The First Case of Zika Virus Disease in Guinea: Description, Virus Isolation, Sequencing, and Seroprevalence in Local Population
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethics
2.2. Sample Collection and Preparation
2.3. PCR and ELISA Diagnostics
2.4. Virus Isolation and Sequencing
2.5. Data Analysis
3. Results
3.1. Case Description and Diagnostics
3.2. Serosurvey
3.3. Phylogenetic Analysis
3.4. Mutation Profile
- Capsid protein C coding region, position 106 (hereinafter, the position in the amino acid sequence of the ZIKV polyprotein relative to the beginning of the open reading frame is indicated, GenBank accession number of the reference: ASR91936), amino acid substitution: A or T;
- Membrane glycoprotein precursor prM coding region, position 123, amino acid substitution: V or A;
- Membrane glycoprotein precursor prM coding region, position 139, amino acid substitution: S or N;
- Membrane glycoprotein precursor prM coding region, position 143, amino acid substitution: E or K;
- Envelope protein E coding region, position 763, amino acid substitution: V or M;
- Nonstructural protein NS1 coding region, position 982, amino acid substitution: A or V;
- RNA-dependent RNA polymerase NS5 coding region, position 3392, amino acid substitution: M or V.
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Appendix A
Name | Nucleotide Sequence 5″-3′ | Length of the Product, bp |
---|---|---|
ZK-1F | AGTTGTTGATCTGTGTGAGTCAGACTG | 799 bp |
ZK-799R | GACCGCGTTTGCAACTTCC | |
ZK-665F | GTCGATTGCTGGTGCAACACGAC | 564 bp |
ZK-1229R | AGGTAGGCTTCACCTTGTGTT | |
ZK-1147F | GAGGCATCGATATCGGACATGGCTT | 717 bp |
ZK-1864R | GGCGACATTTCAAGTGGCCAGAGGA | |
ZK-1774F | GGAGCTCTGGAGGCTGAGATGGATG | 498 bp |
ZK-2272R | CAGGCTGTGTCTCCCAAGACT | |
ZK-2191F | GCATTTGAAGCCACTGTGAGAG | 644 bp |
ZK-2835R | GGGCAGCTCGTTCACAGGCA | |
ZK-2733F | GACGGTCGTTGTGGGATCTGT | 854 bp |
ZK-3587R | GGGAGAAGTGGTCCATGTGATCAGTT | |
ZK-3456F | TGGCTGTTGGTATGGAATGGAGAT | 688 bp |
ZK-4144R | TGGTAAGTTCTTCTTCACACTGCCTT | |
ZK-4021F | GGCACACTGCTTGTGGCGTGGAGA | 686 bp |
ZK-4707R | CGAGTCATTACTCTGTACACTCCA | |
ZK-4598F | GGAGTGGTGCTCTATGGGATGT | 663 bp |
ZK-5261R | TGGCTTCACGGACTATTTCAGGA | |
ZK-5145F | GATGCTGAAGAAGAAGCAGCTAACTGT | 620 bp |
ZK-5765R | TCCAGCCTTTGTCAGACAAGCTGCGA | |
ZK-5632F | TGGAGCTCAGGCTTTGATTGGGTGA | 1051 bp |
ZK-6683R | TCCCAGCGAGACTGTTCCCAGCA | |
ZK-6143F | AGCCTCGCTCTATCGACCTGA | 540 bp |
ZK-6683R | TCCCAGCGAGACTGTTCCCA | |
ZK-6537F | ATTGACAACCTCGCCGTGCTC | 869 bp |
ZK-7406R | GGGGTCTATTGTCATTGTGTCAATG | |
ZK-7263F | GCGCACTACATGTACTTGATCCC | 667 bp |
ZK-7930R | CAGCCCCCTCTGCCACATC | |
ZK-7854F | CCATGCTGTGTCCCGAGGAA | 751 bp |
ZK-8605R | TCCTATATGGGTGGTTCTCGTCAA | |
ZK-8445F | GCCAGTGAAATATGAGGAGGATGT | 599 bp |
ZK-9044R | TGGCACTCTCCTCTCAGGTGGT | |
ZK-8956F | TGGAAGACTGCAGTGGAAGCTGTGA | 724 bp |
ZK-9680R | GCCATTCGTTTGAGCCTATCCCA | |
ZK-9572F | TGGAGGCTGAGGAAGTTCTAGAGAT | 601 bp |
ZK-10173R | GTGGTCGTTCTCCTCAATCCACACT | |
ZK-10087F | TGGTCAATCCATGGAAAGGGAGAA | 644 bp |
ZK-10731R | CTGGTCTTTCCCAGCGTCAATATGCT |
References
- McCrae, A.W.R.; Kirya, B.G. Yellow Fever and Zika Virus Epizootics and Enzootics in Uganda. Trans. R. Soc. Trop. Med. Hyg. 1982, 76, 552–562. [Google Scholar] [CrossRef]
- Ayres, C.F.J. Identification of Zika Virus Vectors and Implications for Control. Lancet Infect. Dis. 2016, 16, 278–279. [Google Scholar] [CrossRef] [Green Version]
- Epelboin, Y.; Talaga, S.; Epelboin, L.; Dusfour, I. Zika Virus: An Updated Review of Competent or Naturally Infected Mosquitoes. PLoS Negl. Trop. Dis. 2017, 11, e0005933. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ioos, S.; Mallet, H.P.; Leparc Goffart, I.; Gauthier, V.; Cardoso, T.; Herida, M. Current Zika Virus Epidemiology and Recent Epidemics. Med. Mal. Infect. 2014, 44, 302–307. [Google Scholar] [CrossRef]
- Vasilakis, N.; Weaver, S.C. Flavivirus Transmission Focusing on Zika. Curr. Opin. Virol. 2017, 22, 30–35. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Weaver, S.C.; Costa, F.; Garcia-Blanco, M.A.; Ko, A.I.; Ribeiro, G.S.; Saade, G.; Shi, P.Y.; Vasilakis, N. Zika Virus: History, Emergence, Biology, and Prospects for Control. Antiviral Res. 2016, 130, 69–80. [Google Scholar] [CrossRef] [PubMed]
- Althaus, C.L.; Low, N. How Relevant Is Sexual Transmission of Zika Virus? PLoS Med. 2016, 13, e1002157. [Google Scholar] [CrossRef] [Green Version]
- Vasquez, A.M.; Sapiano, M.R.P.; Basavaraju, S.V.; Kuehnert, M.J.; Rivera-Garcia, B. Survey of Blood Collection Centers and Implementation of Guidance for Prevention of Transfusion-Transmitted Zika Virus Infection—Puerto Rico, 2016. MMWR Morb. Mortal. Wkly. Rep. 2016, 65, 375–378. [Google Scholar] [CrossRef] [Green Version]
- Rasmussen, S.A.; Jamieson, D.J.; Honein, M.A.; Petersen, L.R. Zika Virus and Birth Defects—Reviewing the Evidence for Causality. N. Engl. J. Med. 2016, 374, 1981–1987. [Google Scholar] [CrossRef]
- Besnard, M.; Lastère, S.; Teissier, A.; Cao-Lormeau, V.M.; Musso, D. Evidence of Perinatal Transmission of Zika Virus, French Polynesia, December 2013 and February 2014. Eurosurveillance 2014, 19, 20751. [Google Scholar] [CrossRef] [Green Version]
- Mlakar, J.; Korva, M.; Tul, N.; Popović, M.; Poljšak-Prijatelj, M.; Mraz, J.; Kolenc, M.; Rus, K.R.; Vipotnik, T.V.; Vodušek, V.F.; et al. Zika Virus Associated with Microcephaly. N. Engl. J. Med. 2016, 374, 91–958. [Google Scholar] [CrossRef]
- Oliveira Melo, A.S.; Malinger, G.; Ximenes, R.; Szejnfeld, P.O.; Alves Sampaio, S.; Bispo De Filippis, A.M. Zika Virus Intrauterine Infection Causes Fetal Brain Abnormality and Microcephaly: Tip of the Iceberg? Ultrasound Obstet. Gynecol. 2016, 47, 6–7. [Google Scholar] [CrossRef]
- Sheridan, M.A.; Balaraman, V.; Schust, D.J.; Ezashi, T.; Michael Roberts, R.; Franz, A.W.E. African and Asian Strains of Zika Virus Differ in Their Ability to Infect and Lyse Primitive Human Placental Trophoblast. PLoS ONE 2018, 13, e0200086. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dick, G.W.A. Zika Virus (I). Isolations and Serological Specificity. Trans. R. Soc. Trop. Med. Hyg. 1952, 46, 509–520. [Google Scholar] [CrossRef]
- Grard, G.; Caron, M.; Mombo, I.M.; Nkoghe, D.; Mboui Ondo, S.; Jiolle, D.; Fontenille, D.; Paupy, C.; Leroy, E.M. Zika Virus in Gabon (Central Africa)—2007: A New Threat from Aedes Albopictus? PLoS Negl. Trop. Dis. 2014, 8, e2681. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Moi, M.L.; Nguyen, T.T.T.; Nguyen, C.T.; Vu, T.B.H.; Tun, M.M.N.; Pham, T.D.; Pham, N.T.; Tran, T.; Morita, K.; Le, T.Q.M.; et al. Zika Virus Infection and Microcephaly in Vietnam. Lancet Infect. Dis. 2017, 17, 805–806. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Moore, D.L.; Causey, O.R.; Carey, D.E.; Reddy, S.; Cooke, A.R.; Akinkugbe, F.M.; David-West, T.S.; Kemp, G.E. Arthropod-Borne Viral Infections of Man in Nigeria, 1964-1970. Ann. Trop. Med. Parasitol. 1975, 69, 49–64. [Google Scholar] [CrossRef]
- Olson, J.G.; Ksiazek, T.G.; Suhandiman, G.; Triwibowo, V. Zika Virus, a Cause of Fever in Central Java, Indonesia. Trans. R. Soc. Trop. Med. Hyg. 1981, 75, 389–393. [Google Scholar] [CrossRef]
- Pond, W.L. Arthropod-Borne Virus Antibodies in Sera from Residents of South-East Asia. Trans. R. Soc. Trop. Med. Hyg. 1963, 57, 364–371. [Google Scholar] [CrossRef]
- Simpson, D.I.H. Zika Virus Infection in Man. Trans. R. Soc. Trop. Med. Hyg. 1964, 58, 339–348. [Google Scholar] [CrossRef]
- Lanciotti, R.S.; Kosoy, O.L.; Laven, J.J.; Velez, J.O.; Lambert, A.J.; Johnson, A.J.; Stanfield, S.M.; Duffy, M.R. Genetic and Serologic Properties of Zika Virus Associated with an Epidemic, Yap State, Micronesia, 2007. Emerg. Infect. Dis. 2008, 14, 1232–1239. [Google Scholar] [CrossRef]
- Cao-Lormeau, V.M.; Roche, C.; Teissier, A.; Robin, E.; Berry, A.L.; Mallet, H.P.; Sall, A.A.; Musso, D. Zika Virus, French Polynesia, South Pacific, 2013. Emerg. Infect. Dis. 2014, 20, 1058. [Google Scholar] [CrossRef] [PubMed]
- Campos, G.S.; Bandeira, A.C.; Sardi, S.I. Zika Virus Outbreak, Bahia, Brazil. Emerg. Infect. Dis. 2015, 21, 1885–1886. [Google Scholar] [CrossRef]
- Zammarchi, L.; Tappe, D.; Fortuna, C.; Remoli, M.E.; Günther, S.; Venturi, G.; Bartoloni, A.; Schmidt-Chanasit, J. Zika Virus Infection in a Traveller Returning to Europe from Brazil, March 2015. Eurosurveillance 2015, 20, 21153. [Google Scholar] [CrossRef] [Green Version]
- Bogoch, I.I.; Brady, O.J.; Kraemer, M.U.G.; German, M.; Creatore, M.I.; Brent, S.; Watts, A.G.; Hay, S.I.; Kulkarni, M.A.; Brownstein, J.S.; et al. Potential for Zika Virus Introduction and Transmission in Resource-Limited Countries in Africa and the Asia-Pacific Region: A Modelling Study. Lancet Infect. Dis. 2016, 16, 1237–1245. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- WHO. World Health Organization Zika Epidemiology Update; WHO: Geneva, Switzerland, 2019. [Google Scholar]
- Kindhauser, M.K.; Allen, T.; Frank, V.; Santhana, R.S.; Dye, C. Zika: The Origin and Spread of a Mosquito-Borne Virus. Bull. World Health Organ. 2016, 94, 675–686. [Google Scholar] [CrossRef] [PubMed]
- Diallo, D.; Sall, A.A.; Diagne, C.T.; Faye, O.; Faye, O.; Ba, Y.; Hanley, K.A.; Buenemann, M.; Weaver, S.C.; Diallo, M. Zika Virus Emergence in Mosquitoes in Southeastern Senegal, 2011. PLoS ONE 2014, 9, e109442. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fagbami, A.H. Zika Virus Infections in Nigeria: Virological and Seroepidemiological Investigations in Oyo State. J. Hyg. 1979, 83, 213–219. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Robin, Y.; Mouchet, J. Enquête Sérologique et Entomologique Sur La Fièvre Jaune En Sierra Leone. Serological and Entomological Study on Yellow Fever in Sierra Leone. Bull. Soc. Pathol. Exot. Filiales 1975, 68, 249–258. [Google Scholar] [PubMed]
- Jan, C.; Languillat, G.; Renaudet, J.; Robin, Y. A serological survey of arboviruses in Gabon. Bull. Soc. Pathol. Exot. Filiales 1978, 71, 140–146. [Google Scholar] [PubMed]
- Akoua-Koffi, C.; Diarrassouba, S.; Bénié, V.B.; Ngbichi, J.M.; Bozoua, T.; Bosson, A.; Akran, V.; Carnevale, P.; Ehouman, A. Investigation surrounding a fatal case of yellow fever in Côte d’Ivoire in 1999. Bull. Soc. Pathol. Exot. 2001, 94, 227–230. [Google Scholar]
- Althouse, B.M.; Hanley, K.A.; Diallo, M.; Sall, A.A.; Ba, Y.; Faye, O.; Diallo, D.; Watts, D.M.; Weaver, S.C.; Cummings, D.A.T. Impact of Climate and Mosquito Vector Abundance on Sylvatic Arbovirus Circulation Dynamics in Senegal. Am. J. Trop. Med. Hyg. 2015, 92, 88–97. [Google Scholar] [CrossRef]
- Diouf, B.; Gaye, A.; Diagne, C.T.; Diallo, M.; Diallo, D. Zika Virus in Southeastern Senegal: Survival of the Vectors and the Virus during the Dry Season. BMC Infect. Dis. 2020, 20, 371. [Google Scholar] [CrossRef] [PubMed]
- Monlun, E.; Zeller, H.; Le Guenno, B.; Traoré-Lamizana, M.; Hervy, J.P.; Adam, F.; Ferrara, L.; Fontenille, D.; Sylla, R.; Mondo, M. Surveillance of the Circulation of Arbovirus of Medical Interest in the Region of Eastern Senegal. Bull. Soc. Pathol. Exot. 1993, 86, 21–28. [Google Scholar]
- Butenko, A.M. Arbovirus Circulation in the Republic of Guinea. Meditsinskaia Parazitol. I Parazit. Bolezn. 1996, 2, 40–45. [Google Scholar]
- Carlson, R.V.; Boyd, K.M.; Webb, D.J. The Revision of the Declaration of Helsinki: Past, Present and Future. Br. J. Clin. Pharmacol. 2004, 57, 695–713. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
- Hoang, D.T.; Chernomor, O.; Von Haeseler, A.; Minh, B.Q.; Vinh, L.S. UFBoot2: Improving the Ultrafast Bootstrap Approximation. Mol. Biol. Evol. 2018, 35, 518–522. [Google Scholar] [CrossRef]
- Nguyen, L.T.; Schmidt, H.A.; Von Haeseler, A.; Minh, B.Q. IQ-TREE: A Fast and Effective Stochastic Algorithm for Estimating Maximum-Likelihood Phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef]
- Aubry, F.; Jacobs, S.; Darmuzey, M.; Lequime, S.; Delang, L.; Fontaine, A.; Jupatanakul, N.; Miot, E.F.; Dabo, S.; Manet, C.; et al. Recent African Strains of Zika Virus Display Higher Transmissibility and Fetal Pathogenicity than Asian Strains. Nat. Commun. 2021, 12, 916. [Google Scholar] [CrossRef]
- Shan, C.; Xia, H.; Haller, S.L.; Azar, S.R.; Liu, Y.; Liu, J.; Muruato, A.E.; Chen, R.; Rossi, S.L.; Wakamiya, M.; et al. A Zika Virus Envelope Mutation Preceding the 2015 Epidemic Enhances Virulence and Fitness for Transmission. Proc. Natl. Acad. Sci. USA 2020, 117, 20190–20197. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Liu, J.; Du, S.; Shan, C.; Nie, K.; Zhang, R.; Li, X.F.; Zhang, R.; Wang, T.; Qin, C.F.; et al. Evolutionary Enhancement of Zika Virus Infectivity in Aedes Aegypti Mosquitoes. Nature 2017, 545, 482–486. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lin, C.-S.; Li, W.-J.; Liao, C.-Y.; Kan, J.-Y.; Kung, S.-H.; Huang, S.-H.; Lai, H.-C.; Lin, C.-W. A Reverse Mutation E143K within the PrM Protein of Zika Virus Asian Lineage Natal RGN Strain Increases Infectivity and Cytopathicity. Viruses 2022, 14, 1572. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Liu, Y.; Shan, C.; Nunes, B.T.D.; Yun, R.; Haller, S.L.; Rafael, G.H.; Azar, S.R.; Andersen, C.R.; Plante, K.; et al. Role of Mutational Reversions Andfitnessrestoration in Zika Virus Spread to the Americas. Nat. Commun. 2021, 12, 595. [Google Scholar] [CrossRef]
- Musso, D.; Gubler, D.J. Zika Virus. Clin. Microbiol. Rev. 2016, 29, 487–524. [Google Scholar] [CrossRef] [Green Version]
- Diarra, I.; Nurtop, E.; Sangaré, A.K.; Sagara, I.; Pastorino, B.; Sacko, S.; Zeguimé, A.; Coulibaly, D.; Fofana, B.; Gallian, P.; et al. Zika Virus Circulation in Mali. Emerg. Infect. Dis. 2020, 26, 945–952. [Google Scholar] [CrossRef]
- Tinto, B.; Kaboré, D.P.A.; Kania, D.; Kagoné, T.S.; Kiba-Koumaré, A.; Pinceloup, L.; Thaurignac, G.; Van de Perre, P.; Dabire, R.K.; Baldet, T.; et al. Serological Evidence of Zika Virus Circulation in Burkina Faso. Pathogens 2022, 11, 741. [Google Scholar] [CrossRef]
- Herrera, B.B.; Chang, C.A.; Hamel, D.J.; MBoup, S.; Ndiaye, D.; Imade, G.; Okpokwu, J.; Agbaji, O.; Bei, A.K.; Kanki, P.J. Continued Transmission of Zika Virus in Humans in West Africa, 1992-2016. J. Infect. Dis. 2017, 215, 1546–1550. [Google Scholar] [CrossRef] [Green Version]
- Stettler, K.; Beltramello, M.; Espinosa, D.A.; Graham, V.; Cassotta, A.; Bianchi, S.; Vanzetta, F.; Minola, A.; Jaconi, S.; Mele, F.; et al. Specificity, Cross-Reactivity, and Function of Antibodies Elicited by Zika Virus Infection. Science (1979) 2016, 353, 823–826. [Google Scholar] [CrossRef] [Green Version]
- Huestis, D.L.; Dao, A.; Diallo, M.; Sanogo, Z.L.; Samake, D.; Yaro, A.S.; Ousman, Y.; Linton, Y.M.; Krishna, A.; Veru, L.; et al. Windborne Long-Distance Migration of Malaria Mosquitoes in the Sahel. Nature 2019, 574, 404–408. [Google Scholar] [CrossRef]
- Faye, O.; de Lourdes Monteiro, M.; Vrancken, B.; Prot, M.; Lequime, S.; Diarra, M.; Ndiaye, O.; Valdez, T.; Tavarez, S.; Ramos, J.; et al. Genomic Epidemiology of 2015-2016 Zika Virus Outbreak in Cape Verde. Emerg. Infect. Dis. 2020, 26, 1084–1090. [Google Scholar] [CrossRef]
- Hill, S.C.; Vasconcelos, J.; Neto, Z.; Jandondo, D.; Zé-Zé, L.; Aguiar, R.S.; Xavier, J.; Thézé, J.; Mirandela, M.; Micolo Cândido, A.L.; et al. Emergence of the Asian Lineage of Zika Virus in Angola: An Outbreak Investigation. Lancet Infect. Dis. 2019, 19, 1138–1147. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kasprzykowski, J.I.; Fukutani, K.F.; Fabio, H.; Fukutani, E.R.; Costa, L.C.; Andrade, B.B.; Queiroz, A.T.L. A Recursive Sub-Typing Screening Surveillance System Detects the Appearance of the ZIKV African Lineage in Brazil: Is There a Risk of a New Epidemic? Int. J. Infect. Dis. 2020, 96, 579–581. [Google Scholar] [CrossRef] [PubMed]
- Smith, D.R.; Sprague, T.R.; Hollidge, B.S.; Valdez, S.M.; Padilla, S.L.; Bellanca, S.A.; Golden, J.W.; Coyne, S.R.; Kulesh, D.A.; Miller, L.J.; et al. African and Asian Zika Virus Isolates Display Phenotypic Differences Both in Vitro and in Vivo. Am. J. Trop. Med. Hyg. 2018, 98, 432–444. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Duggal, N.K.; Ritter, J.M.; McDonald, E.M.; Romo, H.; Guirakhoo, F.; Davis, B.S.; Chang, G.J.J.; Brault, A.C. Differential Neurovirulence of African and Asian Genotype Zika Virus Isolates in Outbred Immunocompetent Mice. Am. J. Trop. Med. Hyg. 2017, 97, 1410–1417. [Google Scholar] [CrossRef] [Green Version]
- Xia, H.; Luo, H.; Shan, C.; Muruato, A.E.; Nunes, B.T.D.; Medeiros, D.B.A.; Zou, J.; Xie, X.; Giraldo, M.I.; Vasconcelos, P.F.C.; et al. An Evolutionary NS1 Mutation Enhances Zika Virus Evasion of Host Interferon Induction. Nat. Commun. 2018, 9, 414. [Google Scholar] [CrossRef] [Green Version]
- Yuan, L.; Huang, X.Y.; Liu, Z.Y.; Zhang, F.; Zhu, X.L.; Yu, J.Y.; Ji, X.; Xu, Y.P.; Li, G.; Li, C.; et al. A Single Mutation in the PrM Protein of Zika Virus Contributes to Fetal Microcephaly. Science (1979) 2017, 358, 933–936. [Google Scholar] [CrossRef] [Green Version]
- Zhao, F.; Xu, Y.; Lavillette, D.; Zhong, J.; Zou, G.; Long, G. Negligible Contribution of M2634V Substitution to ZIKV Pathogenesis in AG6 Mice Revealed by a Bacterial Promoter Activity Reduced Infectious Clone. Sci. Rep. 2018, 8, 10491. [Google Scholar] [CrossRef] [Green Version]
- Jaeger, A.S.; Murrieta, R.A.; Goren, L.R.; Crooks, C.M.; Moriarty, R.V.; Weiler, A.M.; Rybarczyk, S.; Semler, M.R.; Huffman, C.; Mejia, A.; et al. Zika Viruses of African and Asian Lineages Cause Fetal Harm in a Mouse Model of Vertical Transmission. PLoS Negl. Trop. Dis. 2019, 13, e0007343. [Google Scholar] [CrossRef] [Green Version]
- Rossi, S.L.; Ebel, G.D.; Shan, C.; Shi, P.Y.; Vasilakis, N. Did Zika Virus Mutate to Cause Severe Outbreaks? Trends Microbiol. 2018, 26, 877–885. [Google Scholar] [CrossRef]
- Crooks, C.M.; Jaeger, A.S.; Weiler, A.M.; Rybarczyk, S.L.; Bliss, M.I.; Brown, E.A.; Simmons, H.A.; Hayes, J.M.; Mejia, A.; Yamamoto, K.; et al. African-Lineage Zika Virus Causes Placental Pathology in Pregnant Rhesus Macaques. Am. J. Trop. Med. Hyg. 2019, 101, 585. [Google Scholar]
Collection Date | Season | Number of Samples | |||||
---|---|---|---|---|---|---|---|
Studied through RT-PCR | RT-PCR Positive | Studied through ELISA | IgM Positive | IgM Positive, % (CI95%) | |||
2018 | May | Rainy season | 20 | 0 | 18 | 1 | 5.6 (0.1–27.3) |
2018 | August | Rainy season | 69 | 1 | 35 | 6 | 17.1 (6.6–33.6) |
2019 | February–March | Dry season | 30 | 0 | 30 | 5 | 16.7 (5.6–34.7) |
2021 | July | Rainy season | 33 | 0 | 33 | 5 | 15.2 (5.1–31.9) |
Total | 152 | 1 | 116 | 17 | 14.7 (8.8–22.4) |
GBank №/ Strain | Country | Date | Source | C-T106A | prM-V123A | prM-S139N | prM-E143K | E-V763M | NS1-A982V | NS5-M3392V |
---|---|---|---|---|---|---|---|---|---|---|
KU955594 | Uganda | April 1947 | M. mulatta | A | A | S | K | V | V | V |
KU963574 | Nigeria | 9 September 1968 | H. sapiens | A | A | S | K | V | V | V |
KF268950 | Central Afr. Republic | 1976 | Ae. africanus | A | A | S | K | V | V | V |
MF510857 | Senegal | 12 June 1984 | Ae. taylori | A | A | S | K | V | V | V |
MK241415 | Cape Verde | 3 December 2015 | H. sapiens | A | A | N | E | M | V | V |
Senegal 2011 | Senegal | 2011 | Mosquito pools | A | A | S | K | V | V | V |
Senegal 2015 | Senegal | 2015 | Mosquito pools | A | A | S | K | V | V | V |
MN025403 | Guinea | 29 August 2018 | H. sapiens | A | A | S | K | V | V | V |
KX377336 | Malaysia | April 1966 | Ae. aegypti | A | V | S | K | V | A | V |
MW015936 | Thailand | 11 August 2006 | H. sapiens | T | V | S | E | V | A | M |
KU955593 | Cambodia | 2010 | H. sapiens | T | V | S | E | V | A | M |
MG827392 | Fr. Polynesia | 25 October 2013 | H. sapiens | A | A | N | E | M | V | V |
MH013290 | Thailand | 1 October 2017 | H. sapiens | A | A | S | E | M | V | V |
OK054351 | India | 28 July 2021 | H. sapiens | A | V | S | E | V | I | V |
AMK49492 | Indonesia | 30 December 2014 | H. sapiens | T | A | S | E | M | V | V |
OK571913 | Haiti | 25 November 2014 | H. sapiens | A | A | N | E | M | V | V |
MN124090 | Panama | 11 December 2015 | H. sapiens | A | A | N | E | M | V | V |
MH882545 | Brasil | 19 May 2016 | H. sapiens | A | A | N | E | M | V | V |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bayandin, R.B.; Makenov, M.T.; Boumbaly, S.; Stukolova, O.A.; Gladysheva, A.V.; Shipovalov, A.V.; Skarnovich, M.O.; Camara, O.; Toure, A.H.; Svyatchenko, V.A.; et al. The First Case of Zika Virus Disease in Guinea: Description, Virus Isolation, Sequencing, and Seroprevalence in Local Population. Viruses 2023, 15, 1620. https://doi.org/10.3390/v15081620
Bayandin RB, Makenov MT, Boumbaly S, Stukolova OA, Gladysheva AV, Shipovalov AV, Skarnovich MO, Camara O, Toure AH, Svyatchenko VA, et al. The First Case of Zika Virus Disease in Guinea: Description, Virus Isolation, Sequencing, and Seroprevalence in Local Population. Viruses. 2023; 15(8):1620. https://doi.org/10.3390/v15081620
Chicago/Turabian StyleBayandin, Roman B., Marat T. Makenov, Sanaba Boumbaly, Olga A. Stukolova, Anastasia V. Gladysheva, Andrey V. Shipovalov, Maksim O. Skarnovich, Ousmane Camara, Aboubacar Hady Toure, Victor A. Svyatchenko, and et al. 2023. "The First Case of Zika Virus Disease in Guinea: Description, Virus Isolation, Sequencing, and Seroprevalence in Local Population" Viruses 15, no. 8: 1620. https://doi.org/10.3390/v15081620
APA StyleBayandin, R. B., Makenov, M. T., Boumbaly, S., Stukolova, O. A., Gladysheva, A. V., Shipovalov, A. V., Skarnovich, M. O., Camara, O., Toure, A. H., Svyatchenko, V. A., Shvalov, A. N., Ternovoi, V. A., Boiro, M. Y., Agafonov, A. P., & Karan, L. S. (2023). The First Case of Zika Virus Disease in Guinea: Description, Virus Isolation, Sequencing, and Seroprevalence in Local Population. Viruses, 15(8), 1620. https://doi.org/10.3390/v15081620