Genetic Characteristics of Measles Viruses Isolated in Taiwan between 2015 and 2020
Abstract
:1. Introduction
2. Materials and Methods
2.1. Collection of Clinical Samples
2.2. Viral RNA Detection
2.3. Virus Isolation, Genotyping and Extended Window RT-PCR
2.4. Sequencing and Phylogenetic Analysis
2.5. Ethic Statement
3. Results
3.1. Analysis According to N-450 Sequences
3.1.1. Genotype H1
3.1.2. Genotype B3
3.1.3. Genotype D8
3.2. Analysis according to MF-NCR Sequences
3.2.1. MF-NCR Analysis for Genotype B3
3.2.2. MF-NCR Analysis for Genotype D8
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Guerra, F.M.; Bolotin, S.; Lim, G.; Heffernan, J.; Deeks, S.L.; Li, Y.; Crowcroft, N.S. The basic reproduction number (R0) of measles: A systematic review. Lancet Infect Dis 2017, 17, e420–e428. [Google Scholar] [CrossRef] [PubMed]
- Roush, S.W.; Murphy, T.V.; Vaccine-Preventable Disease Table Working, G. Historical comparisons of morbidity and mortality for vaccine-preventable diseases in the United States. JAMA 2007, 298, 2155–2163. [Google Scholar] [CrossRef] [PubMed]
- Moss, W.J.; Strebel, P. Biological feasibility of measles eradication. J Infect Dis 2011, 204 (Suppl. S1), S47–S53. [Google Scholar] [CrossRef] [PubMed]
- Minta, A.A.; Ferrari, M.; Antoni, S.; Portnoy, A.; Sbarra, A.; Lambert, B.; Hauryski, S.; Hatcher, C.; Nedelec, Y.; Datta, D.; et al. Progress Toward Regional Measles Elimination-Worldwide, 2000–2021. MMWR Morb. Mortal. Wkly. Rep. 2022, 71, 1489–1495. [Google Scholar] [CrossRef] [PubMed]
- Patel, M.K.; Gacic-Dobo, M.; Strebel, P.M.; Dabbagh, A.; Mulders, M.N.; Okwo-Bele, J.M.; Dumolard, L.; Rota, P.A.; Kretsinger, K.; Goodson, J.L. Progress Toward Regional Measles Elimination-Worldwide, 2000–2015. MMWR Morb. Mortal. Wkly. Rep. 2016, 65, 1228–1233. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- World Health Organization Regional Office for the Western Pacific. Guidelines on Verification of Measles and Rubella Elimination in the Western Pacific Region, 2nd ed.; WHO Regional Office for the Western Pacific: Manila, Philippines, 2019; Available online: https://apps.who.int/iris/handle/10665/331139 (accessed on 20 November 2022).
- The role of extended and whole genome sequencing for tracking transmission of measles and rubella viruses: Report from the Global Measles and Rubella Laboratory Network meeting, 2017. Wkly. Epidemiol. Rec. 2018, 93, 55–59.
- Cheng, W.Y.; Lee, L.; Rota, P.A.; Yang, D.C. Molecular evolution of measles viruses circulated in Taiwan 1992–2008. Virol. J. 2009, 6, 219. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cheng, W.Y.; Tung, H.P.; Wang, H.C.; Lee, L.L.; Wu, H.S.; Liu, M.T. Molecular epidemiology of measles virus in Taiwan in 2010–2011: The common genotype changed from H1 to D9 and the first appearance of D4. J. Med. Virol. 2013, 85, 1095–1099. [Google Scholar] [CrossRef] [PubMed]
- Cheng, W.Y.; Wang, H.C.; Wu, H.S.; Liu, M.T. Measles surveillance in Taiwan, 2012–2014: Changing epidemiology, immune response, and circulating genotypes. J. Med. Virol. 2015, 88, 746–753. [Google Scholar] [CrossRef] [PubMed]
- Cheng, W.Y.; Yang, C.F.; Hou, Y.T.; Wang, S.C.; Chang, H.L.; Chiu, H.Y.; Wang, E.T.; Wu, H.S. Imported measles and implications for its elimination in taiwan. Emerg. Infect. Dis. 2011, 17, 1523–1526. [Google Scholar] [CrossRef] [PubMed]
- Ono, N.; Tatsuo, H.; Hidaka, Y.; Aoki, T.; Minagawa, H.; Yanagi, Y. Measles viruses on throat swabs from measles patients use signaling lymphocytic activation molecule (CDw150) but not CD46 as a cellular receptor. J. Virol. 2001, 75, 4399–4401. [Google Scholar] [CrossRef] [PubMed]
- WHO. Manual for the Laboratory Diagnosis of Measles and Rubella Virus Infection, 2nd ed.; WHO: Geneva, Switzerland, 2007. [Google Scholar]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
- Limberkova, R.; Repelova, S.; Novakova, L.; Blechova, Z.; Linka, M.; Liptakova, M.; Smiskova, D. Measles outbreaks in 2017–2019-molecular surveillance started in the Czech Republic. Epidemiol. Mikrobiol. Imunol. 2022, 71, 40–47. [Google Scholar] [PubMed]
- Domai, F.M.; Agrupis, K.A.; Han, S.M.; Sayo, A.R.; Ramirez, J.S.; Nepomuceno, R.; Suzuki, S.; Villanueva, A.M.G.; Salva, E.P.; Villarama, J.B.; et al. Measles outbreak in the Philippines: Epidemiological and clinical characteristics of hospitalized children, 2016–2019. Lancet Reg. Health West. Pac. 2022, 19, 100334. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.M.; Park, S.; Kim, S.; Park, K.R.; Wang, J.S.; Chung, Y.S. Genetic Analysis of the Measles Virus From the Outbreaks in South Korea, 2019. Front. Microbiol. 2021, 12, 763107. [Google Scholar] [CrossRef]
- Coulby, C.; Domingo, F.R.; Hiebert, J.; MacDonald, D. Measles surveillance in Canada: 2018. Can. Commun. Dis. Rep. 2020, 46, 77–83. [Google Scholar] [CrossRef]
- Seki, F.; Miyoshi, M.; Ikeda, T.; Nishijima, H.; Saikusa, M.; Itamochi, M.; Minagawa, H.; Kurata, T.; Ootomo, R.; Kajiwara, J.; et al. Nationwide Molecular Epidemiology of Measles Virus in Japan Between 2008 and 2017. Front. Microbiol. 2019, 10, 1470. [Google Scholar] [CrossRef] [Green Version]
- Brown, K.E.; Rota, P.A.; Goodson, J.L.; Williams, D.; Abernathy, E.; Takeda, M.; Mulders, M.N. Genetic Characterization of Measles and Rubella Viruses Detected Through Global Measles and Rubella Elimination Surveillance, 2016–2018. MMWR Morb. Mortal. Wkly. Rep. 2019, 68, 587–591. [Google Scholar] [CrossRef] [Green Version]
- Huang, H.I.; Tai, M.C.; Wu, K.B.; Chen, W.C.; Huang, A.S.; Cheng, W.Y.; Liu, M.T.; Huang, W.T. Measles transmission at an international airport-Taiwan, March-April 2018. Int. J. Infect. Dis. 2019, 86, 188–190. [Google Scholar] [CrossRef] [Green Version]
- Schrag, S.J.; Rota, P.A.; Bellini, W.J. Spontaneous mutation rate of measles virus: Direct estimation based on mutations conferring monoclonal antibody resistance. J. Virol. 1999, 73, 51–54. [Google Scholar] [CrossRef] [Green Version]
- Zhang, X.; Rennick, L.J.; Duprex, W.P.; Rima, B.K. Determination of Spontaneous Mutation Frequencies in Measles Virus under Nonselective Conditions. J. Virol. 2013, 87, 2686–2692. [Google Scholar] [CrossRef] [PubMed]
- Gil, H.; Fernandez-Garcia, A.; Mosquera, M.M.; Hubschen, J.M.; Castellanos, A.M.; de Ory, F.; Masa-Calles, J.; Echevarria, J.E. Measles virus genotype D4 strains with non-standard length M-F non-coding region circulated during the major outbreaks of 2011–2012 in Spain. PLoS ONE 2018, 13, e0199975. [Google Scholar] [CrossRef] [PubMed]
Primer ID | Sequence 5′-3′ | Note |
---|---|---|
1905F | gcagcatggtcagaaatatcag | for real-time RT-PCR |
2030R | gcacYgccttcagYtgatcc | |
1967P | ttgctgagacccgaactgcctgcct | |
MV59 | gatatgtgacattgatacatatat | for N-450 genotyping RT-PCR |
MV64 | tataacaatgatggagggtag | |
Me 214 | taacaatgatggagggtagg | for N-450 genotyping nested PCR |
Me 216 | tggagctatgccatgggagt | |
4200F | ggcaccagtcttcacattagaag | for segment 1 MF NCR RT-PCR/heminested PCR |
4212F | cacattagaagYacaggcaa | |
4869R | cttggccctRagttttgtttag | |
4801F | cacaagcgaccgaggtgac | for segment 2 MF NCR RT-PCR/heminested PCR |
4811F | acccaaccRcaggcatccga | |
5609R | cgagtcataactttgtagcctgc |
Year | The Number of Reported Measles Cases | The Number of Laboratory Confirmed Measles Cases a | The Number of Cases MV Genotype Data | ||||||
---|---|---|---|---|---|---|---|---|---|
Total | Genotype (N-450) | Total | Genotype (M/F NCR-1018) | ||||||
H1 | D8 | B3 | D8 | B3 | |||||
2015 | 141 | 29 | 27 | 27 | 0 | 0 | 0 | 0 | 0 |
2016 | 114 | 14 | 13 | 7 | 6 | 0 | 3 | 3 | 0 |
2017 | 99 | 6 | 6 | 1 | 4 | 1 | 4 | 3 | 1 |
2018 | 471 | 40 | 37 | 0 | 34 | 3 | 34 | 31 | 3 |
2019 | 982 | 140 | 135 | 0 | 101 | 34 | 115 | 89 | 26 |
2020 | 172 | 1 | 1 | 0 | 1 | 1 | 1 | 1 | 0 |
Total | 1979 | 230 | 219 | 35 | 146 | 38 | 157 | 127 | 30 |
Genotype | N-450 Variant ID | Number | WHO Named Strain/Accession Number * Accession Number ** | Epidemiologic Link *** |
---|---|---|---|---|
H1 | H1-seq 1 | 24 | MVs/HongKong.CHN-49.12[H1]/KC417295 | A(5)-CHN; B(17);C(2) |
H1-seq 2 | 1 | C(1) | ||
H1-seq 3 | 2 | MVs/HongKong.CHN-42.11[H1]/JQ031212 | A(1)-CHN; B(1) | |
H1-seq 4 | 1 | A(1)-CHN | ||
H1-seq 5 | 1 | AB968373, LC002658 | A(1)-VNM | |
H1-seq 6 | 1 | A(1)-CHN(HongKong) | ||
H1-seq 7 | 4 | KY056247 | A(2)-CHN; B(2) | |
H1-seq 8 | 1 | MH979988 | A(1)-CHN | |
B3 | B3-seq 1 | 1 | MVi/Gombak.MYS/44.16[B3]/KU678417 | C(1) |
B3-seq 2 | 8 | MVi/Gombak.MYS/40.15[B3]/KU714612 | A(6)-PHL; B(1);C(1) | |
B3-seq 3 | 1 | MK633031 | A(1)-PHL | |
B3-seq 4 | 25 | MVi/Marikina City.PHL/10.18[B3]/MN602382 | A(6)-PHL,CHN,JPN,Europe ****; B(18);C(1) | |
B3-seq 5 | 1 | MT789788, 789389, 789790, MT386953 | A(1)-USA/CHN | |
B3-seq 6 | 2 | B(1);C(1) | ||
D8 | D8-seq 1 | 1 | KX377943 | C(1) |
D8-seq 2 | 1 | A(1)-IND | ||
D8-seq 3 | 4 | MVs/Osaka,JPN/29.15[D8]/LC072667 | A(3)-JPN, THA;B(1) | |
D8-seq 4 | 1 | MVs/Victoria.AUS/6.11[D8]/KF469368 | A(1)-IND/CHN/USA/SGP | |
D8-seq 5 | 1 | MF092792 | A(1)-IDN | |
D8-seq 6 | 3 | MVi/Hulu Langat.MYS/26.11[D8]/JX486001 | A(1)-FRA/BEL/NLD | |
D8-seq 7 | 1 | A(1)-THA | ||
D8-seq 8 | 90 | MVs/Gir Somnath.IND/42.16[D8]/KY120864 | A(35)-THA, VNM,CHN(Macao), KOR, IDN, JPN, BEL, PHL,NZL; B(43);C(12) | |
D8-seq 9 | 3 | A(2)-IDN;B(1) | ||
D8-seq 10 | 1 | MG652493 | C(1) | |
D8-seq 11 | 4 | MVs/Samut.Sakhon.THA/49.16[D8]/MK079566 | A(4)-Thailand | |
D8-seq 12 | 1 | MVs/Herborn.DEU/05.17[D8]/KY973620, T789841, KY973602 | A(1)-GBR | |
D8-seq 13 | 6 | MVs/Samut Sakhon.THA/8.18[D8]/MN602383 | A(3)-THA, COL | |
D8-seq 14 | 4 | MVs/Dagon Seikkan.MMR/5.18[D8]/MN602384 | A(3)-THA,MMR;B(1) | |
D8-seq 15 | 12 | A(3)-CHN, JPN;B(9) | ||
D8-seq 16 | 1 | A(1)-IDN | ||
D8-seq 17 | 6 | MT555111, LC521318, MT789845 | A(3)-THA; B(2); C(1) | |
D8-seq 18 | 6 | A(4)-THA, COL; B(2) |
Epi-Link ID | Genotype | Case Number | N-450 Variant | MF NCR Variant | Imported from |
---|---|---|---|---|---|
1 a | H1 | 16 | H1-seq1/seq2 | NA e | NA |
2 | H1 | 2 | H1-seq1 | NA | NA |
3 | H1 | 2 | H1-seq7 | NA | NA |
4 | D8 | 2 | D8-seq3 | NA | Thailand |
5 b | D8 | 21 | D8-seq8 | D8-V12 | Thailand |
6 | D8 | 2 | D8-seq9 | D8-V29 | Indonesia |
7 | B3 | 2 | B3-seq2 | B3-V2 | the Philippines |
8 | D8 | 3 | D8-seq8 | D8-V9 | Vietnam |
9 | D8 | 6 | D8-seq8 | D8-V11/V17 | Vietnam |
10 | D8 | 2 | D8-seq8 | D8-V12 | NA |
11 | D8 | 2 | D8-seq8 | D8-V12 | Japan |
12 | D8 | 2 | D8-seq14 | D8-V12/V34 | Myanmar |
13 c | D8 | 10 | D8-seq15 | D8-V10/V12/V35 | China |
14 | D8 | 4 | D8-seq8 | D8-V13 | Thailand |
15 d | B3 | 18 | B3-seq4/seq6 | B3-V7/V8 | Europe f |
16 | D8 | 5 | D8-seq13 | D8-V33 | Thailand |
17 | D8 | 2 | D8-seq15 | D8-V12 | Japan |
18 | B3 | 2 | B3-seq4 | B3-V7/V10 | NA |
19 | D8 | 2 | D8-seq8 | D8-V10 | NA |
20 | B3 | 3 | B3-seq4 | B3-V7 | NA |
21 | D8 | 2 | D8-seq8 | D8-V10 | Vietnam |
22 | D8 | 2 | D8-seq8 | D8-V22 | Vietnam |
23 c | D8 | 10 | D8-seq8 | D8-V16 | Vietnam |
24 | D8 | 3 | D8-seq18 | D8-V10 | Cambodia |
25 | D8 | 3 | D8-seq17 | D8-V37 | Thailand |
26 | B3 | 2 | B3-seq2 | B3-V11 | Italy |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cheng, W.-Y.; Chen, B.-S.; Wang, H.-C.; Liu, M.-T. Genetic Characteristics of Measles Viruses Isolated in Taiwan between 2015 and 2020. Viruses 2023, 15, 211. https://doi.org/10.3390/v15010211
Cheng W-Y, Chen B-S, Wang H-C, Liu M-T. Genetic Characteristics of Measles Viruses Isolated in Taiwan between 2015 and 2020. Viruses. 2023; 15(1):211. https://doi.org/10.3390/v15010211
Chicago/Turabian StyleCheng, Wen-Yueh, Bao-Shen Chen, Hsiao-Chi Wang, and Ming-Tsan Liu. 2023. "Genetic Characteristics of Measles Viruses Isolated in Taiwan between 2015 and 2020" Viruses 15, no. 1: 211. https://doi.org/10.3390/v15010211
APA StyleCheng, W.-Y., Chen, B.-S., Wang, H.-C., & Liu, M.-T. (2023). Genetic Characteristics of Measles Viruses Isolated in Taiwan between 2015 and 2020. Viruses, 15(1), 211. https://doi.org/10.3390/v15010211