Versatile SARS-CoV-2 Reverse-Genetics Systems for the Study of Antiviral Resistance and Replication
Abstract
:1. Introduction
2. Materials and Methods
2.1. Generation of a Full-Length SARS-CoV-2 cDNA by RT-PCR
2.2. Construction of a Full-Length SARS-CoV-2 BAC Clone
2.3. Modifications of the Full-Length BAC Clone: Mutagenesis, Insertions, and Deletions
2.4. Virus Cell Culture
2.5. Transfections and Luciferase Assay
2.6. Microscopy and Image Analysis
2.7. Next Generation Sequencing of Viral Supernatants and Plasmids
2.8. RT-qPCR
3. Results
3.1. Characterization of a Novel SARS-CoV-2 Full-Length Clone
3.2. Generation of Marker SARS-CoV-2 Viruses
3.3. Suitability of Full-Length SARS-CoV-2 Clones for Drug Susceptibility Testing
3.4. Remdesivir Susceptibility of SARS-CoV-2 nsp12 Mutant Viruses
3.5. Non-Infectious Subgenomic SARS-CoV-2 Clones with Efficient RNA Replication Inhibited by Remdesivir
4. Discussion
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hu, B.; Guo, H.; Zhou, P.; Shi, Z.L. Characteristics of SARS-CoV-2 and COVID-19. Nat. Rev. Microbiol. 2021, 19, 141–154. [Google Scholar] [CrossRef]
- Gorbalenya, A.E.; Baker, S.C.; Baric, R.S.; de Groot, R.J.; Drosten, C.; Gulyaeva, A.A.; Haagmans, B.L.; Lauber, C.; Leontovich, A.M.; Neuman, B.W.; et al. The species Severe acute respiratory syndrome-related coronavirus: Classifying 2019-nCoV and naming it SARS-CoV-2. Nat. Microbiol. 2020, 5, 536–544. [Google Scholar] [CrossRef] [Green Version]
- Cui, J.; Li, F.; Shi, Z.L. Origin and evolution of pathogenic coronaviruses. Nat. Rev. Microbiol. 2019, 17, 181–192. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhu, N.; Zhang, D.; Wang, W.; Li, X.; Yang, B.; Song, J.; Zhao, X.; Huang, B.; Shi, W.; Lu, R.; et al. A Novel Coronavirus from Patients with Pneumonia in China, 2019. N. Engl. J. Med. 2020, 382, 727–733. [Google Scholar] [CrossRef] [PubMed]
- V’kovski, P.; Kratzel, A.; Steiner, S.; Stalder, H.; Thiel, V. Coronavirus biology and replication: Implications for SARS-CoV-2. Nat. Rev. Microbiol. 2021, 19, 155–170. [Google Scholar] [CrossRef] [PubMed]
- Xia, H.; Cao, Z.; Xie, X.; Zhang, X.; Chen, J.Y.C.; Wang, H.; Menachery, V.D.; Rajsbaum, R.; Shi, P.Y. Evasion of Type I Interferon by SARS-CoV-2. Cell Rep. 2020, 33, 108234. [Google Scholar] [CrossRef]
- Ricardo-Lax, I.; Luna, J.M.; Thao, T.T.N.; Le Pen, J.; Yu, Y.; Hoffmann, H.-H.; Schneider, W.M.; Razooky, B.S.; Fernandez-Martinez, J.; Schmidt, F.; et al. Replication and single-cycle delivery of SARS-CoV-2 replicons. Science 2021, 374, 1099–1106. [Google Scholar] [CrossRef] [PubMed]
- Xie, X.; Muruato, A.; Lokugamage, K.G.; Narayanan, K.; Zhang, X.; Zou, J.; Liu, J.; Schindewolf, C.; Bopp, N.E.; Aguilar, P.V.; et al. An Infectious cDNA Clone of SARS-CoV-2. Cell Host Microbe 2020, 27, 841–848.e3. [Google Scholar] [CrossRef]
- Hou, Y.J.; Okuda, K.; Edwards, C.E.; Martinez, D.R.; Asakura, T.; Dinnon, K.H.; Kato, T.; Lee, R.E.; Yount, B.L.; Mascenik, T.M.; et al. SARS-CoV-2 Reverse Genetics Reveals a Variable Infection Gradient in the Respiratory Tract. Cell 2020, 182, 429–446.e14. [Google Scholar] [CrossRef] [PubMed]
- Almazán, F.; González, J.M.; Pénzes, Z.; Izeta, A.; Calvo, E.; Plana-Durán, J.; Enjuanes, L. Engineering the largest RNA virus genome as an infectious bacterial artificial chromosome. Proc. Natl. Acad. Sci. USA 2000, 97, 5516–5521. [Google Scholar] [CrossRef] [Green Version]
- Ye, C.; Chiem, K.; Park, J.G.; Oladunni, F.; Platt, R.N.; Anderson, T.; Almazan, F.; de la Torre, J.C.; Martinez-Sobrido, L. Rescue of SARS-CoV-2 from a single bacterial artificial chromosome. MBio 2020, 11, e02168-20. [Google Scholar] [CrossRef]
- Thi Nhu Thao, T.; Labroussaa, F.; Ebert, N.; V’kovski, P.; Stalder, H.; Portmann, J.; Kelly, J.; Steiner, S.; Holwerda, M.; Kratzel, A.; et al. Rapid reconstruction of SARS-CoV-2 using a synthetic genomics platform. Nature 2020, 582, 561–565. [Google Scholar] [CrossRef] [PubMed]
- Almazán, F.; DeDiego, M.L.; Galán, C.; Escors, D.; Álvarez, E.; Ortego, J.; Sola, I.; Zuñiga, S.; Alonso, S.; Moreno, J.L.; et al. Construction of a Severe Acute Respiratory Syndrome Coronavirus Infectious cDNA Clone and a Replicon To Study Coronavirus RNA Synthesis. J. Virol. 2006, 80, 10900–10906. [Google Scholar] [CrossRef] [Green Version]
- Almazán, F.; Dediego, M.L.; Sola, I.; Zuñiga, S.; Nieto-Torres, J.L.; Marquez-Jurado, S.; Andrés, G.; Enjuanes, L. Engineering a replication-competent, propagation-defective middle east respiratory syndrome coronavirus as a vaccine candidate. MBio 2013, 4, e00650-13. [Google Scholar] [CrossRef] [Green Version]
- Rihn, S.J.; Merits, A.; Bakshi, S.; Turnbull, M.L.; Wickenhagen, A.; Alexander, A.J.T.; Baillie, C.; Brennan, B.; Brown, F.; Brunker, K.; et al. A plasmid DNA-launched SARS-CoV-2 reverse genetics system and coronavirus toolkit for COVID-19 research. PLoS Biol. 2021, 19, e3001091. [Google Scholar] [CrossRef]
- Rathore, M.H.; Runyon, J.; Haque, T. Emerging Infectious Diseases. Adv. Pediatr. 2017, 64, 27–71. [Google Scholar] [CrossRef] [Green Version]
- Beigel, J.H.; Tomashek, K.M.; Dodd, L.E.; Mehta, A.K.; Zingman, B.S.; Kalil, A.C.; Hohmann, E.; Chu, H.Y.; Luetkemeyer, A.; Kline, S.; et al. Remdesivir for the Treatment of Covid-19—Final Report. N. Engl. J. Med. 2020, 383, 1813–1826. [Google Scholar] [CrossRef]
- Mahase, E. Covid-19: Molnupiravir reduces risk of hospital admission or death by 50% in patients at risk, MSD reports. BMJ 2021, 375, n2422. [Google Scholar] [CrossRef]
- Agostini, M.L.; Andres, E.L.; Sims, A.C.; Graham, R.L.; Sheahan, T.P.; Lu, X.; Smith, E.C.; Case, J.B.; Feng, J.Y.; Jordan, R.; et al. Coronavirus Susceptibility to the Antiviral Remdesivir (GS-5734) Is Mediated by the Viral Polymerase and the Proofreading Exoribonuclease. MBio 2018, 9, e00221-18. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Deng, X.; StJohn, S.E.; Osswald, H.L.; O’Brien, A.; Banach, B.S.; Sleeman, K.; Ghosh, A.K.; Mesecar, A.D.; Baker, S.C. Coronaviruses resistant to a 3C-like protease inhibitor are attenuated for replication and pathogenesis, revealing a low genetic barrier but high fitness cost of resistance. J. Virol. 2014, 88, 11886–11898. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fahnøe, U.; Bukh, J. Full-length open reading frame amplification of hepatitis C virus. Methods Mol. Biol. 2019, 1911, 85–91. [Google Scholar] [CrossRef]
- Ramirez, S.; Fernandez-Antunez, C.; Galli, A.; Underwood, A.; Pham, L.V.; Ryberg, L.A.; Feng, S.; Pedersen, M.S.; Mikkelsen, L.S.; Belouzard, S.; et al. Overcoming Culture Restriction for SARS-CoV-2 in Human Cells Facilitates the Screening of Compounds Inhibiting Viral Replication. Antimicrob. Agents Chemother. 2021, 65, e00097-21. [Google Scholar] [CrossRef]
- Fahnøe, U.; Pedersen, A.G.; Risager, P.C.; Nielsen, J.; Belsham, G.J.; Höper, D.; Beer, M.; Rasmussen, T.B. Rescue of the highly virulent classical swine fever virus strain “Koslov” from cloned cDNA and first insights into genome variations relevant for virulence. Virology 2014, 468, 379–387. [Google Scholar] [CrossRef] [PubMed]
- Wolfisberg, R.; Holmbeck, K.; Nielsen, L.; Kapoor, A.; Rice, C.M.; Bukh, J.; Scheel, T.K.H. Replicons of a Rodent Hepatitis C Model Virus Permit Selection of Highly Permissive Cells. J. Virol. 2019, 93, e00733-19. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Reed, L.J.; Muench, H.A. A simple method of estimating fifty per cent endpoints. Am. J. Epidemiol. 1938, 27, 493–497. [Google Scholar] [CrossRef]
- Jensen, S.B.; Fahnøe, U.; Pham, V.L.; Serre, S.B.N.; Tang, Q.; Ghanem, L.; Pedersen, M.S.; Ramirez, S.; Humes, D.; Pihl, A.F.; et al. Evolutionary Pathways to Persistence of Highly Fit and Resistant Hepatitis C Virus Protease Inhibitor Escape Variants. Hepatology 2019, 70, 771–787. [Google Scholar] [CrossRef]
- Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet.Journal 2011, 17, 10–12. [Google Scholar] [CrossRef]
- Corman, V.M.; Landt, O.; Kaiser, M.; Molenkamp, R.; Meijer, A.; Chu, D.K.W.; Bleicker, T.; Brünink, S.; Schneider, J.; Schmidt, M.L.; et al. Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR. Eurosurveillance 2020, 25, 2000045. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Offersgaard, A.; Duarte Hernandez, C.R.; Pihl, A.F.; Costa, R.; Venkatesan, N.P.; Lin, X.; Van Pham, L.; Feng, S.; Fahnøe, U.; Scheel, T.K.; et al. SARS-CoV-2 Production in a Scalable High Cell Density Bioreactor. Vaccines 2021, 9, 706. [Google Scholar] [CrossRef]
- Sims, A.C.; Baric, R.S.; Yount, B.; Burkett, S.E.; Collins, P.L.; Pickles, R.J. Severe Acute Respiratory Syndrome Coronavirus Infection of Human Ciliated Airway Epithelia: Role of Ciliated Cells in Viral Spread in the Conducting Airways of the Lungs. J. Virol. 2005, 79, 15511–15524. [Google Scholar] [CrossRef] [Green Version]
- He, X.; Quan, S.; Xu, M.; Rodriguez, S.; Goh, S.L.; Wei, J.; Fridman, A.; Koeplinger, K.A.; Carroll, S.S.; Grobler, J.A.; et al. Generation of sars-cov-2 reporter replicon for high-throughput antiviral screening and testing. Proc. Natl. Acad. Sci. USA 2021, 118, e2025866118. [Google Scholar] [CrossRef]
- Xie, X.; Muruato, A.E.; Zhang, X.; Lokugamage, K.G.; Fontes-Garfias, C.R.; Zou, J.; Liu, J.; Ren, P.; Balakrishnan, M.; Cihlar, T.; et al. A nanoluciferase SARS-CoV-2 for rapid neutralization testing and screening of anti-infective drugs for COVID-19. Nat. Commun. 2020, 11, 5214. [Google Scholar] [CrossRef]
- Pachetti, M.; Marini, B.; Benedetti, F.; Giudici, F.; Mauro, E.; Storici, P.; Masciovecchio, C.; Angeletti, S.; Ciccozzi, M.; Gallo, R.C.; et al. Emerging SARS-CoV-2 mutation hot spots include a novel RNA-dependent-RNA polymerase variant. J. Transl. Med. 2020, 18, 179. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Martin, R.; Li, J.; Parvangada, A.; Perry, J.; Cihlar, T.; Mo, H.; Porter, D.; Svarovskaia, E. Genetic conservation of SARS-CoV-2 RNA replication complex in globally circulating isolates and recently emerged variants from humans and minks suggests minimal pre-existing resistance to remdesivir. Antiviral Res. 2021, 188, 105033. [Google Scholar] [CrossRef] [PubMed]
- Lo, M.K.; Albariño, C.G.; Perry, J.K.; Chang, S.; Tchesnokov, E.P.; Guerrero, L.; Chakrabarti, A.; Shrivastava-Ranjan, P.; Chatterjee, P.; McMullan, L.K.; et al. Remdesivir targets a structurally analogous region of the Ebola virus and SARS-CoV-2 polymerases. Proc. Natl. Acad. Sci. USA 2020, 117, 26946–26954. [Google Scholar] [CrossRef]
- Szemiel, A.M.; Merits, A.; Orton, R.J.; MacLean, O.A.; Pinto, R.M.; Wickenhagen, A.; Lieber, G.; Turnbull, M.L.; Wang, S.; Furnon, W.; et al. In vitro selection of Remdesivir resistance suggests evolutionary predictability of SARS-CoV-2. PLOS Pathog. 2021, 17, e1009929. [Google Scholar] [CrossRef] [PubMed]
- Kotaki, T.; Xie, X.; Shi, P.Y.; Kameoka, M. A PCR amplicon-based SARS-CoV-2 replicon for antiviral evaluation. Sci. Rep. 2021, 11, 2229. [Google Scholar] [CrossRef]
- Ge, F.; Luo, Y.; Liew, P.X.; Hung, E. Derivation of a novel SARS-coronavirus replicon cell line and its application for anti-SARS drug screening. Virology 2007, 360, 150–158. [Google Scholar] [CrossRef]
- Hertzig, T.; Scandella, E.; Schelle, B.; Ziebuhr, J.; Siddell, S.G.; Ludewig, B.; Thiel, V. Rapid identification of coronavirus replicase inhibitors using a selectable replicon RNA. J. Gen. Virol. 2004, 85, 1717–1725. [Google Scholar] [CrossRef]
- Wang, J.M.; Wang, L.F.; Shi, Z.L. Construction of a non-infectious SARS coronavirus replicon for application in drug screening and analysis of viral protein function. Biochem. Biophys. Res. Commun. 2008, 374, 138–142. [Google Scholar] [CrossRef]
- Zhang, Y.; Song, W.; Chen, S.; Yuan, Z.; Yi, Z. A bacterial artificial chromosome (BAC)-vectored noninfectious replicon of SARS-CoV-2. Antiviral Res. 2021, 185, 104974. [Google Scholar] [CrossRef] [PubMed]
- Imai, M.; Iwatsuki-Horimoto, K.; Hatta, M.; Loeber, S.; Halfmann, P.J.; Nakajima, N.; Watanabe, T.; Ujie, M.; Takahashi, K.; Ito, M.; et al. Syrian hamsters as a small animal model for SARS-CoV-2 infection and countermeasure development. Proc. Natl. Acad. Sci. USA 2020, 117, 16587–16595. [Google Scholar] [CrossRef] [PubMed]
Primer ID | Sequence 5′-3′ |
---|---|
RT1 | CTACATAAGCAGCCATTAGATCT |
RT2 | TTTGTGTAGTACCGGCAGCA |
RT3 | AGTGTATGCAGGGGGTAATTG |
PF1 | ATTAAAGGTTTATACCTTCCCAGGTAACAAAC |
PR1 | TGTGTGGCCAACCTCTTCTGT |
PF2 | GGGAATGGATAATCTTGCCTGCG |
PR2 | ACCGGCAGCACAAGACATCT |
PF3 | AGGGCCAATTCTGCTGTCAAA |
PR3 | TGCAGGGGGTAATTGAGTTCTGG |
PF4 | GGCAAACCACGCGAACAAAT |
PR4 | GTCATTCTCCTAAGAAGCTATTAAAATCACATG |
PF3-In | CAATTACCCCCTGCACCGGGCCGTCGACCAATTC |
PR3-In | AGCAGAATTGGCCCTATCGAATATAACTTCGTATAATGTATGCTATACG |
F1-T7 | TAATACGACTCACTATAGATTAAAGGTTTATACCTTCCCAGGTAACAAAC |
F4-R-A-RZ | GGGACCATGCCGGCCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGTCATTCTCCTAAGAAGCTATTAAAATCACATG |
BAC11-RZ-F | AATGGCGAATGGGACGCGGCCGCCCGGGCCGTCGA |
BAC11-F4-R | TGTTCGTTTAGTTGTATCGAATATAACTTCGTATAATGTATGCTATACG |
BAC11-F2-R | AGATTATCCATTCCCATCGAATATAACTTCGTATAATGTATGCTATACG |
F4-F | ACAACTAAACGAACAATGTTTGTTTTTCTTG |
BAC11-T7-R | TAGTGAGTCGTATTAATCGAATATAACTTCGTATAATGTATGCTATACG |
F2-F | GGGAATGGATAATCTTGCCTGCG |
RZ-F | GGCCGGCATGGTCCCAGCCT |
RZ-R | GTCCCATTCGCCATTACCGAG |
Position | Protein | Reference Base | Alternative Base | Patient | WT Clone | nsp12 L323P | nsp12 A97V | nsp12 N491S | nsp12 F480L | nsp12 V557L | nsp12 F480L/V557L | Amino Acid Change # |
---|---|---|---|---|---|---|---|---|---|---|---|---|
1,597 | nsp2 | A | T | - | - | - | - | - | - | 43.7 | - | E264D |
1,877 | nsp2 | T | A | - | - | - | - | - | - | - | 55.5 | S358T |
2,337 | nsp2 | A | C | - | - | - | - | 59.2 | - | - | - | D511A |
3,790 | nsp3 | A | T | - | - | 99.5 | - | - | - | - | - | L357F |
6,063 | nsp3 | A | G | - | - | 39.3 | - | - | - | - | - | D1115G |
11,075 | nsp6 | T | C | - | - | - | - | - | 20.8 | - | - | F35L |
11,186 | nsp6 | T | G | - | - | - | - | - | - | 41.2 | - | L72V |
13,730 | nsp12 | C | T | - | - | - | 99.2 | - | - | - | - | A97V |
14,408 | nsp12 | C | T | 99.8 | 99.7 | - | 99.4 | 99.8 | 99.7 | 99.8 | 99.7 | P323L |
14,878 | nsp12 | T | C | - | - | - | - | - | 99.6 | - | 99.7 | F480L |
14,880 | nsp12 | T | A | - | - | - | - | - | 99.8 | - | 99.8 | F480L |
14,912 | nsp12 | A | G | - | - | - | - | 99.6 | - | - | - | N491S |
15,109 | nsp12 | G | C | - | - | - | - | - | - | 99.2 | 99.1 | V557L |
21,784 | S | T | A | - | - | - | - | - | 21.0 | - | 0.7 | N74K |
22,301 | S | A | C | - | 42.7 | 0.8 | - | - | - | - | - | S247R |
23,525 | S | C | T | - | 0.3 | - | 8.5 | 4.7 | - | - | - | H655Y |
23,606 | S | C | T | - | 3.1 | 33.5 | 17.5 | 1.3 | - | - | - | R682W |
23,615 | S | C | A | - | - | - | - | - | 99.4 | - | - | R685S |
26,261 | E | C | T | - | 1.7 | - | 45.1 | 8.0 | - | 2.5 | - | S6L |
26,333 | E | C | T | - | - | - | 0.5 | 66.6 | - | - | 1.0 | T30I |
26,435 | E | A | C | - | - | - | - | - | - | 81.0 | - | N64T |
27,224 | ORF6 | A | C | - | - | - | - | - | - | - | 94.3 | Q8P |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fahnøe, U.; Pham, L.V.; Fernandez-Antunez, C.; Costa, R.; Rivera-Rangel, L.R.; Galli, A.; Feng, S.; Mikkelsen, L.S.; Gottwein, J.M.; Scheel, T.K.H.; et al. Versatile SARS-CoV-2 Reverse-Genetics Systems for the Study of Antiviral Resistance and Replication. Viruses 2022, 14, 172. https://doi.org/10.3390/v14020172
Fahnøe U, Pham LV, Fernandez-Antunez C, Costa R, Rivera-Rangel LR, Galli A, Feng S, Mikkelsen LS, Gottwein JM, Scheel TKH, et al. Versatile SARS-CoV-2 Reverse-Genetics Systems for the Study of Antiviral Resistance and Replication. Viruses. 2022; 14(2):172. https://doi.org/10.3390/v14020172
Chicago/Turabian StyleFahnøe, Ulrik, Long V. Pham, Carlota Fernandez-Antunez, Rui Costa, Lizandro René Rivera-Rangel, Andrea Galli, Shan Feng, Lotte S. Mikkelsen, Judith M. Gottwein, Troels K. H. Scheel, and et al. 2022. "Versatile SARS-CoV-2 Reverse-Genetics Systems for the Study of Antiviral Resistance and Replication" Viruses 14, no. 2: 172. https://doi.org/10.3390/v14020172
APA StyleFahnøe, U., Pham, L. V., Fernandez-Antunez, C., Costa, R., Rivera-Rangel, L. R., Galli, A., Feng, S., Mikkelsen, L. S., Gottwein, J. M., Scheel, T. K. H., Ramirez, S., & Bukh, J. (2022). Versatile SARS-CoV-2 Reverse-Genetics Systems for the Study of Antiviral Resistance and Replication. Viruses, 14(2), 172. https://doi.org/10.3390/v14020172