAAAAAAAAAAAAAAAGGGTCGGCATGGCATC |
BGH-R | GAGAAGCTTCCATAGAGCCCACCGCATCCCCAGC |
A-F | TAGCACTCCTTGCACCGAGCCTAGGTAGGATAAAACCCCCTAC |
A-R | GGCAAATTTAATGGCAGGAC |
B-F | GTCCTGCCATTAAATTTGCC |
B-R | GTTGTGAATCGATTTGCAAG |
C-F | CTTGCAAATCGATTCACAAC |
C-R | CAGAGTGCATCTATTGCTGC |
D-F | GCAGCAATAGATGCACTCTG |
D-R | ACTGCTGGAATTCCTCGTGG |
E-F | CCACGAGGAATTCCAGCAGT |
E-R | GCACCTCCATGTACCCATTGGATCCATAATCCCTGCAAGGAG |
Clone-F | CCAAGTTGGTGATTACATTC |
Clone-R | GCTGAGTCAGTGGTCACGCA |
qPDCoV-nsp16-F | GCCCTCGGTGGTTCTATCTT |
qPDCoV-nsp16-R | TCCTTAGCTTGCCCCAAATA |
qGAPDH-F | ACATGGCCTCCAAGGAGTAAGA |
qGAPDH-R | GATCGAGTTGGGGCTGTGACT |
Primer | Nucleotide Sequence (5′-3′) |
---|---|
sgPDCoV-△NS6a | TTCTAATACGACTCACTATAGGTCCAAATGGTCACCACTAGTTTTAGAGCTAGA |
sgPDCoV-△NS6b | TTCTAATACGACTCACTATAGGTCTTACGACGTACCGCAG GTTTTAGAGCTAGA |
scaffold oligo | AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC |
PDCoV-NS6-upF | GCTCCAACCCTTCACCCTAG |
PDCoV-NS6-upR | ATCTTCGAGTGTGAAGACCATTACATATACTTATACAGGCG |
Nluc-F | CGCCTGTATAAGTATATGTAATGGTCTTCACACTCGAAGAT |
Nluc-R | GATAGATTGGTGTCAAAACTTTACGCCAGAATGCGTTC |
PDCoV-NS6-downF | GAACGCATTCTGGCGTAAAGTTTTGACACCAATCTATC |
PDCoV-NS6-downR | TTGGGTCTTACGACGTACCG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fang, P.; Zhang, H.; Sun, H.; Wang, G.; Xia, S.; Ren, J.; Zhang, J.; Tian, L.; Fang, L.; Xiao, S. Construction, Characterization and Application of Recombinant Porcine Deltacoronavirus Expressing Nanoluciferase. Viruses 2021, 13, 1991. https://doi.org/10.3390/v13101991
Fang P, Zhang H, Sun H, Wang G, Xia S, Ren J, Zhang J, Tian L, Fang L, Xiao S. Construction, Characterization and Application of Recombinant Porcine Deltacoronavirus Expressing Nanoluciferase. Viruses. 2021; 13(10):1991. https://doi.org/10.3390/v13101991
Chicago/Turabian StyleFang, Puxian, Huichang Zhang, He Sun, Gang Wang, Sijin Xia, Jie Ren, Jiansong Zhang, Liyuan Tian, Liurong Fang, and Shaobo Xiao. 2021. "Construction, Characterization and Application of Recombinant Porcine Deltacoronavirus Expressing Nanoluciferase" Viruses 13, no. 10: 1991. https://doi.org/10.3390/v13101991
APA StyleFang, P., Zhang, H., Sun, H., Wang, G., Xia, S., Ren, J., Zhang, J., Tian, L., Fang, L., & Xiao, S. (2021). Construction, Characterization and Application of Recombinant Porcine Deltacoronavirus Expressing Nanoluciferase. Viruses, 13(10), 1991. https://doi.org/10.3390/v13101991