Identification and Characterization of Cell Lines HepG2, Hep3B217 and SNU387 as Models for Porcine Epidemic Diarrhea Coronavirus Infection
Abstract
:1. Introduction
2. Materials and Methods
2.1. CCLE RNA-Seq Dataset Analysis
2.2. Cells, Viruses, and Antibodies
2.3. TCID50 Assay
2.4. RNA Extraction and RT-qPCR Assay
2.5. Infection of Different Cell Lines with rPEDV-EGFP
2.6. Viral Growth Curve
2.7. Viral Plaque Assay
2.8. Indirect Immunofluorescence Assay
2.9. RNA-Seq and Analysis
2.10. Statistical Analysis
3. Results
3.1. Selection of Cell Lines for PEDV Infection
3.2. PEDV Can Infect HepG2, Hep3B217, and SNU387 Cells
3.3. Transcriptome Analysis of HepG2, Hep3B217, and SNU387 Infected with PEDV
3.4. PEDV Infection Induces Host Innate Immune Responses in HepG2, Hep3B217, and SNU387 Cells
4. Discussion
Supplementary Materials
Author Contributions
Funding
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wood, E.N. An apparently new syndrome of porcine epidemic diarrhoea. Vet. Rec. 1977, 100, 243–244. [Google Scholar] [CrossRef] [PubMed]
- Pensaert, M.B.; de Bouck, P. A new coronavirus-like particle associated with diarrhea in swine. Arch. Virol. 1978, 58, 243–247. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ducatelle, R.; Coussement, W.; Pensaert, M.B.; Debouck, P.; Hoorens, J. In vivo morphogenesis of a new porcine enteric coronavirus, CV 777. Arch. Virol. 1981, 68, 35–44. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, C. Porcine epidemic diarrhea virus: An emerging and re-emerging epizootic swine virus. Virol. J. 2015, 12, 193. [Google Scholar] [CrossRef] [Green Version]
- Desmyter, J.; Melnick, J.L.; Rawls, W.E. Defectiveness of interferon production and of rubella virus interference in a line of African green monkey kidney cells (Vero). J. Virol. 1968, 2, 955–961. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Osada, N.; Kohara, A.; Yamaji, T.; Hirayama, N.; Kasai, F.; Sekizuka, T.; Kuroda, M.; Hanada, K. The genome landscape of the african green monkey kidney-derived vero cell line. DNA Res. 2014, 21, 673–683. [Google Scholar] [CrossRef] [Green Version]
- Wang, X.; Fang, L.; Liu, S.; Ke, W.; Wang, D.; Peng, G.; Xiao, S. Susceptibility of porcine IPI-2I intestinal epithelial cells to infection with swine enteric coronaviruses. Vet. Microbiol. 2019, 233, 21–27. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.; Tang, J.; Ma, Y.; Liang, X.; Yang, Y.; Peng, G.; Qi, Q.; Jiang, S.; Li, J.; Du, L.; et al. Receptor usage and cell entry of porcine epidemic diarrhea coronavirus. J. Virol. 2015, 89, 6121–6125. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Q.; Shi, K.; Yoo, D. Suppression of type I interferon production by porcine epidemic diarrhea virus and degradation of CREB-binding protein by nsp1. Virology 2016, 489, 252–268. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Q.; Ma, J.; Yoo, D. Inhibition of NF-kappaB activity by the porcine epidemic diarrhea virus nonstructural protein 1 for innate immune evasion. Virology 2017, 510, 111–126. [Google Scholar] [CrossRef]
- Zhang, J.; Guo, L.; Xu, Y.; Yang, L.; Shi, H.; Feng, L.; Wang, Y. Characterization of porcine epidemic diarrhea virus infectivity in human embryonic kidney cells. Arch. Virol. 2017, 162, 2415–2419. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Cui, Y.; Wang, Z.; Liu, G. Identification and characterization of PEDV infection in rat crypt epithelial cells. Vet. Microbiol. 2020, 249, 108848. [Google Scholar] [CrossRef]
- Park, J.E.; Shin, H.J. Porcine epidemic diarrhea virus infects and replicates in porcine alveolar macrophages. Virus Res. 2014, 191, 143–152. [Google Scholar] [CrossRef] [PubMed]
- Khatri, M. Porcine epidemic diarrhea virus replication in duck intestinal cell line. Emerg. Infect. Dis. 2015, 21, 549–550. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, W.; Luo, R.; He, Q.; van Kuppeveld, F.J.M.; Rottier, P.J.M.; Bosch, B.J. Aminopeptidase N is not required for porcine epidemic diarrhea virus cell entry. Virus Res. 2017, 235, 6–13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhou, Y.; Li, C.; Ren, C.; Hu, J.; Song, C.; Wang, X.; Li, Y. One-Step Assembly of a Porcine Epidemic Diarrhea Virus Infectious cDNA Clone by Homologous Recombination in Yeast: Rapid Manipulation of Viral Genome With CRISPR/Cas9 Gene-Editing Technology. Front. Microbiol. 2022, 13, 787739. [Google Scholar] [CrossRef]
- Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A fast spliced aligner with low memory requirements. Nat. Methods 2015, 12, 357–360. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Anders, S.; Pyl, P.T.; Huber, W. HTSeq—A Python framework to work with high-throughput sequencing data. Bioinformatics 2015, 31, 166–169. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome. Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gu, Z.; Eils, R.; Schlesner, M. Complex heatmaps reveal patterns and correlations in multidimensional genomic data. Bioinformatics 2016, 32, 2847–2849. [Google Scholar] [CrossRef] [PubMed]
- Subramanian, A.; Tamayo, P.; Mootha, V.K.; Mukherjee, S.; Ebert, B.L.; Gillette, M.A.; Paulovich, A.; Pomeroy, S.L.; Golub, T.R.; Lander, E.S.; et al. Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. USA 2005, 102, 15545–15550. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, T.; Hu, E.; Xu, S.; Chen, M.; Guo, P.; Dai, Z.; Feng, T.; Zhou, L.; Tang, W.; Zhan, L.; et al. clusterProfiler 4.0: A universal enrichment tool for interpreting omics data. Innovation 2021, 2, 100141. [Google Scholar] [CrossRef] [PubMed]
- Ji, C.M.; Wang, B.; Zhou, J.; Huang, Y.W. Aminopeptidase-N-independent entry of porcine epidemic diarrhea virus into Vero or porcine small intestine epithelial cells. Virology 2018, 517, 16–23. [Google Scholar] [CrossRef]
- Hofmann, M.; Wyler, R. Propagation of the virus of porcine epidemic diarrhea in cell culture. J. Clin. Microbiol. 1988, 26, 2235–2239. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, M.; Lv, L.; Cai, H.; Li, Y.; Gao, F.; Yu, L.; Jiang, Y.; Tong, W.; Li, L.; Li, G.; et al. Long-Term Expansion of Porcine Intestinal Organoids Serves as an in vitro Model for Swine Enteric Coronavirus Infection. Front. Microbiol. 2022, 13, 865336. [Google Scholar] [CrossRef]
- Yu, L.; Dong, J.; Wang, Y.; Zhang, P.; Liu, Y.; Zhang, L.; Liang, P.; Wang, L.; Song, C. Porcine epidemic diarrhea virus nsp4 induces pro-inflammatory cytokine and chemokine expression inhibiting viral replication in vitro. Arch. Virol. 2019, 164, 1147–1157. [Google Scholar] [CrossRef] [PubMed]
- Drummond, C.G.; Bolock, A.M.; Ma, C.; Luke, C.J.; Good, M.; Coyne, C.B. Enteroviruses infect human enteroids and induce antiviral signaling in a cell lineage-specific manner. Proc. Natl. Acad. Sci. USA 2017, 114, 1672–1677. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Clevers, H. Modeling Development and Disease with Organoids. Cell 2016, 165, 1586–1597. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, Y.; Yang, N.; Chen, J.; Huang, X.; Zhang, N.; Yang, S.; Liu, G.; Liu, G. Next-Generation Porcine Intestinal Organoids: An Apical-Out Organoid Model for Swine Enteric Virus Infection and Immune Response Investigations. J. Virol. 2020, 94, e01006-20. [Google Scholar] [CrossRef]
- Li, L.; Fu, F.; Guo, S.; Wang, H.; He, X.; Xue, M.; Yin, L.; Feng, L.; Liu, P. Porcine Intestinal Enteroids: A New Model for Studying Enteric Coronavirus Porcine Epidemic Diarrhea Virus Infection and the Host Innate Response. J. Virol. 2019, 93, e01682-18. [Google Scholar] [CrossRef]
- Jiang, Z.; Jhunjhunwala, S.; Liu, J.; Haverty, P.M.; Kennemer, M.I.; Guan, Y.; Lee, W.; Carnevali, P.; Stinson, J.; Johnson, S.; et al. The effects of hepatitis B virus integration into the genomes of hepatocellular carcinoma patients. Genome. Res. 2012, 22, 593–601. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, W.; van Kuppeveld, F.J.M.; He, Q.; Rottier, P.J.M.; Bosch, B.J. Cellular entry of the porcine epidemic diarrhea virus. Virus Res. 2016, 226, 117–127. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, B.X.; Ge, J.W.; Li, Y.J. Porcine aminopeptidase N is a functional receptor for the PEDV coronavirus. Virology 2007, 365, 166–172. [Google Scholar] [CrossRef] [Green Version]
- Shirato, K.; Maejima, M.; Islam, M.T.; Miyazaki, A.; Kawase, M.; Matsuyama, S.; Taguchi, F. Porcine aminopeptidase N is not a cellular receptor of porcine epidemic diarrhea virus, but promotes its infectivity via aminopeptidase activity. J. Gen. Virol. 2016, 97, 2528–2539. [Google Scholar] [CrossRef] [PubMed]
- Whitworth, K.M.; Rowland, R.R.R.; Petrovan, V.; Sheahan, M.; Cino-Ozuna, A.G.; Fang, Y.; Hesse, R.; Mileham, A.; Samuel, M.S.; Wells, K.D.; et al. Resistance to coronavirus infection in amino peptidase N-deficient pigs. Transgenic. Res. 2019, 28, 21–32. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Annamalai, T.; Saif, L.J.; Lu, Z.; Jung, K. Age-dependent variation in innate immune responses to porcine epidemic diarrhea virus infection in suckling versus weaned pigs. Vet. Immunol. Immunopathol. 2015, 168, 193–202. [Google Scholar] [CrossRef]
- Jung, K.; Miyazaki, A.; Saif, L.J. Immunohistochemical detection of the vomiting-inducing monoamine neurotransmitter serotonin and enterochromaffin cells in the intestines of conventional or gnotobiotic (Gn) pigs infected with porcine epidemic diarrhea virus (PEDV) and serum cytokine responses of Gn pigs to acute PEDV infection. Res. Vet. Sci. 2018, 119, 99–108. [Google Scholar] [CrossRef]
- Gao, Q.; Zhao, S.; Qin, T.; Yin, Y.; Yang, Q. Effects of porcine epidemic diarrhea virus on porcine monocyte-derived dendritic cells and intestinal dendritic cells. Vet. Microbiol. 2015, 179, 131–141. [Google Scholar] [CrossRef] [PubMed]
- Jung, K.; Saif, L.J.; Wang, Q. Porcine epidemic diarrhea virus (PEDV): An update on etiology, transmission, pathogenesis, and prevention and control. Virus Res. 2020, 286, 198045. [Google Scholar] [CrossRef]
- Yuan, C.; Sun, L.; Chen, L.; Guo, H.; Yao, Z.; Wang, Y.; Zhu, W.; Li, T.; Song, Q.; Li, H. Chemokines induced by PEDV infection and chemotactic effects on monocyte, T and B cells. Vet. Microbiol. 2022, 275, 109599. [Google Scholar] [CrossRef]
- Hu, Z.; Li, Y.; Du, H.; Ren, J.; Zheng, X.; Wei, K.; Liu, J. Transcriptome analysis reveals modulation of the STAT family in PEDV-infected IPEC-J2 cells. BMC Genomics 2020, 21, 891. [Google Scholar] [CrossRef] [PubMed]
Primer Name. | Sequence (5′-3′) | Reference No. |
---|---|---|
IL8-F | TAGCAAAATTGAGGCCAAGG | NM_000584.4 |
IL8-R | GGACTTGTGGATCCTGGCTA | |
DDIT4-F | TGTTTAGCTCCGCCAACTCT | NM_019058.4 |
DDIT4-R | CACCCCAAAAGTTCAGTCGT | |
IFNα-F | CTGGGAGGTTGTCAGAGCAG | NM_024013.3 |
ΙFΝα-R | ATGAAAGCGTGACCTGGTGT | |
IFNβ-F | TGCTCTGGCACAACAGGTAG | NM_002176.4 |
IFNβ-R | AGCCTCCCATTCAATTGCCA | |
IFNγ-F | GGCTTTATCTCAGGGGCCAA | NM_000619.3 |
IFNγ-R | GCACCAGGCATGAAATCTCC | |
IL1β-F | ACGATGCACCTGTACGATCA | NM_000576.3 |
IL1β-R | TCTTTCAACACGCAGGACAG | |
IL6-F | TTCGGTCCAGTTGCCTTCTC | NM_000600.5 |
IL6-R | TGTTTTCTGCCAGTGCCTCT | |
TNFα-F | CACAGTGAAGTGCTGGCAAC | NM_000594.4 |
TNFα-R | AGGAAGGCCTAAGGTCCACT | |
GAPDH-F | GATTTGGTCGTATTGGGCGC | NM_002046.7 |
GAPDH-R | TTCCCGTTCTCAGCCTTGAC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lv, L.; Luo, H.; Yu, L.; Tong, W.; Jiang, Y.; Li, G.; Tong, G.; Li, Y.; Liu, C. Identification and Characterization of Cell Lines HepG2, Hep3B217 and SNU387 as Models for Porcine Epidemic Diarrhea Coronavirus Infection. Viruses 2022, 14, 2754. https://doi.org/10.3390/v14122754
Lv L, Luo H, Yu L, Tong W, Jiang Y, Li G, Tong G, Li Y, Liu C. Identification and Characterization of Cell Lines HepG2, Hep3B217 and SNU387 as Models for Porcine Epidemic Diarrhea Coronavirus Infection. Viruses. 2022; 14(12):2754. https://doi.org/10.3390/v14122754
Chicago/Turabian StyleLv, Lilei, Huaye Luo, Lingxue Yu, Wu Tong, Yifeng Jiang, Guoxin Li, Guangzhi Tong, Yanhua Li, and Changlong Liu. 2022. "Identification and Characterization of Cell Lines HepG2, Hep3B217 and SNU387 as Models for Porcine Epidemic Diarrhea Coronavirus Infection" Viruses 14, no. 12: 2754. https://doi.org/10.3390/v14122754
APA StyleLv, L., Luo, H., Yu, L., Tong, W., Jiang, Y., Li, G., Tong, G., Li, Y., & Liu, C. (2022). Identification and Characterization of Cell Lines HepG2, Hep3B217 and SNU387 as Models for Porcine Epidemic Diarrhea Coronavirus Infection. Viruses, 14(12), 2754. https://doi.org/10.3390/v14122754