1. Introduction
HF2 is a myovirus belonging to the species
Haloferacalesvirus HF1, within the genus
Haloferacalesvirus (family:
Hafunaviridae, previously
Myoviridae) [
1]. It is lytic and can infect two species of extremely halophilic archaea,
Halorubrum saccharovorum and
Halorubrum coriense [
2]. The viral genome is linear dsDNA, 77,672 bp in length and has a GC content of 56%, significantly lower than that of its host species (67%). It was the first halovirus genome to be fully sequenced [
3] revealing a gene organization typical of myoviruses, but with many of its 127 annotated genes coding for proteins of unknown function. It also carries four tRNA genes. The genomic termini consist of 306 bp direct repeats, and replication proceeds by concatemer formation, followed by precise cutting at a specific target sequence [
4]. The presence of direct terminal repeats (DTR) is reminiscent of the genome structure of coliphage T7 and related viruses [
5].
The modular gene organization in haloferacalesviruses is well conserved [
1,
6]. Genes are organized as modular units in two genomic arms so that most genes are directed towards the centre. Many of the genes of the left arm have unknown function but some are involved in replication, DNA modification and accessory biological activities, while the right arm carries genes for virus morphogenesis and DNA packaging. Recombination events can replace large parts of the genome, as was revealed from a comparison of HF2 and the related virus, HF1 [
7]. The two viruses differ in genes coding for proteins of virion morphogenesis, and the divergent tail genes are consistent with their differing host ranges: HF1 has a broad host range, being able to infect haloarchaea of at least three genera (
Haloferax,
Halobacterium and
Halorubrum), while HF2 has a much narrower host range, and infects two species of
Halorubrum [
2,
7].
The HF2 transcriptome was first studied by Tang et al. [
3], who used Northern blot hybridisation to identify and map transcripts at various times post-infection (p.i.). Consistent with the orientation of gene modules, the majority of the HF2 genome is transcribed inwards from the termini, with transcript lengths ranging from 0.5 to 9 kb, and often overlapping. The replication cycle of HF2 in
Hrr. coriense is approximately 5 h, with groups of transcripts being synthesised from particular regions of the genome in a temporal pattern of early (0–1 h p.i.), middle (1–3 h p.i.) and late (3–5 h p.i.). Early and middle transcripts were produced from the left arm of the genome, while late transcripts were produced from genes of the virus morphogenesis module found at the right arm of the genome. This pattern of gene expression is similar to that found in many well studied bacterial caudoviruses, such as T7 [
5].
Intriguingly, the 5′ ends of several transcripts occurred at the approximate location of intergenic repeat sequences (IRs) [
3,
6]. IRs fall into two distinct sequence groups (class I and II), and the members of each class are found in different regions of the genome. Class I IRs are 56–58 bp long and occur in the first 49 kb of the genome among genes that are transcribed from the early to middle stages of virus infection. While most of the genes in this region cannot be assigned a function, it includes genes involved in DNA synthesis and replication (e.g., helicase, DNA polymerase, ribonucleotide reductase), tRNA repair and DNA methylation. Class II repeats are 29 bp long and restricted to the right arm of the genome (54–77 kb), within the virus morphogenesis module that is transcribed late in infection.
Although many new isolates and genome sequences of haloviruses have recently become available [
1], little is known regarding the regulation of gene expression during lytic infection or in the provirus state. Within both classes of IRs are AT-rich sequences that could represent promoter motifs, but experimental evidence supporting this hypothesis has so far been lacking. The aims of this study were to test whether the IRs of HF2 contain functional promoters; to map the 5′ ends of IR-directed transcripts; and to search for long transcripts that would have escaped detection by the previous method of Northern blot analysis.
2. Materials and Methods
2.1. Strains and Cultivation
Conditions for growth of the Δ
radA strain of
Hfx.
volcanii, DS52, were reported previously [
8].
Escherichia coli strain DH5α (
recA1,
endA1,
mcrA+,
mcrB+,
gyrA96) from Stratagene (La Jolla, CA, USA), was used for plasmid propagation and transformation, and was cultured in Luria-Bertani medium supplemented with ampicillin (100 μg/mL) where necessary. Transformation of
E.
coli was by the TSS method [
9]. while
Hfx.
volcanii was transformed as previously described [
10]. Cultures of
Hrr. coriense were maintained in 18% Modified Growth Medium (MGM; 2.47 M NaCl, 90 mM MgCl
2, 90 mM MgSO
4, 60 mM KCl, 3 mM CaCl
2, 10 mM Tris-HCl pH 7.5, 5 g/L bacteriological peptone, 1 g/L yeast extract. The pH was adjusted to 7.5 with Tris base). Cultures were incubated at 37 °C, with orbital shaking (180 rpm), and supplemented with novobiocin (0.3 μg/mL), when required to maintain plasmids.
2.2. Reporter Plasmids pRV1 and pRV2
The reporter plasmid pRV1 was used in the study by Large et al. [
11] to measure promoter strength in
Hfx. volcanii, but its construction has not been previously described. It was developed from the 13.3 kb plasmid pMLH32 [
12] which carries
E.coli genes for replication and ampicillin resistance (
bla) from plasmid pBS(+); the replication region of haloarchaeal plasmid pHK2 from
Hfx. lucentense; the novobiocin resistance gene
gyrB (
Hfx. lucentense); and the gene for β-galactosidase BgaH (
bgaH;
Hfx. lucentense). The existing
NdeI site and one
EcoRI site of pMLH32 were removed by partially cutting with
KpnI (there are two sites) followed by complete digestion with
NdeI. The exposed termini were blunted with T4 DNA polymerase, the ends joined by ligation, the products transformed into
E.coli and transformants grown under ampicillin selection. From these, a colony carrying the desired plasmid was selected, in which the
KpnI and
NdeI sites at nt 1 and 712 were destroyed and the intervening fragment removed, which contained an
EcoRI site (adjacent to the
KpnI site) as well as the f1
ori and
lacZα genes from the
E.coli plasmid pBS+.
A second
EcoRI site, within the
gyrB gene, was removed by site-directed mutagenesis, to alter GAATTC (nt 7823–7828) to GAATT
G, producing a silent change (GGG Gly to GGC Gly) within the
gyrB ORF. Next, the
HindIII-
EcoRI fragment containing the 5′ end of
bgaH was replaced with a PCR modified version of the same sequence that contained an
NdeI site positioned at the start codon of the
bgaH ORF (i.e., nt 2614–2629: TTGTGT
ATG ACA GTT changed to TTG
CAT
ATG ACA GTT). Then, a 97 nt sequence (nt 971–1067 of accession X58924) containing the transcriptional terminator of the gene encoding ribosomal protein L11e of
Haloferax volcanii [
13] was PCR amplified with primers that included a 5′
HindIII site and a 3′
BglII site. The primers used were BR1 (5′-TACTCG
AAGCTTCTGACGTCTCGGAACCGTCTC-3′) and BR2 (5′-GTG
AGATCTTCCGGGTCGAATCGGG-3′) that contain 5′
HindIII and
BglII sites, respectively (underlined). The amplified product was digested with
HindIII and
BglII, ligated to
HindIII +
BglII-digested plasmid, and introduced into
E. coli cells. A plasmid isolated from ampicillin-resistant transformants was sequenced across the cloning region to confirm the presence, orientation and correct sequence of the terminator. In this way, the L11e terminator was positioned just upstream of the
NdeI promoter cloning site (the start codon of the
bgaH ORF), while retaining the
HindIII site and
BglII sites, and deleting the natural promoter of
bgaH. The resulting plasmid was designated pRV1.
The NdeI site of pRV1, which overlaps the reporter gene initiation codon (catATG) was replaced by a ClaI site (atcgATG; the ClaI site is underlined) by insertion of a synthetic linker that replaced the sequence between the NdeI and AfeI restriction sites of pRV1. The two strands of the linker had the following sequences:
pRV1 top strand linker:
5′-GATCTCCACGTTGATCATTGATCGATGACAGTT GGTGTCTGCTATTTCCCGAGCACTGGTCGCGAGAGC-3′;
pRV1 bottom strand linker:
5′-GCTCTCGCGACCAGTGCTCCGGGAAATAGCAGACACCAACTGTCATCGATC AATGATCAACGTGGA-3′.
The
ClaI site is underlined in both sequences. The complementary oligonucleotides were annealed, ligated to
NdeI +
AfeI digested pRV1, and the products introduced into
E.coli and transformants grown under ampicillin selection. A colony was selected that contained a plasmid with the expected linker addition, and the resulting 12,135 bp construct was designated as pRV2. A plasmid map is given in
Figure S1, and the sequence of pRV2 was deposited under GenBank accession MZ936313.
Primers used to amplify the IRs from halovirus HF2 for ligation into pRV2 are shown in
Table S1. These and other promoter amplicons were generated with primers carrying
BstB1 (TT′CGAA) tags, which allowed selection against self-ligated plasmids by digestion of ligation mixtures with
BstB1. This is because
BstB1 and
ClaI generate complementary overhangs, but ligation of
BstB1 and
Cla1 overhangs destroys both sites. Reporter gene fusions were constructed as follows: pRV2 was digested with
ClaI and purified (MoBio DNA purification kit; Carlsbad, CA, USA). PCR amplicons were purified, as above, restricted with
BstB1, purified again, and then ligated to the vector, as above; 50 ng vector was ligated per reaction. Ligations were performed in a 5 µL total volume, which was diluted to 50 µL for digestion with
BstB1 in order to linearize any self-ligated vector, which greatly reduces its ability to transform host cells.
2.3. Site-Directed Mutagenesis of Intergenic Repeat IR4
Site-directed mutations were generated using the Invitrogen GeneTailor kit (Invitrogen; Carlsbad, CA, USA), which allows the use of a mutagenic oligonucleotide primer to produce the desired mutation from cloned DNA that has been previously methylated. The procedure also incorporated PCR amplification, and after the introduction of the reaction products into E. coli DH5α, unmutated template plasmid was degraded by the McrBC endonuclease that digested methylated DNA, allowing the efficient recovery of the amplified (mutated) plasmid. IR4 was cloned between the HindIII-EcoRI sites of pBlueScript SK II+ and used for mutagenesis, after which the mutations were confirmed by sequencing. IR4 variants were then amplified using forward and reverse primers with engineered ClaI tags, digested with ClaI and ligated to the BgaH reporter plasmid pRV2 (see above).
2.4. β-Galactosidase Assay
β-galactosidase assays were performed using a protocol modified from that described in the HaloHandbook [
10]. Briefly, cultures of
Hfx.
volcanii DS52 strains carrying promoter–reporter plasmids were cultivated in MGM to OD
600 0.4–0.7. As a negative control,
Hfx.
volcanii DS52 carrying the reporter plasmid without any insert was used. To measure BgaH activity, 50 μL of culture was added to 350 μL BgaH buffer (2.5 M NaCl, 50 mM Tris-HCl pH 7.2, 10 μM MnCl
2, 0.1%
v/v 2-mercaptoethanol) and 50 μL 1%
v/v Triton X-100, 20%
v/v Tween 20 in a 1.5 mL plastic microcuvette tube. Samples were vortexed briefly prior to the addition of 50 μL ONPG (8 mg/mL in BgaH buffer). Reactions were incubated at 32 °C and the OD
405 measured at regular intervals until it had reached 0.7–1.0, after which the entire reaction volume was quickly transferred to a plastic tube containing 700 μL of 1 M Na
2CO
3 (to stop the reaction), and vortexed briefly.
For each assay, at least four time points were used to generate a curve for each construct, and β-galactosidase specific activities (SA) were calculated according to the equation [ΔOD405 ÷ ΔT] × [1000 ÷ (culture volume × OD600)], where ΔOD405 measures the change in OD405 over a time period (ΔT) measured in minutes. ΔOD405 was taken from the linear region of the resulting curve. OD600 refers to the optical density of the culture at the time of the assay. Assays were completed in duplicate, and 3 biological replicates were used for each plasmid construct.
2.5. RT-PCR
Cultures were grown to OD
600 ~ 0.4 before isolation of total RNA using Trizol (Invitrogen; Carlsbad, CA, USA), as described in
Section 2.7. The quality of preparations was determined by electrophoresis on 2% Tris-acetate-EDTA (TAE) gels containing 20 mM (final concentration) guanidine thiocyanate.
Reverse transcription was at 50 °C for 1 h, using 1 μg of RNA as template with 1 μg specific primer. AMV reverse transcriptase (Promega; Madison, WI, USA) was used according to the manufacturer′s instructions. Following cDNA synthesis, cDNA templates were purified using the Qiaquick PCR clean-up kit (Qiagen; Germantown, MD, USA), with elution in 50 μL pure water. PCR reactions were performed with 25 μL GoTaq mastermix (Promega; Madison, WI, USA) and 5 μL cDNA template according to the manufacturer′s instructions. PCR reactions were run for 35 cycles, with the annealing temperature being equivalent to the lower Tm of the primers for the first 5 cycles. Thereafter, the annealing temperature was 5 °C lower. Primers are listed in
Table S2.
All RT-PCR experiments included a number of controls to exclude false-positive or false-negative results. The following controls were performed alongside test reactions: (1) a positive control consisting of HF2 genomic DNA; (2) a negative control consisting of RNA extracted from uninfected cells, which was mock reverse-transcribed to confirm that cDNAs and PCR products were virus-specific, and not the result of mis-priming on the host transcriptome; (3) a negative control consisting of RNA (harvested from infected cells) that was not reverse-transcribed, in order to show that positive signals were not due to amplification of incompletely digested viral DNA.
2.6. Infection of Hrr. coriense with HF2
For infection with virus, cultures of Hrr. coriense were grown to OD600 ~0.3–0.4 at 37 °C, with orbital shaking (180 rpm). HF2 virus was added (MOI ~ 50) and the cells were incubated without shaking for 30 min (RT) to allow virus absorption, after which the culture was shaken at 110 rpm for 5 h until harvesting for RNA.
2.7. RNA Extraction
RNA was extracted from Hrr. coriense cultures 5 h p.i. using Trizol (Invitrogen; Carlsbad, CA, USA). Cells from 5 mL cultures were pelleted (bench top centrifuge, 14,000 rpm) and resuspended in 1 mL Trizol. After incubation (RT, 5 min), 200 μL chloroform was added, the mixture shaken vigorously, and incubation continued (5 min). Mixtures were centrifuged (14,000 rpm, 15 min) to separate aqueous and phenol-chloroform phases. The aqueous phase was removed to a fresh tube, and RNA was precipitated by the addition of 0.5 mL isopropanol. Following incubation (15 min, RT), and pelleting (14,000 rpm, 15 min), the RNA was washed twice with 75% v/v ethanol, and the pellet was then air-dried.
Before use in RT-PCR assays, pellets were resuspended in 50 μL RNase free water. DNA was hydrolysed by the addition of 20 U RNase-free DNase I (New England Biolabs; Ipswich, MA, USA) and incubation at 37 °C for 1 h, after which the enzyme was inactivated by heat treatment (75 °C for 10 min). The concentration of RNA was determined spectrophotometrically, and the quality was assessed by denaturing agarose gel electrophoresis.
2.8. Primer Extension Assays
Primers are listed in
Tables S2 and S3, and were designed with a 5′ terminal guanosine residue to maximise labelling efficiency [
14]. Primers were radiolabelled with
32P-ATP using polynucleotide kinase (New England Biolabs, Ipswich, MA, USA), after which the labelled primer was recovered by ethanol precipitation. Extension reactions used 10 µg RNA as a template, labelled primer and Promega AMV Reverse transcriptase, and followed the manufacturer′s instructions. The resulting cDNA was purified (QIAquick PCR purification kit, Qiagen) and resolved by electrophoresis on a 6% acrylamide urea sequencing gel alongside a sequencing ladder. DNA sequencing ladders were prepared using labelled primer on either HF2 DNA or reporter plasmid pRV2 DNA. In the latter case, the primer Bgal pEXT (5′ GCCATCTGACTGATATCGGTCTCC 3′) was used in PCR with a forward (unlabelled) primer BR1 (5′ TACTCGAAGCTTCTGACGTCTCGGAACCGTCTC 3′), and 1 ng of unlabelled pRV2 plasmid as template. Following PCR, the amplicon was column purified, and the equivalent of 800 counts/s added to 4 µg salmon sperm DNA in a total volume of 14 µL. To produce a purine ladder, 3 µL of 8.8%
v/v formic acid was added, and the mixture incubated (7 min, 37 °C). Reactions were immediately placed on ice (5 min) prior to the addition of 150 µL 0.1 M piperidine and incubation (at 85 °C, 30 min). Reactions were then precipitated twice (with ethanol), before the pellet was resuspended in 10 µL H
2O.
Primer extension assays either used RNA templates extracted from HF2-infected Hrr. coriense cultures, or RNA extracted from Hfx. volcanii carrying pRV2, into which putative HF2 promoters were ligated. Putative promoters were fused at the translation initiation codon of the bgaH gene, and primer extension was performed using the primer Bgal pEXT which anneals seventy-three nucleotides downstream of the bgaH translation initiation codon.
2.9. Phylogenetic Reconstruction
Viral genome sequences were aligned within the Geneious Prime v2021.2.2 (Auckland, New Zealand) environment using the MAFFT aligner tool and trees inferred using the Geneious Tree Builder option with the genetic distance model of Tamura-Nei, the Neighbor-Joining algorithm and 100 bootstrap replications.
4. Discussion
The class I and class II intergenic repeats, which were previously identified in the genome sequence of HF2 and thought to contain promoter motifs [
3]
, were demonstrated to contain viral promoters. Class I IRs are found between position 16 kb to 49 kb of the HF2 genome and are involved in the transcription of early-middle genes; while class II IRs are found in the right arm between 49 kb and the right end and likely regulate the late gene transcription of virus morphogenesis genes. Both classes of IRs are well conserved in the genomes of related viruses, supporting their functional significance. The distinct difference in the consensus sequence of the two IR classes suggest a regulatory model, where sequence-specific, virus-encoded factors interact with IRs to control viral gene expression in a programmed and temporal manner. Since the promoters of individual IRs were found to be active in the cells of
Hfx. volcanii, where other HF2 genes were not present, virus-encoded factors were not required for their activity. The potential role of host cell factors in regulating the promoter activity of IRs needs to be determined. The transcription of genes located between the left end and 16 kb utilize promoters that do not show any extended sequence pattern and are probably unregulated. HF2 does not encode an RNA polymerase to drive virus-specific gene expression in the same way that bacterial viruses, such as T7, do [
5]; therefore, this is dependent on the host enzyme. This is similar to lactococcal
Siphoviridae, belonging to the 936 group [
21], which have linear dsDNA genomes with genes arranged in modules that face inwards, with one arm carrying early genes and the other arm carrying late-expressed genes involved in virus morphogenesis. The temporal regulation of HF2 middle and late gene transcription is likely governed by virus-encoded proteins that influence when and how the host RNA polymerase interacts with IRs and the promoters they contain. In the first 16 kb of the genome, which is transcribed first, there are no IRs but many candidate genes that could specify IR-regulatory proteins, such as those specifying proteins with CxxC motifs indicative of zinc-finger domains [
22], one of which (HrrHF2_165) also carries a predicted helix-turn-helix domain [
23].
Scanning mutagenesis of IR4 provided more detailed insight into the important promoter elements contained within a representative member of the class I intergenic repeats. Alterations to the TATA box and the sequence around the TSS greatly reduced the measured promoter activity, which was consistent with earlier studies that identified these conserved promoter elements in haloarchaea using bioinformatics [
15,
16,
24], and by in vivo studies [
25,
26]. It is likely that IRs contain binding sites for viral regulatory proteins, but to examine this in detail will require more advanced experimental systems.
Surprisingly, class II IRs display a high promoter activity in both directions when tested using the BgaH reporter plasmid in
Hfx. volcanii; their activities in the reverse direction being about half of those in the forward direction. In the case of IR12c, this is consistent with its location at a point where the coding strand changes, allowing it to drive the outward transcription of the CDSs found on either strand of the genome. Two of the class I IRs (IR1c and IR3) also show a promoter activity in the reverse direction in the same reporter system, although much weaker than in the forward direction. In the case of IR3, this initiates two outwardly directed and long transcripts (R52 and F52). How these dual promoters function within the confines of IRs without interfering with each other remains to be examined. Interference between closely spaced, outwardly facing promoters was previously reported in phiH1 [
27], a temperate myovirus infecting
Halobacterium salinarum [
27,
28,
29].
Long viral transcripts were detected by RT-PCR in HF2 infected cells. These encompassed well-defined gene modules where genes were closely spaced (or overlapping) and in the same orientation, such as the 35 kb transcript across the virus morphogenesis module. However, the previous Northern blot study of HF2 revealed transcripts that ranged in size from 0.5–9 kb, with most being between 1–2.5 kb [
3]. One explanation for these differing results is that long primary transcripts were processed into smaller species. Such processing was well described in phiH1 [
29,
30,
31] which synthesized long primary transcripts, one of which was at least 20 kb, that were subsequently processed to smaller RNAs. The synthesis of long viral transcripts is not limited to caudoviruses, as long sense and anti-sense transcripts were previously reported for SH1, an alphasphaerolipovirus, using the RT-PCR approach [
17,
32].
Long anti-sense counter transcripts were a significant observation in the present study, and they are likely to function in regulating viral gene expression. Anti-sense RNAs are well known in bacteria and their viruses, such as lambda [
33]. The first example in Archaea was found in halovirus phiH1 [
34], which synthesizes a counter transcript (T
ant) complementary to an early lytic transcript (T1). These bind to produce an RNA hybrid that becomes a substrate for an endogenous RNase, rendering the mRNA untranslatable. This processing was later shown to be catalyzed by a structure-specific RNase that attacks the ends of RNA duplexes [
35]. Recent RNA-seq studies [
16,
36] in
Hfx. volcanii also demonstrated that a high level of counter-transcription (‘cis-antisense′) occurs in haloarchaea, producing many transcripts complementary to mRNAs.
The potential temperate state of HF2 and other haloferacalesviruses, and the regulation of the lytic–lysogenic switch, remain unexplored. Once the genes involved in decision-making and lysogeny are identified their functions can be analysed in detail and compared to well-studied temperate bacteriophages such as lambda [
37]. Although HF2 carries an integrase gene nearby a putative
attP sequence, the host species used (
Hrr. coriense) does not possess a homologous tRNA for integration, explaining why infection is lytic. The three-gene module consisting of
attP, a small CxxC domain protein, and integrase (HrrHF2_450, 445 and 440) is situated between the middle- and late-expressed regions and found to be transcribed from a single promoter (T-40936) that is not part of an IR. An added level of complexity is that the TATA-box of this promoter also functions in the opposite direction (T-40979), across genes for a small hypothetical protein (HrrHF2_455) and N-6 DNA methylase (HrrHF2_460).
Hdep-prov1 provides a natural example of the integrated state of a haloferacalesvirus and is found in the genome of
Hrr. depositum Y78 integrated at a tRNA gene [
6]. Its recombination into the chromosome would have required the circularization of the viral genome prior to site-specific integration. Only one copy of the direct terminal repeat (DTR) is found in Hdep-prov1, suggesting that the termini were joined by homologous recombination. However, in the related halovirus HF1, the termini appear to be cohesive, presumably by single-stranded DNA overhangs [
7]. The presence of DTRs on the HF2 genome resembles coliphage T7-like viruses and, although T7 does not carry an integrase, there are T7-like cyanoviruses such as P-SSP7 that do, and are thought to be capable of integration [
38]. They may provide useful models for comparison.
Much remains to be discovered but a continuing obstacle is the lack of genetically tractable and robust host strains in which the genes of these viruses can be analysed in detail. However, in other halovirus groups, such as the recently described siphovirus HFTV1 (host Hfx. gibbonsii LR2-5) this aspect looks promising. Nonetheless, virus–host systems to study lysogeny in haloferacalesviruses may be best studied by engineering a model host strain, such as Hfx. volcanii, to carry the homologous tRNA gene and express the cognate cell surface receptor. The latter strategy would also enable the functions of all genes to be studied using the full range of genetic tools.