Next Article in Journal
Transcriptional Modulation of Plant Defense Genes by a Bipartite Begomovirus Promotes the Performance of Its Whitefly Vector
Previous Article in Journal
Hepatitis A, B, and C in Brazilian Afro-Descendant Communities from Northeast Brazil: A Seroepidemiological Survey
Previous Article in Special Issue
Clinical Evaluation of the VirClia IgM/IgG Chemiluminescence Tests for the Diagnosis of Tick-Borne Encephalitis in an Endemic Part of Norway
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Viruses
Volume 16
Issue 11
10.3390/v16111653
viruses-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Analysis of Powassan Virus Genome Sequences from Human Cases Reveals Substantial Genetic Diversity with Implications for Molecular Assay Development

by
Erik H. Klontz
1,
Navid Chowdhury
1,
Nolan Holbrook
1,
Isaac H. Solomon
2,
Sam R. Telford 3rd
3,
Matthew T. Aliota
4,
Chantal B. F. Vogels
5,
Nathan D. Grubaugh
5,
Jeffrey Helgager
6,
Holly R. Hughes
7,
Jason Velez
7,
Anne Piantadosi
8,
Charles Y. Chiu
9,
Jacob Lemieux
10 and
John A. Branda
1,*
1
Department of Pathology, Massachusetts General Hospital and Harvard Medical School, Boston, MA 02114, USA
2
Department of Pathology, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115, USA
3
Department of Infectious Disease and Global Health, Tufts University, North Grafton, MA 02155, USA
4
Department of Veterinary and Biomedical Sciences, University of Minnesota, Twin Cities, St. Paul, MN 55455, USA
5
Department of Epidemiology of Microbial Diseases, Yale School of Public Health, New Haven, CT 06510, USA
6
Department of Pathology and Laboratory Medicine, School of Medicine and Public Health, University of Wisconsin, Madison, WI 53726, USA
7
Centers for Disease Control and Prevention, Fort Collins, CO 80521, USA
8
Department of Pathology and Laboratory Medicine, School of Medicine, Emory University, Atlanta, GA 30322, USA
9
Department of Laboratory Medicine, University of California San Francisco, San Francisco, CA 94115, USA
10
Department of Medicine, Massachusetts General Hospital and Harvard Medical School, Boston, MA 02114, USA
*
Author to whom correspondence should be addressed.
Viruses 2024, 16(11), 1653; https://doi.org/10.3390/v16111653
Submission received: 24 August 2024 / Revised: 24 September 2024 / Accepted: 15 October 2024 / Published: 23 October 2024
(This article belongs to the Special Issue Tick-Borne Viruses: Transmission and Surveillance)
Browse Figures
Versions Notes

Abstract

:
Powassan virus (POWV) is an emerging tick-borne virus that causes severe meningoencephalitis in the United States, Canada, and Russia. Serology is generally the preferred diagnostic modality, but PCR on cerebrospinal fluid, blood, or urine has an important role, particularly in immunocompromised patients who are unable to mount a serologic response. Although the perceived poor sensitivity of PCR in the general population may be due to the biology of infection and health-seeking behavior (with short viremic periods that end before hospital presentation), limitations in assay design may also contribute. Genome sequences from clinical POWV cases are extremely scarce; PCR assay design has been informed by those available, but the numbers are limited. Larger numbers of genome sequences from tick-derived POWV are available, but it is not known if POWV genomes from human infections broadly mirror genomes from tick hosts, or if human infections are caused by a subset of more virulent strains. We obtained viral genomic data from 10 previously unpublished POWV human infections and showed that they broadly mirror the diversity of genome sequences seen in ticks, including all three major clades (lineage I, lineage II Northeast, and lineage II Midwest). These newly published clinical POWV genome sequences include the first confirmed lineage I infection in the United States, highlighting the relevance of all clades in human disease. An in silico analysis of published POWV PCR assays shows that many assays were optimized against a single clade and have mismatches that may affect their sensitivity when applied across clades. This analysis serves as a launching point for improved PCR design for clinical diagnostics and environmental surveillance.

1. Introduction

Powassan virus (POWV) is an emerging tick-borne flavivirus that is capable of causing severe meningoencephalitis, leading to death in approximately 10% of diagnosed individuals, and long-term neurological sequela in one third of survivors [1]. POWV has long been considered a rare cause of encephalitis, with approximately one case reported per year from 1958 to 2005 [2]. However, the last several years have seen a proliferation of cases, with 211 cases reported in the United States from 2016 to 2022 [3]. The increase in reported cases could be due to increases in infections and/or improved surveillance, but the true incidence is likely still higher, owing primarily to the challenges in making a diagnosis. In the United States, the preferred method in immunocompetent patients is IgM serology with confirmatory plaque reduction neutralization testing. However, this testing is only available in the United States through the CDC and select state/commercial reference laboratories [4]. Real-time reverse transcription-PCR (RT-PCR) from cerebrospinal fluid, blood, or urine is similarly available through select laboratories but is thought to be less sensitive than serology, except in immunocompromised hosts [5,6]. The perceived insensitivity of PCR is due, in part, to the short viremic period in related arboviruses [6]. However, it is not known if the insensitivity of PCR may be influenced by the use of assays that are not optimized to detect the full diversity of POWV genomes, given that many assays were designed before large numbers of POWV genome sequences became available. Recently, diagnoses have also been made through CSF metagenomic next generation sequencing (mNGS), highlighting the usefulness of molecular tests in some patients [7,8,9,10].
Powassan virus has two distinct phylogenetic lineages that are serologically indistinguishable but are spread by different vectors. Lineage I (the prototypical lineage) is spread primarily by Ixodes cookei and Ixodes marxi ticks; lineage II, also named Deer Tick Virus (DTV) is spread by Ixodes scapularis ticks, and can be separated into northeastern and midwestern clades [1]. Both lineages are maintained by distinct enzootic cycles involving small mammals, with humans incidentally infected as dead-end hosts [1]. Hundreds of POWV genome sequences have been determined from ticks, and large phylogenetic studies from ticks have been recently published [11,12]. However, POWV genome sequences from humans are extremely scarce [8,13,14,15,16,17], and it is unknown if human infections are caused by select highly virulent strains, or if they mirror the diversity of strains seen in ticks.
Understanding the genomic diversity of human POWV infections has important implications on the design of sensitive RT-PCR assays. Until now, published POWV genome sequences from human infections in the United States have been exclusively lineage II, with at least nine confirmed cases described [8,13,16,18,19,20,21] and complete or nearly complete genome sequences published for four [8,13]. Lineage I genomes have been detected from humans in Canada and Russia, with sequences published for five [14,15]. Here, we report genome sequences from 10 new human POWV infections, including the first published human lineage I infection in the United States, and demonstrate that they represent the diversity of genomes seen in ticks. An in silico analysis of published RT-PCR assays suggests that many assays were designed against a single lineage or sub-lineage and have mismatches that may limit their sensitivity if applied across sub-lineages.

2. Methods

Sequencing and genome assembly. Sequencing and genome assembly were performed at multiple institutions according to researchers’ local preferences. Seven samples (OR130288-OR130294) were sequenced directly from patient CSF using a previously described clinically validated pipeline [22]. Raw mNGS data were aligned to POWV reference genomes (MZ576219.1 for lineage II and MF374486.1 for lineage I) using viral-ngs 2.1.28 hosted on the Terra platform (app.terra.bio). Samples OR130295 and OR130296 were sequenced from patient formalin-fixed paraffin-embedded brain tissue [13,23]: RNA was extracted using the E.Z.N.A FFPE Kit (Omega, Norcross, GA, USA), DNase treated (ArcticZymes, Tromsø, Norway), and converted to cDNA using the SuperScript IV First-Strand Synthesis System (Thermo Fisher Scientific/Invitrogen, Waltham, MA, USA) and New England Biolabs (Ipswich, MA, USA) reagents for second-strand synthesis. Sequencing libraries were fragmented and indexed using the Nextera XT DNA Library Prep kit (Illumina, San Diego, CA, USA) with dual indexes and 16 cycles of PCR. Libraries were quantified using the KAPA Universal Complete Kit (Roche Diagnostics, Indianapolis, IN, USA), pooled to equimolar concentration, and sequenced on an Illumina instrument with paired-end 150–base pair reads. Sample OL695841 was sequenced from BHK-1 cells after one passage from CSF, as previously described [12].
Phylogenetic tree construction. GenBank was queried on 5/8/23 for “Powassan” and all POWV genome sequences between the lengths 8000 and 12,000 nucleotides were downloaded and limited to one genome per patient where duplicates existed. In total, 407 genome sequences were aligned using MAFFT FFT-NS-2 [24]. A maximum likelihood tree was generated with IQ-tree [25] and bootstrap node support calculated using UFBoot2 [26]. For each clinical POWV genome sequence, the percent identity to tick genomes was determined by NCBI blast.
In silico PCR analysis. A representative subset of the genome sequences queried on 5/8/23 was selected for PCR analysis. Up to five complete genomes from each state (Minnesota, Wisconsin, Connecticut, Maine, Massachusetts, New York, New Hampshire, Rhode Island, New Jersey, West Virginia) and country (Canada, Russia) were selected and manually verified for completeness and quality to form a final set of 47 genomes (Supplemental Table S1). Complete clinical genome sequences were prioritized when available. For PCR review, a PubMed search for “Powassan PCR” was conducted on 5/8/23, and papers that described unique primers/probes to detect POWV using RT-PCR were included in this study. Primers/probes were mapped to each genome using Geneious, allowing for up to four mismatch tolerance. Degenerate primers were individually mapped as each of their components, and the result with the fewest mismatches was recorded. When primers bound in multiple locations, the location with the fewest mismatches was used.
Mutation analysis. The same set of 407 genome sequences used for phylogenetic tree construction was assessed for nucleotide and amino acid mutations. Nucleotide sequences were translated using Geneious and analyzed using R. The difference in frequency for each nucleotide and amino acid between samples from ticks and humans was determined and a Fisher’s exact test was performed, with a value considered nominally significant if the two-tailed p-value was less than 0.05. When accounting for multiple comparisons, an adjusted significance threshold was determined by dividing 0.05 by the number of comparisons. Analysis was stratified by lineage to account for the relative under-sampling of lineage I tick genomes compared to lineage II tick genomes.

3. Results

Phylogeny of POWV from humans versus ticks. Powassan virus genomic data were obtained by metagenomic next-generation sequencing of CSF and/or brain tissue from 10 human cases of POWV, producing four partial genomes and six complete genomes. To assess if POWV genomes from human infections broadly sample genomes obtained from ticks, or if they represent a narrow subset of closely related strains, POWV genome sequences from both sources were compared. In total, 19 POWV genome sequences from humans, including 10 newly published, were compared to 387 previously published POWV genomes from ticks. A maximum-likelihood tree revealed that POWV genomes from humans broadly sampled those from ticks (Figure 1). POWV genome sequences from humans clustered within the same three clades that have been previously described in ticks (lineage I, lineage II Northeast, and lineage II Midwest). Among 10 newly published genome sequences, nine belonged to lineage II, with seven falling within to the Northeastern clade, and two within the Midwestern clade, matching the regions in which the patients resided. One new genome belonged to lineage I, coming from a fatal infection in Maine in 2022. The complete genome sequence showed greatest similarity (96.41% nucleotide identity and 98.95% protein identity) to a POWV genome from ticks on Marmota spp. in New York in 1964 and showed comparable similarity to other lineage I genome sequences determined more recently from I. cookei (95.93% nucleotide identity) and I. scapularis ticks (96.12% nucleotide identity) in the US. Excluding gaps, lineage II genome sequences were >99% identical at the nucleotide and protein level to the nearest genome sequences from ticks (Table 1). This is consistent with the observation that most POWV strains are >99% identical at the nucleotide level to other members within their clade (Supplemental Table S2). However, substantial diversity is seen across lineages, with lineage I and lineage II genome sequences sharing as little as 85% nucleotide identity (Table 2).
Analysis of mutations. Substitutions at the amino acid level have led to the emergence and spread of related flaviviruses such as Zika virus and West Nile virus [28,29,30,31]. To assess for mutations that may have led to increased spread or virulence of POWV in humans, the frequency of each nucleotide and amino acid at each position in the genome was compared between genomes from ticks and humans. At the nucleotide level, there were no significant differences at any position between genomes from ticks and humans in lineage I (Figure 2a) or lineage II (Figure 2b) after correcting for multiple comparisons. At the amino acid level, there were no significant differences in lineage I (Figure 2c) but one significant difference (p = 1.82 × 10−5) at position 2451 in lineage II genomes (Figure 2d). This position, which corresponds to position 191 in NS4b, is an alanine in all genomes from ticks, but a valine (n = 2) or threonine (n = 1) in a subset of genomes from humans.
Analysis of PCR assays. With more POWV genome sequences available, we sought to assess the theoretical suitability of various published PCR assays for the detection of POWV in humans. We performed an in silico analysis of published POWV RT-PCR assays, mapping unique sets of primers/probes to a representative set of genome sequences that samples the known diversity of POWV genomes. The results show that most PCR assays are optimized against a single clade (Table 3). With one-mismatch tolerance in each component (primers and probe), no assay mapped to all genome sequences in the set. The assay described by El Khoury et. al., performed at the New York State lab, had the fewest mismatches of any probe-based assay, mapping with ≤1 mismatch to 98% of analyzed genome sequences (see Supplemental Table S3 for a more detailed summary; primers/probes for the assay performed at Mayo were not available for analysis but detect lineage I and lineage II). Assays performed by the CDC arbovirus branch showed close matching for lineage I and lineage II Midwestern genomes, but relatively less matching for lineage II Northeastern genomes. Two assays targeting the 3′ UTR were negatively influenced in the in silico analysis by the inclusion of complete genomes that terminate before the target region.

4. Discussion

Our analysis revealed that POWV genome sequences derived from human infections are highly similar to those derived from ticks, representing the broad diversity of lineage I and lineage II clades in ticks. The similarity between POWV genome sequences from humans and ticks highlights the relevance of environmental surveillance, as RT-PCR assay design for the diagnosis of human infections can be informed by genomic diversity of POWV in ticks. The high similarity between genome sequences from humans and ticks is consistent with the understanding that humans are incidental hosts and that there is minimal viral evolution occurring within humans. The substitution A191V/T in NS4b in some human lineage II genomes is of uncertain significance and requires further investigation. NS4b is a complex and multifunctional protein involved in viral replication and host immune modulation. Homology with related viruses suggests that this position is at the start of the α8 helix, which is likely a transmembrane helix but may undergo conformational changes within the viral lifecycle [39].
Although most human infections belonged to lineage II, our study reports the first lineage I genome sequence derived from a human infection in the United States (note, subsequent to our analysis, a lineage I genome reportedly from a human dating to 1975 was deposited to GenBank under accession OP265689 but has not been published at the time of writing). Although I. cookei (groundhog ticks) and I. marxi (squirrel ticks) are the primary vectors for lineage I POWV, this lineage has recently been found in Dermacentor variabilis (American dog ticks) and I. scapularis (deer ticks) [12,40]. The genome sequences from the clinical lineage I infection in this study showed comparable similarity to POWV sequences from I. cookei and I. scapularis, implicating either of these ticks as the potential source for the patient’s infection. Although I. cookei generally does not bite humans as aggressively as I. scapularis, in 1989–1990, it was found to account for 34% of human tick bites in Maine [41], the same state in which this patient resided. Although I. scapularis has since become more widely distributed, our study highlights the continued importance of POWV lineage I and the need to better understand the relevance of multiple different tick species in contributing to human infections. Compared to lineage II infections that are >99% identical to genomes from ticks, the lineage I infection showed only 96% nucleotide identity to its nearest relative from ticks, suggesting that tick lineage I genomes are relatively under-sampled in environmental surveys.
Our in silico analysis of published RT-PCR assays revealed that diverse strategies have been used to detect POWV, but that most assays have numerous mismatches against specific clades, potentially impacting their sensitivity in detecting those clades. Assays used for clinical diagnosis or environmental surveillance should be designed to detect lineage I, lineage II Northeastern, and lineage II Midwestern clades. The assay published by El Khoury et. al. had the fewest mismatches across all clades, and may serve as a good starting point for investigators when selecting an RT-PCR assay from the literature [21]. There are uncertainties in the sensitivity of assays that target the 3′ UTR, particularly in lineage II NE genomes, as the full length of this region is not present in all genome sequences, including many annotated as complete. Although this is likely due to sequencing/bioinformatic artifacts limiting reads at the 3′ end, it is not known if some viruses have truncated genomes, or if the 3′ end of the genome degrades before sequencing. Our analysis used ≤1 mismatch as the threshold for an ideal match, but assays may tolerate more or fewer mismatches depending on the nature and location of the mismatch. As a noteworthy example, the lineage I infection published here was detected on a clinical basis by the CDC using an envelope-targeted assay despite three mismatches in the forward primer. Although an in silico analysis is a starting point, it is not a replacement for experimental validation, and more studies comparing available RT-PCR assays are required. There is a need for sensitive and specific POWV RT-PCR assays as unbiased mNGS is currently too costly and slow for widespread routine use.
In conclusion, our data show that POWV genomes from ticks are largely identical to those from humans. PCR assays may be designed using genome sequences from ticks, underscoring the importance of environmental surveillance, particularly if lineage I continues to be detected in I. scapularis. There is substantial diversity between POWV lineages and clades, which may limit the sensitivity of some existing assays when applied to individuals across large geographic areas. As all lineages are relevant to human disease, the most broadly applicable PCR assays should be designed to detect the full diversity of POWV genomes seen in humans and ticks.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/v16111653/s1, Table S1: Genomes used for in silico analysis; Table S2: Pairwise identity of Powassan virus genomes; Table S3: Detailed summary of in silico analysis.

Author Contributions

Conceptualization, E.H.K., J.L., J.A.B., A.P. and I.H.S.; methodology, E.H.K., A.P., J.A.B. and J.L.; validation, H.R.H. and J.V.; formal analysis, E.H.K., N.C., N.H. and J.L.; resources, S.R.T.3rd, M.T.A. and J.H.; data curation, C.B.F.V., N.D.G. and C.Y.C.; writing—original draft preparation, E.H.K.; writing-review and editing, E.H.K., N.C., I.H.S., M.T.A., H.R.H., J.V., A.P., J.L. and J.A.B.; visualization, E.H.K., N.C. and J.L.; supervision, J.A.B. and J.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

This study was conducted in accordance with the Declaration of Helsinki, and approved by the Institutional Review Board of Massachusetts General Hospital (protocol 2019P000986, approved in 2019).

Informed Consent Statement

Patient informed consent was waived due to research conducted on leftover specimens from de-identified patients in accordance with the IRB protocol.

Data Availability Statement

Powassan virus genomic data are publicly available at GenBank under accession numbers OR130288-OR130296 and OL695841.

Acknowledgments

We are very grateful to Shahriar Salamat at the University of Wisconsin, H. Brent Clark at the University of Minnesota, and Robert Smith at Tufts University for submitting specimens used in this study. The findings and conclusions in this report are the opinions of the authors and do not necessarily represent the official position of the Centers for Disease Control and Prevention.

Conflicts of Interest

J.A.B. has received research funding to his institution from Zeus Scientific, bioMerieux, Pfizer, Analog Devices Inc., Immunetics, Alere, and DiaSorin, and has been a consultant for AdvanDx, T2 Biosystems, DiaSorin, Roche Diagnostics, Flightpath Biosciences and Tarsus Pharmaceuticals.

References

  1. Piantadosi, A.; Solomon, I.H. Powassan Virus Encephalitis. Infect. Dis. Clin. N. Am. 2022, 36, 671–688. [Google Scholar] [CrossRef]
  2. Kemenesi, G.; Bányaic, K. Tick-Borne Flaviviruses, with a Focus on Powassan Virus. Clin. Microbiol. Rev. 2019, 32, e00106-17. [Google Scholar] [CrossRef] [PubMed]
  3. ArboNET. Arboviral Diseases Branch Centers for Disease Control and Prevention Powassan Virus Statistics and Maps. Available online: https://www.cdc.gov/powassan/data-maps/historic-data.html (accessed on 17 October 2024).
  4. Clinical Testing and Diagnosis for Powassan Virus Disease. Available online: https://www.cdc.gov/powassan/hcp/diagnosis-testing/index.html (accessed on 15 September 2024).
  5. Piantadosi, A.; Kanjilal, S. Diagnostic Approach for Arboviral Infections in the United States. J. Clin. Microbiol. 2020, 58, e01926-19. [Google Scholar] [CrossRef] [PubMed]
  6. Kapadia, R.K.; Staples, J.E.; Gill, C.M.; Fischer, M.; Khan, E.; Laven, J.J.; Panella, A.; Velez, J.O.; Hughes, H.R.; Brault, A.; et al. Severe Arboviral Neuroinvasive Disease in Patients on Rituximab Therapy: A Review. Clin. Infect. Dis. 2022, 76, 1142–1148. [Google Scholar] [CrossRef] [PubMed]
  7. Farrington, M.; Elenz, J.; Ginsberg, M.; Chiu, C.; Miller, S.; Pangonis, S.F. Powassan Virus Infection Detected by Metagenomic Next-Generation Sequencing, Ohio, USA. Emerg. Infect. Dis. 2023, 29, 838–841. [Google Scholar] [CrossRef] [PubMed]
  8. Piantadosi, A.; Kanjilal, S.; Ganesh, V.; Khanna, A.; Hyle, E.P.; Rosand, J.; Bold, T.; Metsky, H.C.; Lemieux, J.; Leone, M.J.; et al. Rapid Detection of Powassan Virus in a Patient with Encephalitis by Metagenomic Sequencing. Clin. Infect. Dis. 2018, 66, 789–792. [Google Scholar] [CrossRef]
  9. Johnson, I.M.; Scheckel, C.; Parikh, S.A.; Enzler, M.; Fugate, J.; Call, T.G. Fatal Powassan Virus Encephalitis in Patients with Chronic Lymphocytic Leukemia. Blood Cancer J. 2022, 12, 143. [Google Scholar] [CrossRef]
  10. Klontz, E.H.; Solomon, I.H.; Turbett, S.E.; Lemieux, J.E.; Branda, J.A. Cerebrospinal Fluid Metagenomics Has Greatest Added Value as a Test for Powassan Virus among Patients in New England with Suspected Central Nervous System Infection. Diagn. Microbiol. Infect. Dis. 2024, 108, 116169. [Google Scholar] [CrossRef]
  11. McMinn, R.J.; Langsjoen, R.M.; Bombin, A.; Robich, R.M.; Ojeda, E.; Normandin, E.; Goethert, H.K.; Lubelczyk, C.B.; Schneider, E.; Cosenza, D.; et al. Phylodynamics of Deer Tick Virus in North America. Virus Evol. 2023, 9, vead008. [Google Scholar] [CrossRef]
  12. Vogels, C.B.F.; Brackney, D.E.; Dupuis, A.P.; Robich, R.M.; Fauver, J.R.; Brito, A.F.; Williams, S.C.; Anderson, J.F.; Lubelczyk, C.B.; Lange, R.E.; et al. Phylogeographic Reconstruction of the Emergence and Spread of Powassan Virus in the Northeastern United States. Proc. Natl. Acad. Sci. USA 2023, 120, e2218012120. [Google Scholar] [CrossRef]
  13. Normandin, E.; Solomon, I.H.; Zamirpour, S.; Lemieux, J.; Freije, C.A.; Mukerji, S.S.; Tomkins-Tinch, C.; Park, D.; Sabeti, P.C.; Piantadosi, A. Powassan Virus Neuropathology and Genomic Diversity in Patients with Fatal Encephalitis. Open Forum Infect. Dis. 2020, 7, ofaa392. [Google Scholar] [CrossRef] [PubMed]
  14. Leonova, G.N.; Kondratov, I.G.; Ternovoi, V.A.; Romanova, E.V.; Protopopova, E.V.; Chausov, E.V.; Pavlenko, E.V.; Ryabchikova, E.I.; Belikov, S.I.; Loktev, V.B. Characterization of Powassan Viruses from Far Eastern Russia. Arch. Virol. 2009, 154, 811–820. [Google Scholar] [CrossRef] [PubMed]
  15. Mandl, C.W.; Holzmann, H.; Kunz, C.; Heinz, F.X. Complete Genomic Sequence of Powassan Virus: Evaluation of Genetic Elements in Tick-Borne versus Mosquito-Borne Flaviviruses. Virology 1993, 194, 173–184. [Google Scholar] [CrossRef] [PubMed]
  16. Tavakoli, N.P.; Wang, H.; Dupuis, M.; Hull, R.; Ebel, G.D.; Gilmore, E.J.; Faust, P.L. Fatal Case of Deer Tick Virus Encephalitis. N. Engl. J. Med. 2009, 360, 2099–2107. [Google Scholar] [CrossRef] [PubMed]
  17. Feder, H.M.; Telford, S.; Goethert, H.K.; Wormser, G.P. Powassan Virus Encephalitis Following Brief Attachment of Connecticut Deer Ticks. Clin. Infect. Dis. 2021, 73, E2350–E2354. [Google Scholar] [CrossRef]
  18. Solomon, I.H.; Spera, K.M.; Ryan, S.L.; Helgager, J.; Andrici, J.; Zaki, S.R.; Vaitkevicius, H.; Leon, K.E.; Wilson, M.R.; DeRisi, J.L.; et al. Fatal Powassan Encephalitis (Deer Tick Virus, Lineage II) in a Patient with Fever and Orchitis Receiving Rituximab. JAMA Neurol. 2018, 75, 746–750. [Google Scholar] [CrossRef]
  19. Cavanaugh, C.E.; Muscat, P.L.; Telford, S.R.; Goethert, H.; Pendlebury, W.; Elias, S.P.; Robich, R.; Welch, M.; Lubelczyk, C.B.; Smith, R.P. Fatal Deer Tick Virus Infection in Maine. Clin. Infect. Dis. 2017, 65, 1043–1046. [Google Scholar] [CrossRef]
  20. El Khoury, M.Y.; Camargo, J.F.; White, J.L.; Backenson, B.P.; Dupuis, A.P.; Escuyer, K.L.; Kramer, L.; George, K.S.; Chatterjee, D.; Prusinski, M.; et al. Potential Role of Deer Tick Virus in Powassan Encephalitis Cases in Lyme Disease-Endemic Areas of New York, USA. Emerg. Infect. Dis. 2013, 19, 1926–1933. [Google Scholar] [CrossRef]
  21. El Khoury, M.Y.; Hull, R.C.; Bryant, P.W.; Escuyer, K.L.; St George, K.; Wong, S.J.; Nagaraja, A.; Kramer, L.; Dupuis, A.P.; Purohit, T.; et al. Diagnosis of Acute Deer Tick Virus Encephalitis. Clin. Infect. Dis. 2013, 56, 40–47. [Google Scholar] [CrossRef]
  22. Miller, S.; Naccache, S.N.; Samayoa, E.; Messacar, K.; Arevalo, S.; Federman, S.; Stryke, D.; Pham, E.; Fung, B.; Bolosky, W.J.; et al. Laboratory Validation of a Clinical Metagenomic Sequencing Assay for Pathogen Detection in Cerebrospinal Fluid. Genome Res. 2019, 29, 831–842. [Google Scholar] [CrossRef]
  23. Piantadosi, A.; Shariatzadeh, N.; Bombin, A.; Arkun, K.; Alexandrescu, S.; Kleinschmidt-Demasters, B.K.; Solomon, I.H. Double-Stranded RNA Immunohistochemistry as a Screening Tool for Viral Encephalitis. Am. J. Clin. Pathol. 2023, 160, 210–219. [Google Scholar] [CrossRef] [PubMed]
  24. Katoh, K.; Standley, D.M. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability Article Fast Track. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef]
  25. Nguyen, L.; Schmidt, H.A.; von Haeseler, A.; Minh, B.Q. IQ-TREE: A Fast and Effective Stochastic Algorithm for Estimating Maximum-Likelihood Phylogenies. Mol. Biol. Evol. 2014, 32, 268–274. [Google Scholar] [CrossRef] [PubMed]
  26. Thi Hoang, D.; Chernomor, O.; von Haeseler, A.; Quang Minh, B.; Sy Vinh, L.; Rosenberg, M.S. UFBoot2: Improving the Ultrafast Bootstrap Approximation. Mol. Biol. Evol. 2017, 35, 518–522. [Google Scholar] [CrossRef] [PubMed]
  27. Piantadosi, A.; Mukerji, S.S.; Ye, S.; Leone, M.J.; Freimark, L.M.; Park, D.; Adams, G.; Lemieux, J.; Kanjilal, S.; Solomon, I.H.; et al. Enhanced Virus Detection and Metagenomic Sequencing in Patients with Meningitis and Encephalitis. mBio 2021, 12, e0114321. [Google Scholar] [CrossRef] [PubMed]
  28. Shan, C.; Xia, H.; Haller, S.L.; Azar, S.R.; Liu, Y.; Liu, J.; Muruato, A.E.; Chen, R.; Rossi, S.L.; Wakamiya, M.; et al. A Zika Virus Envelope Mutation Preceding the 2015 Epidemic Enhances Virulence and Fitness for Transmission. Proc. Natl. Acad. Sci. USA 2020, 117, 20190–20197. [Google Scholar] [CrossRef]
  29. Brault, A.C.; Huang, C.Y.-H.; Langevin, S.A.; Kinney, R.M.; Bowen, R.A.; Ramey, W.N.; Panella, N.A.; Holmes, E.C.; Powers, A.M.; Miller, B.R.; et al. A Single Positively Selected West Nile Viral Mutation Confers Increased Virogenesis in American Crows Aaron. Nat. Genet. 2000, 39, 97–103. [Google Scholar]
  30. Xia, H.; Luo, H.; Shan, C.; Muruato, A.E.; Nunes, B.T.D.; Medeiros, D.B.A.; Zou, J.; Xie, X.; Giraldo, M.I.; Vasconcelos, P.F.C.; et al. An Evolutionary NS1 Mutation Enhances Zika Virus Evasion of Host Interferon Induction. Nat. Commun. 2012, 9, 414. [Google Scholar] [CrossRef]
  31. Moudy, R.M.; Meola, M.A.; Morin, L.L.L.; Ebel, G.D.; Kramer, L.D. A Newly Emergent Genotype of West Nile Virus Is Transmitted Earlier and More Efficiently by Culex Mosquitoes. Am. J. Trop. Med. Hyg. 2007, 77, 365–370. [Google Scholar] [CrossRef]
  32. Telford, S.; Armstrong, P.; Paula, K.; Foppa, I.; Olmeda Garvia, S.; Wilson, M.; Spielman, A. A New Tick-Borne Encephalitis-like Virus Infecting New England Deer Ticks, Ixodes Dammini. Emerg. Infect. Dis. 1997, 3, 165–170. [Google Scholar] [CrossRef]
  33. Tokarz, R.; Tagliafierro, T.; Cucura, D.M.; Rochlin, I.; Sameroff, S.; Lipkin, W.I. Detection of Anaplasma and Powassan Virus in Ticks by a Multiplex Real-Time Reverse Transcription-PCR Assay. mSphere 2017, 2, e00151-17. [Google Scholar] [CrossRef] [PubMed]
  34. Dupuis, A.P.; Peters, R.J.; Prusinski, M.A.; Falco, R.C.; Ostfeld, R.S.; Kramer, L.D. Isolation of Deer Tick Virus (Powassan Virus, Lineage II) from Ixodes Scapularis and Detection of Antibody in Vertebrate Hosts Sampled in the Hudson Valley, New York State. Parasites Vectors 2013, 6, 185. [Google Scholar] [CrossRef] [PubMed]
  35. Aliota, M.T.; Dupuis, A.P.; Wilczek, M.P.; Peters, R.J.; Ostfeld, R.S.; Kramer, L.D. The Prevalence of Zoonotic Tick-Borne Pathogens in Ixodes Scapularis Collected in the Hudson Valley, New York State. Vector-Borne Zoonotic Dis. 2014, 14, 245–250. [Google Scholar] [CrossRef] [PubMed]
  36. Brackney, D.E.; Nofchissey, R.A.; Fitzpatrick, K.A.; Brown, I.K.; Ebel, G.D. Short Report: Stable Prevalence of Powassan Virus in Ixodes Scapularis in a Northern Wisconsin Focus. Am. J. Trop. Med. Hyg. 2008, 79, 971–973. [Google Scholar] [CrossRef] [PubMed]
  37. Schwartz, S.; Calvente, E.; Rollinson, E.; Koon, D.S.K.; Chinnici, N. Tick-Borne Pathogens in Questing Blacklegged Ticks (Acari: Ixodidae) from Pike County, Pennsylvania. J. Med. Entomol. 2022, 59, 1793–1804. [Google Scholar] [CrossRef]
  38. Yuan, Q.; Llanos-Soto, S.G.; Gangloff-Kaufmann, J.L.; Lampman, J.M.; Frye, M.J.; Benedict, M.C.; Tallmadge, R.L.; Mitchell, P.K.; Anderson, R.R.; Cronk, B.D.; et al. Active Surveillance of Pathogens from Ticks Collected in New York State Suburban Parks and Schoolyards. Zoonoses Public Health 2020, 67, 684–696. [Google Scholar] [CrossRef]
  39. Wang, Y.; Xie, X.; Shi, P.Y. Flavivirus NS4B Protein: Structure, Function, and Antiviral Discovery. Antivir. Res. 2022, 207, 105423. [Google Scholar] [CrossRef]
  40. Lange, R.E.; Dupuis II, A.P.; Prusinski, M.A.; Maffei, J.G.; Koetzner, C.A.; Ngo, K.; Backenson, B.; Oliver, J.; Vogels, C.B.F.; Grubaugh, N.D.; et al. Identification and Characterization of Novel Lineage 1 Powassan Virus Strains in New York State. Emerg. Microbes Infect. 2023, 12, 2155585. [Google Scholar] [CrossRef]
  41. Smith, R.P.; Lacombe, E.H.; Rand, P.W.; Dearborn, R. Diversity of Tick Species Biting Humans in an Emerging Area for Lyme Disease. Am. J. Public Health 1992, 82, 66–69. [Google Scholar] [CrossRef]
Viruses 16 01653 g001
Figure 1. Phylogenetic reconstruction of Powassan virus genome sequences from ticks and humans, colored by location and source. Where node support is >50% by bootstrap approximation, nodes are annotated with blue colored circles shaded by degree of support. Outer rings provide information on the source (tick versus human) and specimen location.
Figure 1. Phylogenetic reconstruction of Powassan virus genome sequences from ticks and humans, colored by location and source. Where node support is >50% by bootstrap approximation, nodes are annotated with blue colored circles shaded by degree of support. Outer rings provide information on the source (tick versus human) and specimen location.
Viruses 16 01653 g001
Viruses 16 01653 g002
Figure 2. Comparison of POWV genome sequences from humans and ticks by nucleotide and amino acid position by Fisher’s exact test. (a) Comparison of lineage I genomes by nucleotide position. (b) Comparison of lineage II genomes by nucleotide position. (c) Comparison of lineage I genomes by amino acid position. (d) Comparison of lineage II genomes by amino acid position. Horizontal dashed line represents threshold for nominal significance (p < 0.05); horizontal dotted line represents threshold for significance after correction for multiple comparisons.
Figure 2. Comparison of POWV genome sequences from humans and ticks by nucleotide and amino acid position by Fisher’s exact test. (a) Comparison of lineage I genomes by nucleotide position. (b) Comparison of lineage II genomes by nucleotide position. (c) Comparison of lineage I genomes by amino acid position. (d) Comparison of lineage II genomes by amino acid position. Horizontal dashed line represents threshold for nominal significance (p < 0.05); horizontal dotted line represents threshold for significance after correction for multiple comparisons.
Viruses 16 01653 g002
Table 1. Comparison of POWV genomes from humans and tick. 1 Excluding gaps in partial genomes.
Table 1. Comparison of POWV genomes from humans and tick. 1 Excluding gaps in partial genomes.
Human InfectionLocationYearCladeClosest Tick GenomeNucleotide Identity (%)Protein Identity (%)Citation
OR130294ME2022Lineage IHM44056396.4198.95This study
OR130288MA2022Lineage II NEOL70427199.8499.97This study
OR130289MA2019Lineage II NEOL70435699.7999.82This study, [1,10]
OR130290MA2020Lineage II NEOP265695100 1100 1This study, [10]
OR130291MA2021Lineage II NEOL70419099.3499.56This study, [10]
OR130292ME2022Lineage II NEOP265694100 1100 1This study, [10]
OR130293MA2022Lineage II NEOL70429599.3999.80This study, [10]
OR130296ME2016Lineage II NEOL70427699.90 199.89 1This study
OR130295WI2018Lineage II MWOP82348199.50 199.85 1This study
OL695841MN2020Lineage II MWOP82348199.3599.74This study
HQ231414RUS2006Lineage IMG65243899.9299.94Unpublished
HQ231415RUS2006Lineage IMG65243899.9299.91Unpublished
EU543649RUS2006Lineage IMG65243899.9299.85[14]
EU670438RUS1991Lineage IMG65243899.9299.94[14]
L06436CAN1958Lineage IOP82340799.9899.91[15]
MW001304MA2016Lineage II NEOP82343899.7099.88[1,13,18]
MW001306MA2019Lineage II NEOP82343899.7599.80[13]
MT996002MA2018Lineage II NEOL70435699.8799.91[13]
MF688929NH2016Lineage II NEOP26569499.89 199.82 1[8,10,27]
Table 2. Nucleotide percent identity matrix of clinical POWV genome sequences by lineage.
Table 2. Nucleotide percent identity matrix of clinical POWV genome sequences by lineage.
Lineage ILineage II NELineage II MW
Lineage I94%85%85%
Lineage II NE85%99%94%
Lineage II MW85%94%99%
Table 3. Published RT-PCR assays and their frequency of mismatches against lineage I, lineage II Midwest and lineage II Northeast genome sequences.
Table 3. Published RT-PCR assays and their frequency of mismatches against lineage I, lineage II Midwest and lineage II Northeast genome sequences.
Primer Set≤1 Mismatch in
All Components		TargetRef.
Forward-1: ACCATAACAAACATGAAAGTCCAACT
Forward-2: CCATCACAAACATGAAAGTCCAACT
Reverse-1: TGAGTCTGCTGGTCCGATGAC
Reverse-2: CTGTGAGTCAGCTGGTCCTATGAC
Probe: 6FAM-CCTTCCATCATGCGGAT-MGB		Lineage I: 92%
Lineage II Midwest: 100%
Lineage II Northeast: 100%
All lineages: 98%		NS5[21]
Assay performed by NYSDOH
Forward: GCATG+A3:G12GTCGGATGAACAGAA
Reverse: GAGCGCTCTTCATCCACCA
Probe: N/A		Lineage I: 83%
Lineage II Midwest: 100%
Lineage II Northeast: 100%
All lineages: 96%		NS5[8]
POW-1: TGGATGACAACAGAAGACATGC
POW-2: GCTCTCTAGCTTGAGCTCCCA
Probe: N/A		Lineage I: 100%
Lineage II Midwest: 100%
Lineage II Northeast: 88%
All lineages: 94%		E[32]
Forward: CACCAGGAGTTAGGCCATTT
Reverse: AGATTGCCAATCTTCTTCCT
Reverse: AGATTGCCAATTGTCTTCCC
Probe: 6FAM-TCCTCCCGAGTTATGCCCGG-BHQ1		Lineage I: 92%
Lineage II Midwest: 100%
Lineage II Northeast: 64%
All lineages: 78%		3′ UTRThis study.
Assay performed by CDC
Forward: GTGATGTGGCAGCGCACC
Reverse: CTGCGTCGGGAGCGACCA
Probe: Texas Red-CCTACTGCGGCAGCACACACAGTG-BHQ		Lineage I: 0%
Lineage II Midwest: 100%
Lineage II Northeast: 88%
All lineages: 67%		3′ UTR[33]
Forward: GATCATGAGAGCGGTGAGTGACT
Reverse: GGATCTCACCTTTGCTATGAATTCA
Probe: 6FAM-TGAGCACCTTCACAGCCGAGCCAG-TAMRA		Lineage I: 0%
Lineage II Midwest: 44%
Lineage II Northeast: 100%
All lineages: 63%		NS5[34]
Forward: AGAATGGCCATGACAGACACAA
Reverse: AGCCAGTCACTCACHGCTCTCAT
Probe: ?-GCCCAAGAGCCRCAGCCAGG-?		Lineage I: 100%
Lineage II Midwest: 0%
Lineage II Northeast: 64%
All lineages: 61%		NS5[35]
Forward: GATCATGAGAGCGGTGAGTGACT
Reverse: GGATCTCACCTTTGCTATGAATTCA
Probe: 6FAM-TGAGCACCTTCACAGCCGAGCCAG-TAMRA		Lineage I: 0%
Lineage II Midwest: 33%
Lineage II Northeast: 100%
All lineages: 61%		NS5[36]
Forward: GAAGCTGGGTGAGTTTGGAG
Reverse: CCTGAGCAACCAACCAAGAT
Probe: N/A		Lineage I: 0%
Lineage II Midwest: 0%
Lineage II Northeast: 100%
All lineages: 54%		NS5[37]
Forward: GTGCCAAGTTTGAATGCGAGGAAG
Reverse: GAACGGGGCCCAGCGAGAGTGAC
Probe: N/A		Lineage I: 0%
Lineage II Midwest: 0%
Lineage II Northeast: 96%
All lineages: 52%		NS5[38]
Forward: CGACCAGCAACGAGCCC
Reverse: GCCAAAGAATCCCCAGCAT
Probe: 6FAM-CCAAAGGGCTTCGTGCTGTCGC-BHQ1		Lineage I: 100%
Lineage II Midwest: 0%
Lineage II Northeast: 0%
All lineages: 26%		CapsidThis study.
Assay performed by CDC
Forward: CAAGCCACACCATCGATAATGA
Reverse: CGTTTGCTCACTATATCCAGGTATTC
Probe: 6FAM-CTTTTCCTGCCGGTTACTCTCGCCG-BHQ1		Lineage I: 0%
Lineage II Midwest: 100%
Lineage II Northeast: 0%
All lineages: 20%		NS5This study.
Assay performed by CDC
Forward: GCAGTTTACGGTGGCATCC
Reverse: CGTCAGCGACACATCTCCAT
Probe: 6FAM-AGTGATCCTGCGGCTCGGCG-BHQ1		Lineage I: 75%
Lineage II Midwest: 0%
Lineage II Northeast: 0%
All lineages: 20%		EThis study.
Assay performed by CDC
Forward: CATAGCRAAGGTGAGATCCAA
Reverse: CTTTCGAGCTCCAYTTRTT
Probe: 6FAM-AGCTCTGGGCGCATGGTYGGATGAACA-TAMRA		Lineage I: 0%
Lineage II Midwest: 0%
Lineage II Northeast: 0%
All lineages: 0%		NS5[34]
ENV-A: GTCGACGACGAGGTGCACGCATCTTGA
POW-6: TTGTGTTTCCAGGGCAGCGCCA
Probe: N/A		Lineage I: 0%
Lineage II Midwest: 0%
Lineage II Northeast: 0%
All lineages: 0%		NS5[32]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Klontz, E.H.; Chowdhury, N.; Holbrook, N.; Solomon, I.H.; Telford, S.R., 3rd; Aliota, M.T.; Vogels, C.B.F.; Grubaugh, N.D.; Helgager, J.; Hughes, H.R.; et al. Analysis of Powassan Virus Genome Sequences from Human Cases Reveals Substantial Genetic Diversity with Implications for Molecular Assay Development. Viruses 2024, 16, 1653. https://doi.org/10.3390/v16111653

AMA Style

Klontz EH, Chowdhury N, Holbrook N, Solomon IH, Telford SR 3rd, Aliota MT, Vogels CBF, Grubaugh ND, Helgager J, Hughes HR, et al. Analysis of Powassan Virus Genome Sequences from Human Cases Reveals Substantial Genetic Diversity with Implications for Molecular Assay Development. Viruses. 2024; 16(11):1653. https://doi.org/10.3390/v16111653

Chicago/Turabian Style

Klontz, Erik H., Navid Chowdhury, Nolan Holbrook, Isaac H. Solomon, Sam R. Telford, 3rd, Matthew T. Aliota, Chantal B. F. Vogels, Nathan D. Grubaugh, Jeffrey Helgager, Holly R. Hughes, and et al. 2024. "Analysis of Powassan Virus Genome Sequences from Human Cases Reveals Substantial Genetic Diversity with Implications for Molecular Assay Development" Viruses 16, no. 11: 1653. https://doi.org/10.3390/v16111653

APA Style

Klontz, E. H., Chowdhury, N., Holbrook, N., Solomon, I. H., Telford, S. R., 3rd, Aliota, M. T., Vogels, C. B. F., Grubaugh, N. D., Helgager, J., Hughes, H. R., Velez, J., Piantadosi, A., Chiu, C. Y., Lemieux, J., & Branda, J. A. (2024). Analysis of Powassan Virus Genome Sequences from Human Cases Reveals Substantial Genetic Diversity with Implications for Molecular Assay Development. Viruses, 16(11), 1653. https://doi.org/10.3390/v16111653

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop