Next Article in Journal
Transcriptome Analysis of LLC-PK Cells Single or Coinfected with Porcine Epidemic Diarrhea Virus and Porcine Deltacoronavirus
Next Article in Special Issue
Development of Stable Infectious cDNA Clones of Tomato Black Ring Virus Tagged with Green Fluorescent Protein
Previous Article in Journal
CSF Extracellular Vesicle Aβ42 and Tau/Aβ42 Ratio Are Associated with Cognitive Impairment in Older People with HIV
Previous Article in Special Issue
Epidemiology and Diagnostics of Cacao Swollen Shoot Disease in Ghana: Past Research Achievements and Knowledge Gaps to Guide Future Research
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Viruses
Volume 16
Issue 1
10.3390/v16010073
viruses-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Antiviral Activity of Ailanthone from Ailanthus altissima on the Rice Stripe Virus

by
Qingwei Tan
1,2,*,
Jianxuan Zhu
1,
Yuanyuan Ju
1,
Xinlin Chi
1,
Tangdan Cao
1,
Luping Zheng
1,2 and
Qijian Chen
1,2,*
1
Key Laboratory of Biopesticide and Chemical Biology, Ministry of Education, Fujian Agriculture and Forestry University, Fuzhou 350002, China
2
Institute of Plant Virus Research, Fujian Agriculture and Forestry University, Fuzhou 350002, China
*
Authors to whom correspondence should be addressed.
Viruses 2024, 16(1), 73; https://doi.org/10.3390/v16010073
Submission received: 27 November 2023 / Revised: 24 December 2023 / Accepted: 29 December 2023 / Published: 31 December 2023
(This article belongs to the Special Issue Plant Virus Epidemiology and Control 2023)
Browse Figures
Versions Notes

Abstract

:
Rice stripe disease caused by the rice stripe virus (RSV), which infects many Poaceae species in nature, is one of the most devastating plant viruses in rice that causes enormous losses in production. Ailanthone is one of the typical C20 quassinoids synthesized by the secondary metabolism of Ailanthus altissima, which has been proven to be a biologically active natural product with promising prospects and great potential for use as a lead structure for pesticide development. Based on the achievement of the systemic infection and replication of RSV in Nicotiana benthamiana plants and rice protoplasts, the antiviral properties of Ailanthone were investigated by determining its effects on viral-coding RNA gene expression using reverse transcription polymerase chain reaction, and Western blot analysis. Ailanthone exhibited a dose-dependent inhibitory effect on RSV NSvc3 expression in the assay in both virus-infected tobacco plants and rice protoplasts. Further efforts revealed a potent inhibitory effect of Ailanthone on the expression of seven RSV protein-encoding genes, among which NS3, NSvc3, NS4, and NSvc4 are the most affected genes. These facts promoted an extended and greater depth of understanding of the antiviral nature of Ailanthone against plant viruses, in addition to the limited knowledge of its anti-tobacco mosaic virus properties. Moreover, the leaf disc method introduced and developed in the study for the detection of the antiviral activity of Ailanthone facilitates an available and convenient screening method for anti-RSV natural products or synthetic chemicals.

1. Introduction

Rice stripe virus (RSV), which causes rice stripe disease and results in enormous losses in production in eastern Asia, is a type of species in the genus Tenuivirus and is considered one of the most economically important virus pathogens of rice [1]. RSV infects many Poaceae species in nature, including several important crops such as rice (Oryza spp.), wheat (Triticum aestivum L.), barley (Hordeum vulgare L.), oat (Avena sativa L.), foxtail millet (Setaria italica L.), and sorghum (Sorghum bicolor L.) [2]. Moreover, RSV infects dicotyledonous Arabidopsis thaliana and Nicotiana benthamiana, which are widely used in the laboratory as model plants for virology studies [3,4,5]. In N. benthamiana, RSV can be transmitted from plant to plant by rub inoculation [6,7].
Effective management of plant virus disease has always been a problem and challenge in plant protection [8]. Due to the lack of highly effective antiviral agents, the use of insecticides against the small brown planthopper (SBPH), which is the main insect vector that transmits RSV, and the exploitation of genetically resistant cultivars are considered the most effective approaches at present to manage rice stripe disease [9,10]. Considering the great threat of plant virus diseases on crop production and the current deficiency in efficient control strategies, there is an urgent and sustained need to develop rapid, convenient, and effective models for screening antiviral agrochemical candidates. During the screening of antiviral natural products using the tobacco mosaic virus as the target pathogen, we reported the identification of quassinoids as major active antiviral structures from Ailanthus altissima [11]. In this study, we developed and conducted a series of antiviral assays based on the mechanical rubbing inoculation of RSV in N. benthamiana and polyethylene glycol-induced virus infection in rice protoplasts. We thus report herein the antiviral properties of Ailanthone, which is one of the typical quassinoids isolated from the MeOH extract of A. altissima.

2. Materials and Methods

2.1. Sources of Virus, Vectors, and Plant Materials

Rice stripe virus-infected rice plants were collected from Jiangsu Province in China. The virus was confirmed by using a Western blot assay and maintained by successive transovarial infections in the small brown planthopper (SBPH) on rice seedlings in an insect-rearing room at 25 °C and 16 h light and 8 h dark conditions, at the Institute of Plant Virus Research, Fujian Agriculture and Forestry University.
The virus particle was isolated and purified from the newly emerged leaves of RSV-infected rice that had obvious and typical symptoms such as chlorosis, stunting, necrosis, or other symptoms using a procedure described by Wang et al. [12]. The purified virus was characterized by 12% SDS-polyacrylamide gel electrophoresis, and its concentration was determined using the Bradford assay with bovine serum albumin as a standard. Purified RSV was stored at −80 °C and always diluted to the same concentration before use to maintain the equivalent inoculation quantity.
RSV infection was achieved through the mechanical rubbing of N. benthamiana plants, according to the method employed by Xu and Zhou [7]. In brief, N. benthamiana with 6−8 fully expanded true leaves were used for experiments, and three of the top fully expanded leaves were used for virus infection. RSV infection was achieved by rubbing N. benthamiana leaves with crude extracts from RSV-infected O. sativa leaves ground in 0.2 M phosphate buffer.
The candidate compound used in the study, Ailanthone, was previously purified from MeOH extracts of Ailanthus altissima in our laboratory.

2.2. Preparation of Rice Protoplasts and Virus Infection

Rice suspension cells were derived from germinal vesicles of Oryza sativa ssp. Japonica cv. Nipponbare, which was grown in N6 medium (pH 5.8) containing 2 mg/L 2,4-D and 0.4 g/L proline at 25 °C under rotation at 120 rpm. Protoplast isolation and virus inoculation were performed as described [13,14,15] with some modifications. The suspension cell was first digested with an enzyme mixture, and the undigested suspension cells were removed by a double filtration procedure with 100 µm and 40 µm nylon filters. The protoplasts were suspended in a washing solution (0.4 M mannitol, 6.8 mM CaCl2, pH 5.6), followed by centrifugation for 5 min at 100× g. The suspension–centrifugation cycle was repeated three times. The pelleted protoplasts were finally resuspended in protoplast suspension medium (0.4 M mannitol, 20 M CaCl2 2H2O, 5 mM Mes-KOH, pH 5.7) and counted in a hemocytometer to prepare a density of 3~4 × l06 protoplasts per ml. Then, 200 µL of protoplast solution was mixed with 1 µg RSV, and 220 µL of polyethylene glycol-CHS solution (0.4 M mannitol, 0.1 M CaCl2 2H2O, 40% polyethylene glycol 4000) was added to the protoplasts and incubated for 20 min at room temperature. Then, the sample was washed with 1 mL of W5 buffer three times. The virus-infected protoplasts were resuspended in 1 mL of WI buffer and incubated in the dark at 28 °C.

2.3. RNA Isolation, cDNA Synthesis, and Quantitative Real-Time RT-PCR Analysis

Total RNA was extracted using the Plant RNA kit (Omega Bio-Tek, Norcross, GA, USA). The optical density of the RNA extracts was determined using an ultraviolet spectrophotometer, and total RNA purity was estimated by calculating OD260/OD280, which remained within 1.8 and 2.2. The concentration of total RNA was calculated according to the dilution ratio and the value of OD260.
cDNAs were synthesized using a StarScript II First-Strand cDNA Synthesis Kit with gDNA Remover (GenStar, Beijing, China). PCR amplifications were carried out using a 2× Taq PCR StarMix with Loading Dye (GenStar) and run according to the program as described (a. 2 min at 94 °C; b. 30 s at 94 °C; c. 30 s at 55 °C; d. 1 min at 72 °C; e. Repeat steps b–d for optimized cycles ranging from 12 to 28; f. 8 min at 72 °C; g. Hold at 4 °C). The gene product was electrophorized in 1% agarose gel. RT-qPCR was carried out using a 2× RealStar Green Fast Mixture with ROX II (GenStar) and run according to the program as described (a. 2 min at 95 °C; b. 15 s at 95 °C; c. 25 s at 55 °C; d. 30 s at 72 °C; e. Repeat steps b–d for 40 cycles).
The specific primers to selected genes were designed using Primer 5.0 software, and the sequences of the primers used are shown in Table 1 and Table 2.

2.4. Sodium Dodecyl Sulfate−Polyacrylamide Gel Electrophoresis (SDS−PAGE) and Western Blot Analysis

RSV-infected protoplasts treated with different concentrations of Ailanthone were extracted for total proteins by using a BCA protein Assay Kit (GenStar), which was applied to the Western blot immunoassay after SDS−PAGE.
In brief, total proteins were separated by 12% SDS-PAGE and transferred to PVDF membranes. The membranes were blocked overnight at 4 °C and then inoculated with diluted anti-RSV CP-AP followed by FITC-conjugated goat anti-rabbit IgG. Signals were developed using the BCIP/NBT Alkaline Phosphatase Color Development kit (Biosharp, Beijing, China).

2.5. Curative, Protective, and Inactivating Activities of Ailanthone against the RSV Pathogenic Process in N. benthamiana

Ailanthone of a certain weight was dissolved in DMSO and then diluted with H2O to a final concentration as required in each test, and the amount of DMSO was no more than 0.5% in the final solution used in all of the tests. A solution containing the same amount of DMSO without Ailanthone was used as a control.
N. benthamiana leaves were sprayed with a solution of 0.5 µM Ailanthone twice every 24 h. Selected leaves were inoculated with RSV extract 24 h after the final application of the test solution. Four days after virus inoculation, the leaf samples were collected and used for RNA isolation and RT-PCR analysis to investigate the protective effect of Ailanthone against RSV infection and replication in the N. benthamiana plant.
Selected leaves of N. benthamiana plants were inoculated with RSV extract. A solution of 0.5 µM Ailanthone was applied to the plants by spraying at 12 h and 36 h after virus inoculation, respectively. Four days after Ailanthone application, leaf samples were collected and used for RNA isolation and RT-PCR analysis to detect the curative effect of Ailanthone against RSV infection and replication in the N. benthamiana plant.
A mixture of RSV extract and Ailanthone solution was used for virus inoculation. Four days later, leaf samples were collected and used for RNA isolation and RT-PCR analysis to determine the inactivating effect of Ailanthone against RSV infection and replication in the N. benthamiana plant.
Leaf samples were always collected from three of the top fully expanded leaves of N. benthamiana. Each test was repeated three times.

2.6. Dose-Dependent Inhibitory Effects of Ailanthone on RSV Replication in N. benthamiana

The leaf disc method was employed to test the antiviral activities of Ailanthone against RSV replication in N. benthamiana at a series of gradient concentrations of 0.125, 0.25, 0.5, 0.75, and 1 µM. The whole fully expanded N. benthamiana leaf was mechanically inoculated with RSV extract. After 48 h, leaf disks (1 cm in diameter) were punched. Six leaf disks were randomly selected, floated on the Ailanthone solution in a Petri dish, and placed in a climate chamber at 25 °C. Leaf disks which were treated with a solution of 0.5% DMSO were used as controls. After 48 h, the leaf disks were used for RNA isolation and further prepared for RT-PCR analysis. A commercial antiviral agent, ningnanmycin, was used as a control agent, and tested using the same method at concentrations of 90 and 180 µM, respectively.

2.7. Dose-Dependent Inhibitory Effects of Ailanthone on RSV Replication in Rice Protoplasts

To develop an antiviral screening model, we must ensure that the tested agents exhibit no toxicity to rice protoplasts. Cell viability tests were conducted using a 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyl tetrazolium bromide (MTT) colorimetric assay to determine the toxic effects of Ailanthone on rice protoplasts. An MTT Cell Proliferation and Cytotoxicity Assay Kit ((Solarbio, Beijing, China)) was used in the test. The isolated rice protoplasts were incubated in WI buffer containing Ailanthone of a series of gradient concentrations of 0.125, 0.25, 0.5, 0.75, and 1 µM, respectively. The isolated rice protoplasts incubated in WI buffer without Ailanthone were used as controls. After incubation for 48 h, the rice protoplasts were tested for cell viability, and the result indicated that Ailanthone under the test concentrations showed no toxicity to rice protoplasts.
Thus, Ailanthone was dissolved with DMSO and then added to WI buffer to obtain solutions containing Ailanthone with a series of gradient concentrations of 0.125, 0.25, 0.5, 0.75, and 1 µM. The virus-infected protoplasts were resuspended in the Ailanthone-containing WI buffer and incubated in the dark at 28 °C for 48 h. A WI buffer with the addition of the same amount of DMSO as that of the test solutions was used as a control. Each treatment was repeated three times. The protoplasts were then used for RNA isolation and RT-PCR. Ningnanmycin was used as a control agent and tested using the same method at concentrations of 90 and 180 µM, respectively.

3. Results

3.1. Effect of Ailanthone on RSV Multiplication in N. benthamiana

3.1.1. Dose-Dependent Inhibitory Activities of Ailanthone on RSV-CP Expression in N. benthamiana

The leaf disc method was employed to test the antiviral activities of Ailanthone against RSV at a series of gradient concentrations of 0.125, 0.25, 0.5, 0.75, and 1 µM. As shown in Figure 1, the relative expression quantities of RSV CP, which was representative of the RSV concentration in virus-infected N. benthamiana, were 0.54, 0.43, 0.20, 0.06, and 0.03, respectively. Ningnanmycin, a commercial antiviral agent, was applied and assayed using the same method as a control agent. The relative expression quantities of RSV CP are 0.42 and 0.17 when ningnanmycin was applied to virus-infected N. benthamiana at concentrations of 90 and 180 µM, respectively. The quantitative real-time polymerase chain reaction (RT-qPCR) results indicated that Ailanthone had a dose-dependent inhibitory effect against the NSvc3 (CP) expression of RSV in N. benthamiana.

3.1.2. Preventive, Inactivating, and Curative Effects against RSV Multiplication in N. benthamiana

A subsequent assay using the RSV-N. benthamiana system was designed to investigate whether Ailanthone could inhibit the virus pathogenic process at a specific stage, such as blocking the virus from infecting and entering the host plant, inactivating and weakening virus vitality, or restricting virus replication in plant cells. Ailanthone was applied to N. benthamiana together with pre- or post-virus inoculation, separately, to determine its inactivating, protective, or curative effect against RSV multiplication. Semi-quantitative RT-PCR detection of RSV-CP gene expression in N. benthamiana, as shown in Figure 2, indicated that 0.5 µM Ailanthone possessed a potent inhibitory effect against RSV in all three different application modes. The reference gene actin in both the control and treatment groups showed clearly visible bands starting from the same amplification cycle. The difference in RSV CP-specific amplification band abundance between the control and Ailanthone treatment groups indicated that RSV-CP gene expression was potently inhibited by Ailanthone at a concentration of 0.5 µM. Thus, the presented evidence showed that regardless of when it was applied (prior to or post virus infection), Ailanthone could always exhibit a potent interference or preventative effect against the pathogenic process of RSV, and thus reduce viral multiplication in RSV-infected N. benthamiana.

3.1.3. Effects of Ailanthone on Coding Gene Expression of RSV in N. benthamiana

The RSV genome consists of four RNAs and encodes seven proteins, namely RNA-dependent RNA polymerase (RdRp), NS2, NSvc2 (glycoprotein), NS3 (gene-silencing suppressor), NSvc3 (coat protein, CP), NS4 (disease-specific protein, SP), and NSvc4 (movement protein, MP) [16,17]. Specific primers were designed as shown in detail in Table 2, and RT-qPCR was carried out to detect the influence of Ailanthone on RSV protein-coding gene expression in virus infected N. benthamiana. The expression of RdRP, NS2, NSvc2, NS3, NS4, and NSvc4 in virus-infected N. benthamiana were all potently inhibited by 0.5 µM Ailanthone, and the relative expression quantities were 0.42, 0.63, 0.60, 0.09, 0.20, 0.16, and 0.15 (Figure 3), respectively. The results indicated that application of 0.5 µM Ailanthone could significantly inhibit the expression of seven protein-coding genes of RSV in N. benthamiana by different degrees.

3.2. Effect of Ailanthone on RSV Replication in Rice Protoplasts

3.2.1. Dose-Dependent Inhibitory Activities of Ailanthone against RSV Multiplication in Rice Protoplasts

Ailanthone of a series of gradient concentrations of 0.125, 0.25, 0.5, 0.75, and 1 µM was applied to RSV-infected rice protoplasts, and the RT-qPCR method was used to determine the relative expression of RSV CP. As shown in Figure 4, the relative expression quantities of RSV CP in rice protoplasts were 0.49, 0.18, 0.05, 0.01, and 0.003, respectively. The separate application of Ningnanmycin at concentrations of 90 and 180 µM also showed a potent inhibitory effect against CP expression, and the relative quantities are 0.28 and 0.07, respectively. The result revealed a dose-dependent inhibitory effect of Ailanthone against the virus multiplication of RSV in rice protoplasts.
Western blot analysis was employed to further investigate the dose-dependent inhibition of Ailanthone on RSV CP expression in rice protoplasts. The target protein, RSV CP, can be detected at around 35 KD. The intensity difference of the distinct and specific bands of RSV CP, as shown in Figure 5, further confirmed the dose-dependent inhibitory effect of Ailanthone on RSV CP expression in rice protoplasts.

3.2.2. Effects of Ailanthone on Coding Gene Expression of RSV in Rice Protoplasts

RT-qPCR was used to detect the influence of Ailanthone on the expression of seven protein-coding genes in RSV-infected rice protoplasts. The sequences of the specific primers used are shown in Table 2. Ailanthone at a concentration of 0.25 µM was applied to virus-infected rice protoplasts and incubated for 48 h, the relative expression quantities of RdRP, NS2, NSvc2, NS3, NS4, and NSvc4 were 0.43, 0.47, 0.49, 0.38, 0.20, 0.14, and 0.13 (Figure 6), respectively.

4. Discussion

Quassinoids are a diverse class of highly oxygenated secondary metabolites, identified from natural plant materials mostly in the Simaroubaceae family, which are believed to be biosynthesized through the triterpenoid biogenetic pathway and originating from the oxidative degradation of tetracyclic tirucallane triterpene [18,19,20]. We initiated a phytochemistry study on the samara of A. altissima and reported the identification of more than 70 natural products of diverse structures, including quassinoids, coumarins, flavonoids, lignans, phenylpropanoids, phenylpropionamides, piperidine, and phenolic derivatives, among which were a series of novel compounds including eleven quassinoid glycosides, two phenylpropionamides, one piperidine, one terpenylated coumarin, and two phenolic derivatives [11,21,22,23]. Antiviral screening using the tobacco mosaic virus (TMV)-tobacco plant system revealed that quassinoids were the major active component from A. altissima secondary metabolites. Among the identified quassinoids, ailanthone and chapparinone showed the best antiviral activity against TMV. Further evidence revealed by Western blot analysis and green fluorescent protein (GFP)-tagged tobacco mosaic virus-based assays proved that Ailanthone could inhibit TMV CP expression and systematic spread of viruses in tobacco [11]. The crude MeOH extract of A. altissima stem barks has been proven to possess potent inhibitory effects against RSV in rice suspension cells [24]. As a highly active component and typical quassinoid from A. altissima, Ailanthone was selected and used to investigate its antiviral effects against the rice stripe virus in the present study.
Rice stripe disease caused by the rice stripe virus is one of the most devastating plant diseases in rice, causing enormous losses in food production [25]. The re-emergence and outbreak of rice stripe disease in East Asia since 2000 have made RSV one of the most attractive focuses of research and attention. Extensive studies of RSV have resulted in substantial advances regarding fundamental aspects of the virus’s pathogenic process [26,27,28,29]. Screening of natural products derived from plant or microbial metabolites is still a promising strategy and approach for discovering lead compounds for the control of anti-plant virus diseases. The TMV-tobacco system is widely used for antiviral active natural product screening and has greatly driven the progression of the development of virus disease control agents [30,31,32,33,34].
Novel applicable methodology for the screening of antiviral agents is urgently needed to develop control methods for diverse, newly presented plant virus diseases. A new breakthrough in the development of screening methods for virus disease control agents is the report of the screening approach of anti-southern rice black-streaked dwarf virus agents based on S7-1 gene expression in rice suspension cells [35]. The cap-snatching inhibitor screening approach was recently realized and developed based on the findings that cucumber mosaic virus (CMV) RNAs can serve as cap donors for the initiation of RSV transcription [36,37].
In the present study, an applicable and convenient leaf disc method was developed based on the systemic infection of RSV in N. benthamiana, partially drawing on the experience of the frequently used leaf disc method in the screening of anti-TMV agents.
Ailanthone was proven to possess a dose-dependent influence upon RSV-CP expression in both virus-infected N. benthamiana and rice protoplasts (Figure 1 and Figure 4) as revealed by RT-qPCR analysis. When applied to virus-infected N. benthamiana at a concentration of 0.5 µM or to virus-infected rice protoplasts at a concentration of 0.25 µM, Ailanthone could inhibit the relative expression of RSV CP in host plant cells by more than 80% (Figure 1 and Figure 4). The dose-dependent inhibitory effect on RSV CP accumulation in RSV-infected rice protoplasts was further detected by Western blotting (Figure 5). Whether it was applied before or after virus inoculation, Ailanthone could exhibit significant inhibition on the RSV replication in host N. benthamiana (Figure 2). The above evidence obtained under laboratory conditions proved that Ailanthone deserves further study as an agent candidate or lead structure for the development of a control agent for plant virus diseases caused by RSV.
The negative/ambisense RNA genome of RSV consists of four single-stranded RNA segments [38]. The largest segment, RNA1, has a negative-sense polarity and encodes RNA-dependent RNA polymerase (RdRp). The RSV segments RNA2, RNA3, and RNA4 are ambisense and each encodes two open reading frames (ORFs) in opposite orientations on the viral RNA (vRNA) and viral complementary RNA (vcRNA) [1]. The NS3 protein of RSV, encoded by the viral strand of RNA3, is a viral suppressor of RNA silencing (VSR). NS3 plays a significant role in viral infection and NS3-transgenic plants manifest resistance to the virus [39]. Coat protein (NSvc3) of the rice stripe virus plays important roles in several biological processes, such as viral transcription and replication. It has been shown that overexpression of RSV CP in rice plants enhances resistance against virus infection [9]. During viral infection, the nonstructural protein NS4 of RSV formed cytoplasmic inclusions in various tissues of viruliferous SBPH and played a critical role in viral spread through insect vectors [40]. NSvc4 belongs to the virus movement protein “30 K” superfamily and is responsible for virus movement. It has the ability to localize to the plasmodesmata and is capable of complementing the cell-to-cell movement of movement-deficient potato virus X (PVX) [41].
Specific primers were designed and RT-qPCR was carried out to detect the influence of Ailanthone on RSV protein-coding gene expression in virus-infected N. benthamiana and rice protoplasts. When 0.5 µM Ailanthone was applied to virus-inoculated N. benthamiana or 0.25 µM Ailanthone was applied to virus-infected rice protoplasts, the expressions of seven RSV protein-coding genes were all significantly inhibited by different degrees (Figure 3 and Figure 6). Among them, the expressions of NS3, NSvc3, NS4, and NSvc4 were affected relatively more than the other three genes in general, which indicates a relatively greater inhibitory effect of Ailanthone on the accumulation of RNA3 and RNA4 segments than that of RNA1 and RNA2 in virus-infected N. benthamiana and rice protoplasts. The results indicated a significant inhibitory effect of Ailanthone on the accumulation of RSV RNAs and encoding gene expression that were closely related to virus infection, replication, and spread.

5. Conclusions

Ailanthone, one of the typical C20 quassinoids isolated from A. altissima, was proven to possess a significant inhibitory effect against RSV multiplication in both the N. benthamiana plant and rice protoplasts by means of the detection of its influence on coding gene expression and the accumulation of RSV protein using RT-PCR and Western blot analysis. The significant and highly efficient inhibitory effect on RSV replication in the host plant indicated that Ailanthone deserves to be further studied as a candidate or a valuable lead structure for the development of an agent for the control of plant virus diseases caused by RSV.

Author Contributions

Conceptualization, Q.C. and Q.T.; methodology, Q.C.; software, J.Z.; validation, Q.T.; formal analysis, Q.T.; investigation, Q.T., J.Z., Y.J., T.C. and X.C.; resources, Q.C.; data curation, Q.T.; writing—original draft preparation, Q.T.; writing—review and editing, Q.T., J.Z., L.Z. and Q.C.; visualization, L.Z.; supervision, Q.C.; project administration, Q.C. and Q.T.; funding acquisition, Q.C. and Q.T. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (grant number 31972317), the Provincial Natural Science Foundation of Fujian (grant number 2021J01067), and The Foundation of The Engineering Technology Research Center of Characteristic Medicinal Plants of Fujian, Ningde Normal University (grant number PP202103).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All the data used in this study are already provided in the manuscript in the required section. There are no underlying data available.

Acknowledgments

We thank Zhenguo Du (Institute of Plant Virus Research, Fujian Agriculture and Forestry University, China) for providing the RSV isolate and the crude and purified viruses, and for assistance in RSV inoculation.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Xu, Y.; Fu, S.; Tao, X.; Zhou, X. Rice stripe virus: Exploring molecular weapons in the arsenal of a negative-sense RNA virus. Annu. Rev. Phytopathol. 2021, 59, 351–371. [Google Scholar] [CrossRef] [PubMed]
  2. Hibino, H. Biology and epidemiology of rice viruses. Annu. Rev. Phytopathol. 1996, 34, 249–274. [Google Scholar] [CrossRef] [PubMed]
  3. Sun, F.; Yuan, X.; Zhou, T.; Fan, Y.; Zhou, Y. Arabidopsis is susceptible to Rice stripe virus infections. J. Phytopathol. 2011, 159, 767–772. [Google Scholar] [CrossRef]
  4. Xiong, R.; Wu, J.; Zhou, Y.; Zhou, X. Characterization and subcellular localization of an RNA silencing suppressor encoded by rice stripe tenuivirus. Virology 2009, 387, 29–40. [Google Scholar] [CrossRef] [PubMed]
  5. Xu, Y.; Huang, L.; Fu, S.; Wu, J.; Zhou, X. Population diversity of Rice stripe virus-derived siRNAs in three different hosts and RNAi-based antiviral immunity in Laodelphgax striatellus. PLoS ONE 2012, 7, e46238. [Google Scholar] [CrossRef]
  6. Lu, L.; Wu, S.; Jiang, J.; Liang, J.; Zhou, X.; Wu, J. Whole genome deep sequencing revealed host impact on population structure, variation and evolution of Rice stripe virus. Virology 2018, 524, 32–44. [Google Scholar] [CrossRef]
  7. Xu, Y.; Zhou, X. Role of Rice stripe virus NSvc4 in cell-to-cell movement and symptom development in Nicotiana benthamiana. Front. Plant Sci. 2012, 3, 269. [Google Scholar] [CrossRef]
  8. Zhang, J.; He, F.; Chen, J.; Wang, Y.; Yang, Y.; Hu, D.; Song, B. Purine nucleoside derivatives containing a sulfa ethylamine moiety: Design, synthesis, antiviral activity, and mechanism. J. Agri. Food Chem. 2021, 69, 5575–5582. [Google Scholar] [CrossRef]
  9. Sun, F.; Hu, P.; Wang, W.; Lan, Y.; Du, L.; Zhou, Y.; Zhou, T. Rice stripe virus coat protein-mediated virus resistance is associated with RNA silencing in Arabidopsis. Front. Microbiol. 2020, 11, 591619. [Google Scholar] [CrossRef]
  10. Otuka, A. Migration of rice planthoppers and their vectored reemerging and novel rice viruses in East Asia. Front. Microbiol. 2013, 4, 309. [Google Scholar] [CrossRef]
  11. Tan, Q.W.; Ni, J.C.; Zheng, L.P.; Fang, P.H.; Shi, J.T.; Chen, Q.J. Anti-Tobacco mosaic virus quassinoids from Ailanthus altissima (Mill.) Swingle. J. Agric. Food Chem. 2018, 66, 7347–7357. [Google Scholar] [CrossRef] [PubMed]
  12. Wang, Q.; Liu, Y.; He, J.; Zheng, X.; Hu, J.; Liu, Y.; Dai, H.; Zhang, Y.; Wang, B.; Wu, W.; et al. Stv11 encodes a sulphotransferase and confers durable resistance to Rice stripe virus. Nat. Commun. 2014, 5, 4768. [Google Scholar] [CrossRef] [PubMed]
  13. Yang, W.; Wang, X.; Wang, S.; Yie, Y.; Tien, P. Infection and replication of a planthopper transmitted virus-Rice stripe virus in rice protoplasts. J. Virol. Methods 1996, 59, 57. [Google Scholar] [CrossRef] [PubMed]
  14. Zhang, Y.; Su, J.; Duan, S.; Ao, Y.; Dai, J.; Liu, J.; Wang, P.; Li, Y.; Liu, B.; Feng, D.; et al. A highly efficient rice green tissue protoplast system for transient gene expression and studying light/chloroplast-related processes. Plant Methods 2011, 30, 30. [Google Scholar] [CrossRef]
  15. Yamaji, Y.; Maejima, K.; Ozeki, J.; Komatsu, K.; Shiraishi, T.; Okano, Y.; Himeno, M.; Sugawara, K.; Neriya, Y.; Minato, N.; et al. Lectin-mediated resistance impairs plant virus infection at the cellular level. Plant Cell 2012, 24, 778–793. [Google Scholar] [CrossRef] [PubMed]
  16. Li, Z.; Li, C.; Fu, S.; Liu, Y.; Xu, Y.; Wu, J.; Wang, Y.; Zhou, X. NSvc4 encoded by Rice stripe virus targets host chloroplasts to suppress chloroplast-mediated defense. Viruses 2022, 14, 36. [Google Scholar] [CrossRef] [PubMed]
  17. Kong, L.; Wu, J.; Lu, L.; Xu, Y.; Zhou, X. Interaction between Rice stripe virus disease-specific protein and host PsbP enhance virus symptoms. Mol. Plant. 2014, 7, 691–708. [Google Scholar] [CrossRef]
  18. Fiaschetti, G.; Grotzer, M.A.; Shalaby, T.; Castelletti, D.; Arcaro, A. Quassinoids: From traditional drugs to new cancer therapeutics. Curr. Med. Chem. 2011, 18, 316–328. [Google Scholar] [CrossRef]
  19. Guo, Z.; Vangapandu, S.; Sindelar, R.W.; Walker, L.A.; Sindelar, R.D. Biologically active quassinoids and their chemistry: Potential leads for drug design. Curr. Med. Chem. 2005, 12, 173–190. [Google Scholar] [CrossRef]
  20. Hoüel, E.; Stien, D.; Bourdy, G.; Deharo, E. Quassinoids: Anticancer and antimalarial activities. In Natural Products: Phytochemistry, Botany and Metabolism of Alkaloids, Phenolics and Terpenes.; Ramawat, K.G., Mérillon, J.M., Eds.; Springer: Berlin/Heidelberg, Germany, 2013; pp. 3775–3802. [Google Scholar]
  21. Tan, Q.W.; Ni, J.C.; Shi, J.T.; Zhu, J.X.; Chen, Q.J. Two novel quassinoid glycosides with antiviral activity from the samara of Ailanthus altissima. Molecules 2020, 25, 5679. [Google Scholar] [CrossRef]
  22. Ni, J.C.; Shi, J.C.; Tan, Q.W.; Chen, Q.J. Two new compounds from the samara of Ailanthus altissima. Nat. Prod. Res. 2019, 33, 101–107. [Google Scholar] [CrossRef] [PubMed]
  23. Ni, J.C.; Shi, J.T.; Tan, Q.W.; Chen, Q.J. Phenylpropionamides, piperidine, and phenolic derivatives from the samara of Ailanthus altissima. Molecules 2017, 22, 2107. [Google Scholar] [CrossRef] [PubMed]
  24. Yang, J.G.; Dang, Y.G.; Li, G.Y.; Guo, L.J.; Wang, W.T.; Tan, Q.W.; Lin, Q.Y.; Wu, Z.J.; Xie, L.H. Note: Anti-viral activity of Ailanthus altissima crude extract on Rice stripe virus in rice suspension cells. Phytoparasitica 2008, 36, 405–408. [Google Scholar] [CrossRef]
  25. Muthayya, S.; Sugimoto, J.D.; Montgomery, S.; Maberly, G.F. An overview of global rice production, supply, trade, and consumption. Ann. N. Y. Acad. Sci. 2014, 1324, 7–14. [Google Scholar] [CrossRef] [PubMed]
  26. Zhou, T.; Fan, Y.; Cheng, Z.; Zhou, Y. Studies on the methodology for resistance identification of rice cultivar to the rice stripe disease. Plant Prot. 2008, 34, 77–80. [Google Scholar]
  27. Zhao, W.; Wang, Q.; Xu, Z.; Liu, R.; Cui, F. Immune responses induced by different genotypes of the disease-specific protein of Rice stripe virus in the vector insect. Virology 2019, 527, 122–131. [Google Scholar] [CrossRef]
  28. Zhao, W.; Xu, Z.; Zhang, X.; Yang, M.; Kang, L.; Liu, R.; Cui, F. Genomic variations in the 3′-termini of Rice stripe virus in the rotation between vector insect and host plant. New Phytol. 2018, 219, 1085–1096. [Google Scholar] [CrossRef]
  29. Zhang, H.; Li, L.; He, Y.; Qin, Q.; Chen, C.; Wei, Z.; Tan, X.; Xie, K.; Zhang, R.; Hong, G. Distinct modes of manipulation of rice auxin response factor OsARF17 by different plant RNA viruses for infection. Proc. Natl. Acad. Sci. USA 2020, 117, 9112–9121. [Google Scholar] [CrossRef]
  30. Dai, J.M.; Mi, Q.L.; Li, X.M.; Gang, D.; Yang, G.Y.; Zhang, J.D.; Wang, J.; Li, Y.K.; Yang, H.Y.; Miao, D.; et al. The anti-TMV potency of the tobacco-derived fungus Aspergillus versicolor and its active alkaloids, as anti-TMV activity inhibitors. Phytochemistry 2023, 205, 113485. [Google Scholar] [CrossRef]
  31. Yan, Y.; Tang, P.; Zhang, X.; Wang, D.; Peng, M.; Yan, X.; Hu, Z.; Tang, L.; Hao, X. Anti-TMV effects of seco-pregnane C21 steroidal glycosides isolated from the roots of Cynanchum paniculatum. Fitoterapia 2022, 161, 105225. [Google Scholar] [CrossRef]
  32. Xu, W.T.; Tian, H.; Song, H.; Liu, Y.; Li, Y.; Wang, Q. Route development, antiviral studies, field evaluation and toxicity of an antiviral plant protectant NK0238. Front. Agric. Sci. Eng. 2022, 9, 110–119. [Google Scholar] [CrossRef]
  33. Li, Z.; Yang, B.; Ding, Y.; Zhou, X.; Fang, Z.; Liu, S.S.; Yang, J.; Yang, S. Discovery of phosphonate derivatives containing different substituted 1,2,3-triazole motif as promising tobacco mosaic virus (TMV) helicase inhibitors for controlling plant viral diseases. Pest Manag. Sci. 2023, 79, 3979–3992. [Google Scholar] [CrossRef] [PubMed]
  34. Xu, W.; Yang, R.; Hao, Y. Discovery of aldisine and its derivatives as novel antiviral, larvicidal, and antiphytopathogenic-fungus agents. J. Agric. Food Chem. 2022, 70, 12355–12363. [Google Scholar] [CrossRef] [PubMed]
  35. Yu, D.; Wang, Z.; Liu, J.; Lv, M.; Liu, J.; Li, X.; Chen, Z.; Jin, L.; Hu, D.; Yang, S.; et al. Screening anti-southern rice black-streaked dwarf virus drugs based on S7-1 gene expression in rice suspension cells. J. Agric. Food Chem. 2013, 61, 8049–8055. [Google Scholar] [CrossRef] [PubMed]
  36. Lin, W.; Zha, Q.; Zhang, W.; Wu, G.; Yan, F.; Wu, Z.; Du, Z. Cap-snatching inhibitors of influenza virus are inhibitory to the in vitro transcription of Rice stripe virus. Phytopath. Res. 2022, 4, 36. [Google Scholar] [CrossRef]
  37. Yao, M.; Zhang, T.; Zhou, T.; Zhou, Y.; Zhou, X.; Tao, X. Repetitive prime-and-realign mechanism converts short capped RNA leaders into longer ones that may be more suitable for elongation during Rice stripe virus transcription initiation. J. Gen. Virol. 2012, 93, 194–202. [Google Scholar] [CrossRef] [PubMed]
  38. Lefkowitz, E.J.; Dempsey, D.M.; Hendrickson, R.C.; Orton, R.J.; Siddell, S.G.; Smith, D.B. Virus taxonomy: The database of the International Committee on Taxonomy of Viruses (ICTV). Nucleic. Acids Res. 2018, 46, D708–D717. [Google Scholar] [CrossRef]
  39. Wu, G.; Zheng, G.; Hu, Q.; Ma, M.; Li, M.; Sun, X.; Yan, F.; Qing, L. NS3 Protein from Rice stripe virus affects the expression of endogenous genes in Nicotiana benthamiana. Virol. J. 2018, 15, 105. [Google Scholar] [CrossRef]
  40. Wu, W.; Zheng, L.; Chen, H.; Jia, D.; Li, F.; Wei, T. Nonstructural protein NS4 of Rice stripe virus plays a critical role in viral spread in the body of vector insects. PLoS ONE 2014, 9, e88636. [Google Scholar] [CrossRef]
  41. Xiong, R.Y.; Wu, J.X.; Zhou, Y.J.; Zhou, X.P. Identification of a movement protein of the Tenuivirus rice virus. J. Virol. 2008, 82, 12304–12311. [Google Scholar] [CrossRef]
Viruses 16 00073 g001
Figure 1. Dose-dependent inhibitory effect of Ailanthone on RSV CP expression in N. benthamiana. The data were from three independent experiments and the error bar represents ±SD.
Figure 1. Dose-dependent inhibitory effect of Ailanthone on RSV CP expression in N. benthamiana. The data were from three independent experiments and the error bar represents ±SD.
Viruses 16 00073 g001
Viruses 16 00073 g002
Figure 2. Semi-quantitative RT-PCR detection of RSV-CP gene expression in rice stripe virus-infected N. benthamiana treated with Ailanthone using different application methods. Ailanthone at a concentration of 0.5 µM was applied to N. benthamiana together with (a), pre- (b) or post-virus inoculation (c), and leaf samples were collected 4 d after the final treatment and used for RNA isolation and RT-PCR analysis.
Figure 2. Semi-quantitative RT-PCR detection of RSV-CP gene expression in rice stripe virus-infected N. benthamiana treated with Ailanthone using different application methods. Ailanthone at a concentration of 0.5 µM was applied to N. benthamiana together with (a), pre- (b) or post-virus inoculation (c), and leaf samples were collected 4 d after the final treatment and used for RNA isolation and RT-PCR analysis.
Viruses 16 00073 g002
Viruses 16 00073 g003
Figure 3. Effects of Ailanthone on RSV protein-coding gene expression in N. benthamiana. The data were from three independent experiments and the the error bar represents ±SD.
Figure 3. Effects of Ailanthone on RSV protein-coding gene expression in N. benthamiana. The data were from three independent experiments and the the error bar represents ±SD.
Viruses 16 00073 g003
Viruses 16 00073 g004
Figure 4. Dose-dependent inhibitory effects of Ailanthone on RSV CP expression in rice protoplasts. The data were from three independent experiments and the error bar represents ±SD.
Figure 4. Dose-dependent inhibitory effects of Ailanthone on RSV CP expression in rice protoplasts. The data were from three independent experiments and the error bar represents ±SD.
Viruses 16 00073 g004
Viruses 16 00073 g005
Figure 5. Western blotting of RSV CP in virus-infected rice protoplasts. Lane 1, protein marker; lane 2, rice protoplasts without RSV inoculation as a mock; lane 3, blot of RSV CP in rice protoplasts 48 h post-RSV inoculation as a control; lanes 4 to 8, blots of RSV CP in rice protoplasts 48 h post-RSV inoculation. The rice protoplasts were incubated with 0.0625, 0.125, 0.25, 0.5, and 0.75 µM of Ailanthone. The extracted rice protoplast protein was used as a loading control, which was separated by SDS-PAGE and stained with Coomassie Brilliant Blue as shown below the Western blots.
Figure 5. Western blotting of RSV CP in virus-infected rice protoplasts. Lane 1, protein marker; lane 2, rice protoplasts without RSV inoculation as a mock; lane 3, blot of RSV CP in rice protoplasts 48 h post-RSV inoculation as a control; lanes 4 to 8, blots of RSV CP in rice protoplasts 48 h post-RSV inoculation. The rice protoplasts were incubated with 0.0625, 0.125, 0.25, 0.5, and 0.75 µM of Ailanthone. The extracted rice protoplast protein was used as a loading control, which was separated by SDS-PAGE and stained with Coomassie Brilliant Blue as shown below the Western blots.
Viruses 16 00073 g005
Viruses 16 00073 g006
Figure 6. Effects of Ailanthone on RSV gene expression in rice protoplasts. The data were from three independent experiments and the error bar represents ±SD.
Figure 6. Effects of Ailanthone on RSV gene expression in rice protoplasts. The data were from three independent experiments and the error bar represents ±SD.
Viruses 16 00073 g006
Table 1. Primers for NSvc3 in RSV and reference genes used in semi-quantitative RT-PCR.
Table 1. Primers for NSvc3 in RSV and reference genes used in semi-quantitative RT-PCR.
GeneForward Primer 5′−3′Reverse Primer 5′−3′Length (bp)
NSvc3 (CP)GCAGGCTATGATGCTGCAACTTGTCAGACCACGCTCCTTC510
Actin (N. benthamiana)ACTGATGAAGATACTCACAGATGGAATTGTATGTGGTTTCAT236
Table 2. Primers for selected genes in RSV and reference genes used in quantitative real-time RT-PCR.
Table 2. Primers for selected genes in RSV and reference genes used in quantitative real-time RT-PCR.
GeneForward Primer 5′−3′Reverse Primer 5′−3′Length (bp)
RdRpCAGTGAAGTGGAGGCTGCTAGCAAGTCTGTGGCTCTCAA166
NS2TGGGATGCTGTGAGGAGTTCAGGATCAGTTTCAGATGCTCAGT174
NSvc2GAGAGGGATGGAGTGGACATTGAGGTCCCATTGAGGGATA180
NS3TTCACATCGTCTGTGGGTTCTGGAAGGGTGCCTAGATGAATG163
NSvc3 (CP)TGCAGAAGGCAATCAATGACATTGTCACCACCTTTGTCCTCAA150
NS4 (SP)CCTGTTAGGAGGTGAAGATGATGAGCTCTCAGCCTTAGCCATCTTG180
NSvc4 (MP)TGAAGGCCCATAGGAAAGCATGCGGAGGGTAGTTATTCCAC153
18S rRNA
(Nipponbare)		ATGATAACTCGACGGATCGCCTTGGATGTGGTAGCCGTTT169
Actin
(N. benthamiana)		TGTGCTCAGTGGTGGCTCTAGGTGCTGAGAGAAGCCAAGATA163
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Tan, Q.; Zhu, J.; Ju, Y.; Chi, X.; Cao, T.; Zheng, L.; Chen, Q. Antiviral Activity of Ailanthone from Ailanthus altissima on the Rice Stripe Virus. Viruses 2024, 16, 73. https://doi.org/10.3390/v16010073

AMA Style

Tan Q, Zhu J, Ju Y, Chi X, Cao T, Zheng L, Chen Q. Antiviral Activity of Ailanthone from Ailanthus altissima on the Rice Stripe Virus. Viruses. 2024; 16(1):73. https://doi.org/10.3390/v16010073

Chicago/Turabian Style

Tan, Qingwei, Jianxuan Zhu, Yuanyuan Ju, Xinlin Chi, Tangdan Cao, Luping Zheng, and Qijian Chen. 2024. "Antiviral Activity of Ailanthone from Ailanthus altissima on the Rice Stripe Virus" Viruses 16, no. 1: 73. https://doi.org/10.3390/v16010073

APA Style

Tan, Q., Zhu, J., Ju, Y., Chi, X., Cao, T., Zheng, L., & Chen, Q. (2024). Antiviral Activity of Ailanthone from Ailanthus altissima on the Rice Stripe Virus. Viruses, 16(1), 73. https://doi.org/10.3390/v16010073

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop