Next Article in Journal
RNA-Seq Reveals Transcriptome Changes Following Zika Virus Infection in Fetal Brains in c-Flip Knockdown Mice
Previous Article in Journal
Evaluation of Interfering RNA Efficacy in Treating Hepatitis B: Is It Promising?
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Viruses
Volume 16
Issue 11
10.3390/v16111711
viruses-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Isolation and Characterization of a Bacteriophage with Potential for the Control of Multidrug-Resistant Salmonella Strains Encoding Virulence Factors Associated with the Promotion of Precancerous Lesions

by
Luis Amarillas
1,2,
Fedra Padilla-Lafarga
1,
Rubén Gerardo León Chan
1,
Jorge Padilla
2,
Yadira Lugo-Melchor
3,
Jesús Enrique López Avendaño
2,
Luis Lightbourn-Rojas
1,* and
Mitzi Estrada-Acosta
2,*
1
Instituto de Investigación Lightbourn, Jimenez 33981, Mexico
2
Facultad de Agronomía de la Universidad Autónoma de Sinaloa, Culiacán 80000, Mexico
3
Centro de Investigación y Asistencia en Tecnología y Diseño del Estado de Jalisco, Guadalajara 44270, Mexico
*
Authors to whom correspondence should be addressed.
Viruses 2024, 16(11), 1711; https://doi.org/10.3390/v16111711
Submission received: 19 September 2024 / Revised: 10 October 2024 / Accepted: 20 October 2024 / Published: 31 October 2024
(This article belongs to the Section Bacterial Viruses)
Browse Figures
Review Reports Versions Notes

Abstract

:
Background: Antimicrobial-resistant bacteria represent a serious threat to public health. Among these bacteria, Salmonella is of high priority because of its morbidity levels and its ability to induce different types of cancer. Aim: This study aimed to identify Salmonella strains encoding genes linked to the promotion of precancerous lesions and to isolate a bacteriophage to evaluate its preclinical potential against these bacteria. Methodology: An epidemiological approach based on wastewater analysis was employed to isolate Salmonella strains and detect genes associated with the induction of precancerous lesions. Antimicrobial susceptibility was assessed by the disk diffusion method. A bacteriophage was isolated via the double agar technique, and its morphological characteristics, stability, host range, replication dynamics, and ability to control Salmonella under different conditions were evaluated. The bacteriophage genome was sequenced and analyzed using bioinformatics tools. Results: Thirty-seven Salmonella strains were isolated, seventeen of which contained the five genes associated with precancerous lesions’ induction. These strains exhibited resistance to multiple antimicrobials, including fluoroquinolones. A bacteriophage from the Autographiviridae family with lytic activity against 21 bacterial strains was isolated. This phage exhibited a 20 min replication cycle, releasing 52 ± 3 virions per infected cell. It demonstrated stability and efficacy in reducing the Salmonella concentration in simulated gastrointestinal conditions, and its genome lacked genes that represent a biosafety risk. Conclusion: This bacteriophage shows promising preclinical potential as a biotherapeutic agent against Salmonella.

Graphical Abstract

1. Introduction

Currently, bacterial infections account for one in every eight deaths worldwide, and this figure continues to rise [1]. Moreover, this problem is aggravated by the emergence of bacteria that are multidrug-resistant to antimicrobials [2]. In the absence of effective preventive measures, projections suggest that this type of bacteria could become the leading cause of death in the coming years [3]. Consequently, experts have emphasized the urgent need for immediate intervention to mitigate this escalating crisis [4,5].
Among the particularly dangerous multidrug-resistant bacteria, considered priority pathogens by the World Health Organization, Salmonella stands out for its high morbidity rate [6]. Worldwide, between 200 million and 1 billion infections caused by Salmonella are reported annually, leading to approximately 420,000 deaths [7,8,9].
In addition, growing evidence suggests that Salmonella is implicated in the development of different types of cancer in the gastrointestinal tract [10,11,12,13]. Although many aspects of Salmonella’s role in promoting precancerous lesions and tumorigenesis remain unclear, it is known that the oncogenic potential exhibited by certain Salmonella strains is directly attributed to the ability to synthesize certain effector proteins, including AvrA, SopB, CdtB, PltA, and PltB [14,15,16,17]. These proteins contribute chronic inflammation, DNA damage, and manipulation of host signaling pathways [18,19].
This underscores the pressing need for more effective antimicrobial agents to reinforce public health strategies against these types of bacteria. In this context, there is renewed interest in the use of bacteriophages, also called phages, viruses that infect and lyse bacteria, as therapeutic agents [20,21,22]. These viruses represent one of the most promising alternatives for acting against resistant bacteria due to their highly species-specific manner, which enables the selective targeting and destruction of pathogenic bacteria without harming beneficial ones, a crucial advantage in precision medicine [23]. Furthermore, phages are generally recognized as safe, as they do not directly affect human or animal health [24]. Their low production costs also make them an attractive option for biopharmaceutical application [25].
However, not all phages are suitable as therapeutic agents, as some may carry genes encoding pathogenicity factors, which could increase the virulence of the bacteria. Others, meanwhile, may contain proteins with allergenic potential, be unstable during storage, or fail to exert their therapeutic effect at the intended site of action [26,27,28]. Therefore, it is essential to select phages through comprehensive characterization to assess both their therapeutic potential and biosafety.
Accordingly, the main aim of this research was to isolate and characterize a bacteriophage with preclinical potential as an alternative for the treatment for multidrug-resistant Salmonella strains, particularly those encoding virulence factors associated with the induction of precancerous lesions.

2. Materials and Methods

2.1. Isolation of Salmonella Strains and Identification of Genes with Oncogenic Potential

Salmonella strains were isolated from 54 urban wastewater samples collected in August–September 2023 from the central zone of the State of Sinaloa, Mexico. Samples were obtained from the sewage system in the municipalities of Culiacan and Navolato. The ultrafiltration method described by Liu et al. (2021) was employed due to its high efficiency in concentrating pathogenic bacteria present in environmental samples, enabling a more effective recovery of bacteria such as Salmonella [29]. Subsequently, the bacteria were isolated by inoculating the eluate on Hektoen enteric agar. The presence of the invA gene was confirmed using polymerase chain reaction (PCR), ensuring accurate identification of each bacterial strain [30]. In addition, PCR analysis was also utilized to detect genes associated with the promotion of precancerous lesions, which are encoded by specific Salmonella strains. The genes targeted in this study included avrA, sopB, cdtB, pltA, and pltB. For this purpose, the oligonucleotides and protocols described by lshaheeb et al., 2023, Hawwas et al., 2022, and Mezal et al., 2014 were used for analysis (Table 1) [31,32,33].

2.2. Antibiotic Susceptibility Tests

The disk diffusion method was used to evaluate the in vitro susceptibility of the isolated bacterial strains to 12 antibiotics, representing six distinct families and five mechanisms of action. The antibiotics included beta-lactams (ampicillin, amoxicillin/clavulanic acid, cephalothin, imipenem), which inhibit cell wall synthesis; quinolones (ciprofloxacin, nalidixic acid), targeting DNA synthesis; aminoglycosides (gentamicin, amikacin), phenicols (chloramphenicol), and tetracyclines (tetracycline), which inhibit protein synthesis; polymyxins (colistin), which disrupt the cell membrane; and sulfonamides (sulfamethoxazole/trimethoprim), inhibiting folic acid synthesis. This selection covers key biochemical pathways to provide a comprehensive profile of antimicrobial resistance. Antibiotics were chosen based on their clinical relevance in treating Salmonella infections and their usage in the local agricultural sector, the predominant activity in the sampling area. For this purpose, 6 mm discs impregnated with standard antibiotic concentrations, as recommended by the International Committee for Laboratory Standards (CLSI), were used. The bacterial inoculums were adjusted to a turbidity equivalent to 0.5 on the McFarland scale, and the plates were incubated at 37 °C for 24 h (h). After incubation, the diameter of the inhibition zones was measured with a calibrated Vernier [34]. Salmonella ATCC 14028 was used as the reference strain.

2.3. Bacteriophage Isolation and Purification

For bacteriophage isolation, urban wastewater samples were filtered through aluminum oxide nanofibers (NanoCeram-Argonide Corp., Sanford, FL USA), due to their high efficiency in retaining viral particles, using a MasterFlex peristaltic pump (Cole-Palmer, Vernon Hills, Illinois USA) at a constant flow rate of 500 milliliters per minute (mL/min) [35]. The eluate was recovered, and the double-agar-layer technique was used to determine the presence of phages with lytic activity on Salmonella. Briefly, 1 mL of the overnight bacterial culture grown in trypticasein soy broth (TSB) was mixed with 200 µL of the eluate and 3 mL of 0.4% TSB-agarose, and the mixture was poured onto Petri dishes containing trypticasein soy agar (TSA). The plates were incubated at 37 °C for 24 h, after which lysis plaques were identified, excised with a Pasteur pipette, and transferred to microcentrifuge tubes containing sterile distilled water. An aliquot of 100 µL was taken, and the double-agar-layer technique was repeated. Plates were again incubated for 24 h at 37 °C [36]. This process was repeated five times to ensure the recovery of a single phage type. The phage was propagated following the protocol described by [37]. Purification of the bacteriophage suspension was achieved via dialysis using the 20,000 MWCO Slide-A-Lyzer system (Thermo Fisher, Waltham, MA, USA), followed by endotoxin removal with the EndoTrap HD system (Lionex, Braunschweig Germany). Subsequently, the suspension was filtered through a polyvinylidene difluoride membrane with 0.22 µm pores.

2.4. Transmission Electron Microscopy

For electron microscopy, 30 µL of the purified bacteriophage suspension was placed on a Formvar-coated copper grid with 400-mesh carbon baking and allowed to absorb for 10 min [38]. Subsequently, the grid was placed in a vacuum evaporator (JEE400, JEOL Ltd., Tokyo, Japan), stained with 2% (w/v) phosphotungstic acid (pH 7.2) for 1 min, and air-dried in a dust-free environment. The samples were examined using a transmission electron microscope (JEM-1011, JEOL Ltd., Tokyo, Japan) operating with an accelerating voltage of 80 kV.

2.5. One-Step Replication Curve

The multiplicity of infection (MOI) value of 0.1 was calculated by first determining both the concentration of the bacteriophage and the Salmonella strain. The bacteriophage titer was quantified using the double-agar-layer technique in combination with serial dilutions. The concentration of Salmonella was assessed by plating on Hektoen enteric agar after the culture reached an optical density of 0.1 at 600 nm.
To evaluate the replication kinetics of the bacteriophage, a single colony of the host strain was resuspended in 50 mL of TSB medium and incubated at 37 °C with shaking at 100 rpm. When the optical density at 600 nm reached 0.1, the phage was added at a multiplicity of infection (MOI) of 0.1. At five-minute intervals, two aliquots were collected from the culture, one treated with chloroform, which lyses the host cells to release intracellular phage particles, and one left untreated. The aliquots were centrifuged at 10,000× g for 1 min, and the supernatant was used to determine the bacteriophage concentration through serial decimal dilutions and the double-agar-layer method, as described by [37]. This procedure was performed in triplicate for each time point to ensure the reproducibility and accuracy of the results. The adsorption phase was monitored by determining the rate of bacteriophage attachment to host cells over time, while the eclipse phase was identified as the period between initial infection and the detection of intracellular phage particles. The latency phase was defined as the interval between infection and the release of newly formed phages into the medium. All phases were assessed in triplicate to ensure the reproducibility and accuracy of the results.

2.6. Bacteriophage Host Range

The host range of the bacteriophage was evaluated by the agar double-layer method using a purified suspension of the phage at a concentration of 1 × 103 plaque-forming units per milliliter (PFU/mL). The assay included 37 Salmonella strains, 8 Escherichia coli strains, and 5 probiotic bacterial strains known to be part of human gut microbiota and considered beneficial, including Bacillus clausii, Bacillus coagulans, Lactobacillus paracasei, Lactobacillus rhamnosus, and Limosilactobacillus reuteri. Double-layer agar plates were prepared for each strain according to the method described in Section 2.3. The plates were inspected for the formation of lysis plaques on the agar, which indicated the lytic activity of the bacteriophage against the tested strains.

2.7. Stability of the Bacteriophage

Accelerated stability test. The accelerated stability test of the phage was conducted according to the protocol described by Xu et al. (2023), with modifications outline below [39]. A purified suspension of phage was incubated at 60, 65, and 70 °C, and its concentration was continuously monitored at 1 or 2 h intervals. The data on viral concentration were analyzed using three reaction kinetic models: zero-order (kt = M0 − M), first-order (kt = In (M0/M)), and second-order (kt = 1/M − M0), respectively. The kinetic model that exhibited the lowest coefficient of determination (r2) was selected for subsequent calculations, indicating the best fit to the experimental data. The thermodynamic temperature (T) and rate constant (k) obtained from the selected kinetic model were applied to the Arrhenius equation (ln(k) = (Ea/RT) − ln[A], where Ea is the activation energy and R is the gas constant. The values of Ea and A were determined experimentally by a nonlinear fit of the viral concentration data. By combining the Arrhenius equation with the selected reaction kinetics model, we calculated the relationship between time (t) and the actual phage concentration (M), which was the model for predicting the phage lifetime. To validate the model’s applicability under realistic conditions, it was tested at 28 °C, with the bacteriophage concentration measured monthly over six months.
Stability in simulated gastrointestinal environment. The simulated gastrointestinal system was composed of three phases: oral phase, gastric phase, and intestinal phase. The composition of each phase is detailed in Table 2. Electrolyte solutions were sterilized at 121 °C for 15 min at one atmospheric pressure. After sterilization, the corresponding enzymes and bile solution, previously filtered with 0.45 μm filters, were added. The phage was then inoculated in the oral phase at a concentration of approximately 1 × 10⁶ colony-forming units per milliliter (CFU/mL), with the final pH adjusted to 7. The mixture was incubated at 37 °C with agitation at 100 rpm for 2 min. Subsequently, the contents of the oral phase were mixed at a 1:1 ratio with the gastric phase, adjusting the final pH to 3, and incubated under the same conditions for 2 h. Finally, the contents of the gastric phase and the intestinal phase were mixed at a 1:1 ratio, adjusting the final pH to 7, and the solution was incubated for 2 h in the described conditions [40]. At each phase of the experiment, the phage concentration was determined through serial decimal dilutions and the agar double-layer method. The results were expressed as means ± standard deviation of the phage concentration, and values of p < 0.01 were considered significant.

2.8. Bacteriolytic Activity of the Bacteriophage

In culture medium. The Salmonella strain, designated Sal-28, that exhibited the highest level of antibiotic resistance and encoded all five evaluated virulence genes was cultured in TSB medium at 37 °C for 24 h. Afterward, 1 mL of this culture was added to four separate flasks, each containing 200 mL of TSB, and incubated at 37 °C in a shaker at 100 rpm. Bacterial growth was monitored by measuring the optical density at 600 nm (OD600). When the OD600 reached 0.5 (~2 × 108 CFU/mL), varying concentrations of purified bacteriophage suspension were added: 100 µL to the first flask to a final concentration of 1 × 107 PFU/mL, 1 × 106 PFU/mL to the second, and 1 × 105 PFU/mL to the third. The fourth flask served as a control without phage. All cultures were incubated under the same conditions, and optical density measurements were taken hourly [41].
In the simulated gastrointestinal system. The bacteriolytic capacity of the bacteriophage was evaluated using the in vitro system described in Section 2.7, with modifications to incorporate a food model similar to that proposed by Akritidou et al. (2023), designed to promote bacterial survival [42]. To simulate a microbiome, the five bacterial species described in Section 2.6 were used. All strains were mixed in equal proportions and used immediately [43]. In the simulated intestinal fluid, each of the following treatments were inoculated: (1) beneficial bacteria consortium (1 × 106 CFU/mL) + 50 µL of sterile water, (2) Salmonella (1 × 106 CFU/mL) + 50 µL of sterile water, (3) beneficial bacteria consortium (1 × 106 CFU/mL) + 50 µL of purified phage suspension (1 × 104 PFU/mL), (4) Salmonella (1 × 106 CFU/mL) + 50 µL of the purified phage suspension (1 × 104 CFU/mL), (5) Salmonella (1 × 106 CFU/mL) + ciprofloxacin 0.5 mg/mL, and (6) beneficial bacteria consortium (1 × 106 CFU/mL) + ciprofloxacin 0.5 mg/mL. The bacterial concentration of each treatment was quantified using a plate count method based on spreading the sample on Petri plates. Results were presented as the mean concentration ± standard deviation, with p-values < 0.01 considered statistically significant.

2.9. Genomic Sequencing and Bioinformatic Analysis

Bacteriophage genetic material was extracted according to the proteinase K/SDS protocol [44]. Genomic libraries were generated using the MGIEasy DNA library Prep Universal System, and nucleotide sequencing was conducted on the MGISEQ-2000 platform utilizing the DNBSEQTM (nanoballs DNA) system. Assembly and bioinformatics analysis were performed according to the guidelines proposed by Philipson et al. (2018) and Turner et al. (2021) [45,46]. Random sampling of reads (50,000 to 100,000) was performed using the Seqtk Toolkit tool until a coverage depth of ~100× was achieved. After analyzing the quality of reads with FastQC, low-quality adapters and sequences (Phred index < 30) were removed using Trimmomatic. De novo assembly of reads was performed with SPAdes, employing k-mers of 21, 33, and 55. Open reading frames (ORFs) were identified using Glimmer, Genemark, Genemark.hmm, Genemark S, Prodigal, RAST, and MetaGene. Promoters were identified with PhagePromoter and PHIRE, while FindTerm and RNAold were used to identify Rho-independent terminators. The tRNAs were determined by ARAGORN and tRNAscan-SE. The ability of the phage to establish lysogenic cycles was evaluated using PhageAI and PHACTS. The presence of genes associated with antibiotic resistance was analyzed in the CARD platform (https://card.mcmaster.ca accessed on 17 September 2024) and AMRFinderPlus, while virulence factors were identified through VFDB (www.mgc.ac.cn/VFs/search_VFs.htm accessed on 17 September 2024) and VirulentPred (https://bioinfo.icgeb.res.in/virulent/submit.html accessed on 17 September 2024).

2.10. Statistical Analysis

All statistical analyses were conducted using Minitab 19. Normality assumptions were verified with the Shapiro–Wilk test, and homogeneity of variance was assessed with Levene’s test. Differences in bacteriophage stability under simulated gastrointestinal conditions and bacteriolytic activity were analyzed by repeated-measures ANOVA and two-factor ANOVA, respectively, both followed by Tukey’s post hoc test. Significance was set at p ≤ 0.01. All assays were performed in triplicate.

3. Results

3.1. Isolation of Salmonella and Identification of Genes Associated with Cancer Induction

A total of 37 Salmonella strains were isolated from the wastewater samples, with an average isolation rate of 43%. The high prevalence of this bacterium suggests a significant occurrence of Salmonella in urban wastewater, underscoring the importance of monitoring its presence due to its potential impact on public health risks. These findings are congruent with previous studies that have documented the presence of Salmonella in urban wastewater systems as an indicator of fecal contamination and insufficient water treatment efforts [47,48]. Notably, 17 of the 37 isolates harbored five virulence genes associated with potential cancer induction, specifically avrA, sopB, cdtB, pltA, and pltB (Table 3).
According to numerous studies, Salmonella strains that encode these genes produce effector proteins implicated in chronic inflammation and the induction of precancerous lesions. Although several aspects remain unclear, it is known that the AvrA protein modulates the β-catenin signaling pathway, potentially influencing the regulation, differentiation, and proliferation of intestinal epithelial cells [49]. In contrast, SopB promotes intracellular invasion of Salmonella and inhibits apoptosis [16,50]. Additionally, the cytolethal distending toxin, composed of CdtB, PltA, and PltB proteins, induces DNA damage, which results in genomic instability and a proinflammatory environment associated with precancerous lesions [51]. Consequently, future research will aim to evaluate the pathogenic potential of these strains in cancer promotion.
The detection of Salmonella strains harboring genes associated with cancer induction in wastewater highlights the urgent need for stricter water treatment policies to mitigate the spread of these pathogens and their long-term public health implications.

3.2. Antibiotic Sensitivity Tests

The antimicrobial sensitivity of the 37 Salmonella strains was evaluated against 12 antibiotics commonly used for treating bacterial infections. The results revealed that four (sal01, sal08, sal27, and sal28) of the strains exhibited resistance or intermediate sensitivity to at least three different classes of antibiotics, leading us to categorize them as multidrug-resistant (Table 3). A significantly higher incidence of resistance was observed for colistin (11 strains), followed by nalidixic acid (9 strains), tetracycline (7 strains), and ampicillin (6 strains). The resistance to ciprofloxacin and colistin, two critical antibiotics used the treating severe Salmonella infections, and other bacterial infections, is particularly alarming. These findings are consistent with recent reports from other Latin American regions, which also indicate a rising prevalence of antibiotic-resistant bacterial strains [52,53]. The identification of multidrug-resistant Salmonella strains highlights the need for new strategies to combat antimicrobial resistance. In this context, research into therapeutic alternatives, such as the use of bacteriophages, may offer a promising approach for addressing this growing public health challenge [22].

3.3. Isolation of the Bacteriophage

A total of seven bacteriophages were isolated from wastewater, and the one producing the largest, clearest, and most well-defined lysis plaques was selected for further study. This bacteriophage was designated as Phylax-28 (from the Greek “guard” or “protector), which is capable of producing clear and well-defined lysis plaques, with a diameter of approximately 1.2 cm (Figure 1A). The plaque size generated by Phylax-28 is notably larger than typical Salmonella phages, which are generally reported to form plaques ranging between 0.5 and 3.5 mm in diameter [54,55,56,57].
In addition, Phylax-28 induces the formation of an inhibition halo, a semitransparent zone surrounding the lysis plaques. This phenomenon is consistent with findings by Jurczak-Kurek and coworkers, who noted that phages that produce clear plaques are often associated with a strong lytic activity against bacteria [58]. The appearance of the halo is attributed to the activity of some enzymes, encoded by a certain phage, that degrade the cell wall, thereby enhancing the phage’s potential for bacterial elimination [58].

3.4. Bacteriophage Morphology

Analysis of transmission electron micrographs of 20 virions of Phylax-28 revealed that it has an icosahedral, isometric capsid of 28 ± 0.2 nm in diameter, along with a thin, short, non-contractile, and rigid tail of 8.2 ± 0.1 nm in length (Figure 1B). Based on these morphological features and the criteria established by the International Committee on Viral Taxonomy, the bacteriophage Phylax-28 was classified as a new member of the family Autographiviridae.
Usually, phages with short tails or absent tails, such as Phylax-28, are typically associated with increased resistance to harsh environmental conditions [59,60]. These morphological traits suggest that Phylax-28 may maintain stability under aggressive biophysicochemical conditions, such as those prevailing in the gastrointestinal system. However, further experimental data are required to confirm this hypothesis. Subsequent sections will detail the experimental results of phage stability under these conditions.

3.5. Bacteriophage Replication Curve

Within 5 min of exposure, approximately 80% of Phylax-28 virions were adsorbed on the bacterial surface (Figure 2). Phylax-28 presents a latency period of 15 min, with bacterial lysis occurring at 20 min post-infection, releasing 52 ± 3 virions per bacterial cell.
This burst size observed in Phylax-28 is relatively large compared to other Salmonella-phages, which typically produce between 34 and 37 virions per cell [61,62]. Some Salmonella-infecting phages, however, have been reported to produce larger burst sizes but with longer latency periods [63,64]. The short latency period of Phylax-28 suggests a competitive advantage over other phages, as they can produce enough virions to lyse the bacterium in a short period of time, making it a promising candidate for Salmonella control.

3.6. Host Range

Phylax-28 showed the ability to lyse 21 of the 37 Salmonella strains and 3 strains of E. coli. Bacteriophages capable of lysing two or more bacterial species or diverse strains within a bacterial species, like Phylax-28, are considered to have a broad host range [65]. These bacteriophages are more likely to be chosen as therapeutic agents [66]. However, the therapeutic efficacy of a phage also depends on its specificity. It is essential that phages selectively target pathogenic bacteria without harming bacteria that perform beneficial functions [67]. Notably, Phylax-28 did not exhibit lytic activity against probiotic strains such as Bacillus clausii, Bacillus coagulans, Lactobacillus paracasei, Lactobacillus rhamnosus, and Limosilactobacillus reuteri, an attribute that could prove advantageous for controlling the population of pathogenic bacteria during infection without affecting beneficial bacteria.

3.7. Stability of the Bacteriophage

3.7.1. Storage Stability

An essential criterion for selecting bacteriophages as therapeutic agents is their stability during storage and under the biophysicochemical conditions prevailing at the site of action [39]. For this reason, the storage stability of the Phylax-28 phage was assessed through an accelerated stability assay and validated by monitoring the decrease in phage concentration at 28 °C over six months.
The experimental data on the accelerated stability revealed that the reduction in Phylax-28 concentration followed first-order kinetics, with a correlation coefficient (r) of 0.991 at 70 °C (Figure 3).
The coefficient of determination (r2) for the first-order kinetics was 2.80, higher than the values obtained for the zero-order (2.40) and second-order (2.63) reactions, confirming that the first-order model best described the changes in Phylax-28 concentration. The degradation constant (k), calculated from the experimental data obtained for the stability of Phylax-28 at a temperature of 28 °C over six months was estimated to be 0.045 days−1, while the activation energy (Ea) was 158.6 kJ/mol.
The predictive model suggests that the phage suspension will retain its stable concentration for approximately 92 days at 28 °C before undergoing a 1-logarithm reduction. This prediction is based on the application of the first-order kinetic model together with the Arrhenius equation.
Notably, the experimental results supported the accuracy of this model: after three months of storage at 28 °C, only a 1-logarithm reduction in phage concentration was observed, consistent with model predictions at 94% accuracy. According to Xu et al. (2023) [39], this level of accuracy is considered high. However, the full validation of the model remains ongoing.

3.7.2. Stability in Simulated Gastrointestinal System

Phage Phylax-28 exhibited remarkable stability under simulated gastrointestinal conditions. In the oral phase, no significant reduction in viral concentration was observed, and at the gastric level, the decrease was limited to 1.1 logarithms. Furthermore, the concentration remained stable at the intestinal level in relation to the gastric phase (Figure 4). These finding stand in contrast to those report for coliphage Ace, which experienced a 4-logarithm reduction compared to the initial dose under similar conditions [68]. Additionally, when studying five Salmonella phages, Dlamini et al. (2023) documented reductions ranging from 4.86 to 5.55 logarithms, concluding that these phages would require encapsulation in CaCO3 for therapeutic viability [69]. Similarly, bacteriophage ZCEC5 showed comparable reductions, with the authors recommending microencapsulation in chitosan–alginate for stability [70]. In comparison, Phylax-28 demonstrated superior stability under gastrointestinal conditions, suggesting its potential as a more robust therapeutic agent.

3.8. Capacity of the Bacteriophage to Control Salmonella

3.8.1. In Culture Medium

Under these conditions, Phylax-28 exhibited bacteriolytic activity against Salmonella, achieving a significant reduction in bacterial concentration within 60 min of inoculation compared to normal bacterial growth (p < 0.01). This effect was observed even at low multiplicities of infection (MOI) of 0.01 and 0.001 (Figure 5). These findings are noteworthy, as many phages demonstrate rapid bacteriolytic activity only at higher MOIs. For instance, Ref. [71] reported a significant reduction in bacterial load only when using MOIs of 10 and 100. Phylax-28’s bacteriolytic activity at low MOIs presents a significant advantage for therapeutic applications, as it suggests that lower phage doses may effectively control Salmonella populations. This reduces the potential risk of side effects commonly associated with higher phage doses, offering a safer and more efficient approach to phage therapy.

3.8.2. In Simulated Gastrointestinal System

Salmonella tends to colonize and invade the human intestine [72], making it crucial to evaluate the bacteriophage’s ability to control this pathogen under such conditions. In this regard, the results indicated that Phylax-28 significantly reduced the Salmonella concentration in a simulated intestinal environment (p ≤ 0.01). Moreover, no significant changes were observed in the population of beneficial bacteria due to phage activity (Figure 6).
In contrast, the treatment with ciprofloxacin did not reduce the Salmonella concentration compared to the control, and there was a marked reduction in the population of beneficial bacteria caused by the antibiotic. Meanwhile, in the beneficial bacteria, there was a marked reduction in the concentration due to the action of the antibiotic. These findings are highly relevant, as they suggest that Phylax-28 could potentially control Salmonella without adversely affecting the microbiome, positioning it as a promising tool in precision medicine. However, further studies are necessary to validate these results.

3.9. Bacteriophage Genomics Analysis

The genome of the bacteriophage Phylax-28 consists of linear double-stranded DNA, with a molecular size of 40,989 bp and GC content of 57.81%. It encodes 50 genes, none of which are associated with tRNA. Gene functions were annotated using the NCBI BLAST database (Figure 7).
Gene functions were identified with an e-value of <10−5, sequence coverage exceeding 50%, and identity greater than 85%. The genome is organized into distinct functional modules: a morphogenesis module, containing ten genes responsible for the synthesis of virion structural proteins; a packaging module, comprising four genes involved in DNA encapsulation within the capsid; a DNA processing module, with 13 genes regulating the replication and transcription of genetic material; and a lysis module, consisting of three genes responsible for cell wall degradation and bacterial lysis. The remaining genes encode hypothetical proteins. Critically, for biosafety considerations, no genes related to virulence factors, antimicrobial resistance, or allergenic responses were identified. Moreover, Phylax-28 was classified as strictly lytic, a desirable trait for bacteriophages intended for therapeutic applications [73]. The complete genome sequence of phage Phylax-28 was deposited in GenBank/EMBL/DDBJ under the accession number PQ306468.

4. Conclusions

Phylax-28 demonstrates substantial potential as a therapeutic agent against multidrug-resistant Salmonella strains that encode virulence factors associated with the development of precancerous lesions. In our study, we isolated thirty-seven Salmonella strains, of which seventeen were found to encode genes linked to the promotion of these lesions and displayed resistance to multiple antimicrobial agents, including fluoroquinolones. The isolated bacteriophage, belonging to the Autographiviridae family, exhibited broad lytic activity against Salmonella strains, characterized by a rapid replication cycle and effective reduction in this pathogen’s concentration under simulated gastrointestinal conditions. While further research is necessary to confirm the safety and efficacy of Phylax-28 in clinical settings, preliminary data indicate that it could become a viable biopharmaceutical option for combating antimicrobial-resistant pathogens in the near future. Nevertheless, the reliance on a single bacteriophage poses an increased risk of developing phage-resistant bacterial strains. To mitigate this concern, our research group plans to continue the isolation and characterization of additional bacteriophages, with the goal of developing a multi-phage formulation to enhance the efficacy of Salmonella control.

Author Contributions

L.A., L.L.-R. and M.E.-A. contributed to the experimental design, data collection, and analysis. L.A., L.L.-R., Y.L.-M. and R.G.L.C. provided technical expertise in bacteriophage characterization and bioinformatics analysis. F.P.-L. and J.P. were involved in the microbiological assays and data validation. J.E.L.A. participated in the experimental setup and contributed to the drafting of the manuscript. M.E.-A. was responsible for overseeing the research project, conceptualization, supervision of this study, and manuscript preparation. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by CONAHCYT Mexico through the “Ciencia de Frontera 2019” program, under a project with ID: 1043168. We gratefully acknowledge the financial support from CONAHCYT, which was crucial to the successful completion of this research.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The only new data generated in this study relates to the genomic information of the bacteriophage, which is publicly accessible at NCBI (https://www.ncbi.nlm.nih.gov/nuccore/2814448250) (accessed on 9 October 2024).

Acknowledgments

We would like to express our sincere appreciation to Armando Favela Olivas, Israel Estrada Niebla, Jesús Antonio Núñez, and Zendy Mariela Martínez for their invaluable technical assistance and contributions during the experimental phases. Their expertise and steadfast commitment were crucial to the progress and success of this study.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Ikuta, K.S.; Swetschinski, L.R.; Aguilar, G.R.; Sharara, F.; Mestrovic, T.; Gray, A.P.; Weaver, N.D.; Wool, E.E.; Han, C.; Hayoon, A.G.; et al. Global mortality associated with 33 bacterial pathogens in 2019: A systematic analysis for the Global Burden of Disease Study 2019. Lancet 2022, 400, 2221–2248. [Google Scholar] [CrossRef] [PubMed]
  2. Loftus, M.J.; Everts, R.J.; Cheng, A.C.; Eti, P.; Fakasiieiki, T.; Isaia, L.; Isopo, E.; Jenney, A.W.; Lameko, V.; Leaupepe, H.; et al. Antimicrobial susceptibility of bacterial isolates from clinical specimens in four Pacific Island countries, 2017–2021. Lancet Reg. Health—West. Pac. 2022, 32, 100677. [Google Scholar] [CrossRef] [PubMed]
  3. Murray, C.J.; Ikuta, K.S.; Sharara, F.; Swetschinski, L.; Aguilar, G.R.; Gray, A.; Han, C.; Bisignano, C.; Rao, P.; Wool, E.; et al. Global burden of bacterial antimicrobial resistance in 2019: A systematic analysis. Lancet 2022, 399, 629–655. [Google Scholar] [CrossRef]
  4. Karvanen, M.; Cars, O. The language of antimicrobial and antibiotic resistance is blocking global collective action. Infect. Dis. 2024, 56, 487–495. [Google Scholar] [CrossRef] [PubMed]
  5. Heinzel, M.; Koenig-Archibugi, M. National action on antimicrobial resistance and the political economy of health care. J. Eur. Public Policy 2024, 31, 3981–4007. [Google Scholar] [CrossRef]
  6. WHO. WHO Bacterial Priority Pathogens List, 2024: Bacterial Pathogens of Public Health Importance to Guide Research, Development and Strategies to Prevent and Control Antimicrobial Resistance; World Health Organization: Geneva, Switzerland, 2024; pp. 12–13. [Google Scholar]
  7. Soubeiga, A.P.; Kpoda, D.S.; Compaoré, M.K.; Somda-Belemlougri, A.; Kaseko, N.; Rouamba, S.S.; Ouedraogo, S.; Traoré, R.; Karfo, P.; Nezien, D. Molecular characterization and the antimicrobial resistance profile of Salmonella spp. isolated from ready-to-eat foods in Ouagadougou, Burkina Faso. Int. J. Microbiol. 2022, 2022, 9640828. [Google Scholar] [CrossRef]
  8. Wang, Z.; Zhou, H.; Liu, Y.; Huang, C.; Chen, J.; Siddique, A.; Yin, R.; Jia, C.; Li, Y.; Zhao, G.; et al. Nationwide trends and features of human salmonellosis outbreaks in China. Emerg. Microbes Infect. 2024, 13, 2372364. [Google Scholar] [CrossRef] [PubMed]
  9. Lamichhane, B.; Mawad, A.M.; Saleh, M.; Kelley, W.G.; Harrington, P.J.; Lovestad, C.W.; Amezcua, J.; Sarhan, M.M.; El Zowalaty, M.E.; Ramadan, H. Salmonellosis: An overview of epidemiology, pathogenesis, and innovative approaches to mitigate the antimicrobial resistant infections. Antibiotics 2024, 13, 76. [Google Scholar] [CrossRef]
  10. Scanu, T.; Spaapen, R.M.; Bakker, J.M.; Pratap, C.B.; Wu, L.E.; Hofland, I.; Broeks, A.; Shukla, V.K.; Kumar, M.; Janssen, H. Salmonella manipulation of host signaling pathways provokes cellular transformation associated with gallbladder carcinoma. Cell Host Microbe 2015, 17, 763–774. [Google Scholar] [CrossRef]
  11. Lu, R.; Wu, S.; Zhang, Y.G.; Xia, Y.; Zhou, Z.; Kato, I.; Dong, H.; Bissonnette, M.; Sun, J. Salmonella protein AvrA activates the STAT3 signaling pathway in colon cancer. Neoplasia 2016, 18, 307–316. [Google Scholar] [CrossRef]
  12. de Savornin Lohman, E.; Duijster, J.; Groot Koerkamp, B.; van der Post, R.; Franz, E.; Mughini Gras, L.; de Reuver, P. Severe Salmonella spp. or Campylobacter spp. infection and the risk of biliary tract cancer: A population-based study. Cancers 2020, 12, 3348. [Google Scholar] [CrossRef] [PubMed]
  13. Wang, D.N.; Ni, J.J.; Li, J.H.; Gao, Y.Q.; Ni, F.J.; Zhang, Z.Z.; Fang, J.Y.; Lu, J.; Yao, Y.F. Bacterial infection promotes tumorigenesis of colorectal cancer via regulating CDC42 acetylation. PLoS Pathog. 2023, 19, e1011189. [Google Scholar] [CrossRef] [PubMed]
  14. Lopez Chiloeches, M.; Bergonzini, A.; Martin, O.C.; Bergstein, N.; Erttmann, S.F.; Aung, K.M.; Gekara, N.O.; Avila Cariño, J.F.; Pateras, I.S.; Frisan, T. Genotoxin-producing Salmonella enterica induces tissue-specific types of DNA damage and DNA damage response outcomes. Front. Immunol. 2023, 14, 1270449. [Google Scholar] [CrossRef]
  15. Lu, R.; Bosland, M.; Xia, Y.; Zhang, Y.G.; Kato, I.; Sun, J. Presence of Salmonella AvrA in colorectal tumor and its precursor lesions in mouse intestine and human specimens. Oncotarget 2017, 8, 55104. [Google Scholar] [CrossRef] [PubMed]
  16. Zhao, S.; Xu, Q.; Cui, Y.; Yao, S.; Jin, S.; Zhang, Q.; Wen, Z.; Ruan, H.; Liang, X.; Chao, Y.; et al. Salmonella effector SopB reorganizes cytoskeletal vimentin to maintain replication vacuoles for efficient infection. Nat. Commun. 2023, 14, 478. [Google Scholar] [CrossRef]
  17. ElGhazaly, M.; Collins, M.O.; Ibler, A.E.M.; Humphreys, D. Typhoid toxin hijacks Wnt5a to establish host senescence and Salmonella infection. Cell Rep. 2023, 42, 113181. [Google Scholar] [CrossRef]
  18. Shukla, R.; Shukla, P.; Behari, A.; Khetan, D.; Chaudhary, R.K.; Tsuchiya, Y.; Ikoma, T.; Asai, T.; Nakamura, K.; Kapoor, V.K. Roles of Salmonella typhi and Salmonella paratyphi in gallbladder cancer development. Asian Pac. J. Cancer Prev. 2021, 22, 509–516. [Google Scholar] [CrossRef]
  19. Mughini-Gras, L.; Schaapveld, M.; Kramers, J.; Mooij, S.; Neefjes-Borst, E.A.; Pelt, W.V.; Neefjes, J. Increased colon cancer risk after severe Salmonella infection. PLoS ONE 2018, 13, e0189721. [Google Scholar] [CrossRef]
  20. Onallah, H.; Hazan, R.; Nir-Paz, R. Compassionate use of bacteriophages for failed persistent infections during the first 5 years of the Israeli Phage Therapy Center. Open Forum Infect. Dis. 2023, 10, ofad221. [Google Scholar] [CrossRef]
  21. Zaki, B.M.; Fahmy, N.A.; Aziz, R.K.; Samir, R.; El-Shibiny, A. Characterization and comprehensive genome analysis of novel bacteriophage, vB_Kpn_ZCKp20p, with lytic and anti-biofilm potential against clinical multidrug-resistant Klebsiella pneumoniae. Front. Cell. Infect. Microbiol. 2023, 13, 1077995. [Google Scholar] [CrossRef]
  22. Ferreira, R.; Sousa, C.; Gonçalves, R.F.; Pinheiro, A.C.; Oleastro, M.; Wagemans, J.; Lavigne, R.; Figueiredo, C.; Azeredo, J.; Melo, L.D. Characterization and genomic analysis of a new phage infecting Helicobacter pylori. Int. J. Mol. Sci. 2022, 23, 7885. [Google Scholar] [CrossRef]
  23. Principi, N.; Silvestri, E.; Esposito, S. Advantages and limitations of bacteriophages for the treatment of bacterial infections. Front. Pharmacology 2019, 10, 457104. [Google Scholar]
  24. Gindin, M.; Febvre, H.P.; Rao, S.; Wallace, T.C.; Weir, T.L. bacteriophage for gastrointestinal health (PHAGE) study: Evaluating the safety and tolerability of supplemental bacteriophage consumption. J. Am. Coll. Nutr. 2019, 38, 68–75. [Google Scholar] [CrossRef] [PubMed]
  25. Krysiak-Baltyn, K.; Martin, G.J.O.; Gras, S.L. Computational modelling of large scale phage production using a two-stage batch process. Pharmaceuticals 2018, 11, 31. [Google Scholar] [CrossRef] [PubMed]
  26. Castillo, D.; Kauffman, K.; Hussain, F.; Kalatzis, P.; Rørbo, N.; Polz, M.F.; Middelboe, M. Widespread distribution of prophage-encoded virulence factors in marine Vibrio communities. Sci. Rep. 2018, 8, 9973. [Google Scholar] [CrossRef] [PubMed]
  27. Flint, R.; Laucirica, D.R.; Chan, H.K.; Chang, B.J.; Stick, S.M.; Kicic, A. Stability considerations for bacteriophages in liquid formulations designed for nebulization. Cells 2023, 12, 2057. [Google Scholar] [CrossRef]
  28. Berkson, J.D.; Wate, C.E.; Allen, G.B.; Schubert, A.M.; Dunbar, K.E.; Coryell, M.P.; Sava, R.L.; Gao, Y.; Hastie, J.L.; Smith, E.M.; et al. Phage-specific immunity impairs efficacy of bacteriophage targeting vancomycin resistant Enterococcus in a murine model. Nat. Commun. 2024, 15, 2993. [Google Scholar] [CrossRef]
  29. Liu, P.; Ibaraki, M.; Kapoor, R.; Amin, N.; Das, A.; Miah, R. Development of moore swab and ultrafiltration concentration and detection methods for Salmonella typhi and Salmonella paratyphi A in wastewater and application in Kolkata, India and Dhaka, Bangladesh. Front. Microbiol. 2021, 12, 684094. [Google Scholar] [CrossRef]
  30. Yanestria, S.M.; Rahmaniar, R.P.; Wibisono, F.J.; Effendi, M.H. Detection of invA gene of Salmonella from milkfish (Chanos chanos) at Sidoarjo wet fish market, Indonesia, using polymerase chain reaction technique. Vet. World 2019, 12, 170–175. [Google Scholar] [CrossRef]
  31. Alshaheeb, Z.A.; Thabit, Z.A.; Oraibi, A.G.; Baioumy, A.A.; Abedelmaksoud, T.G. Salmonella enterica species isolated from local foodstuff and patients suffering from foodborne illness: Surveillance, antimicrobial resistance and molecular detection. Theory Pract. Meat Process. 2023, 8, 112–123. [Google Scholar] [CrossRef]
  32. Hawwas, H.A.E.H.; Aboueisha, A.K.M.; Fadel, H.M.; El-Mahallawy, H.S. Salmonella serovars in sheep and goats and their probable zoonotic potential to humans in Suez Canal Area, Egypt. Acta Vet. Scand. 2022, 64, 17. [Google Scholar] [CrossRef] [PubMed]
  33. Mezal, E.H.; Bae, D.; Khan, A.A. Detection and functionality of the CdtB, PltA, and PltB from Salmonella enterica serovar Javiana. Pathog. Dis. 2014, 72, 95–103. [Google Scholar] [PubMed]
  34. CLSI. Performance Standards for Antimicrobial Disk Susceptibility Tests, 14th ed.; CLSI standard M02; Clinical and Laboratory Standards Institute: Berwyn, PA, USA, 2024. [Google Scholar]
  35. Ikner, L.A.; Soto-Beltran, M.; Bright, K.R. New method using a positively charged microporous filter and ultrafiltration for concentration of viruses from tap water. Appl. Environ. Microbiol. 2011, 77, 3500–3506. [Google Scholar] [CrossRef]
  36. Li, C.; Yuan, X.; Li, N.; Wang, J.; Yu, S.; Zeng, H.; Zhang, J.; Wu, Q.; Ding, Y. Isolation and characterization of Bacillus cereus phage vb_bcep-dlc1 reveals the largest member of the Φ29-like phages. Microorganisms 2020, 8, 1750. [Google Scholar] [CrossRef]
  37. Le Guellec, S.; Pardessus, J.; Bodier-Montagutelli, E.; L’hostis, G.; Dalloneau, E.; Piel, D.; Samaï, H.C.; Guillon, A.; Mujic, E.; Guillot-Combe, E. Administration of bacteriophages via nebulization during mechanical ventilation: In vitro study and lung deposition in macaques. Viruses 2023, 15, 602. [Google Scholar] [CrossRef]
  38. Kabwe, M.; Brown, T.; Speirs, L.; Ku, H.; Leach, M.; Chan, H.T.; Petrovski, S.; Lock, P.; Tucci, J. Novel bacteriophages capable of disrupting biofilms from clinical strains of Aeromonas hydrophila. Front. Microbiol. 2020, 11, 194. [Google Scholar] [CrossRef]
  39. Xu, Z.; Ding, Z.; Zhang, Y.; Liu, X.; Wang, Q.; Shao, S.; Liu, Q. Shelf-life prediction and storage stability of Aeromonas bacteriophage vB_AsM_ZHF. Virus Res. 2023, 323, 198997. [Google Scholar] [CrossRef]
  40. Mulet-Cabero, A.I.; Egger, L.; Portmann, R.; Ménard, O.; Marze, S.; Minekus, M.; Le Feunteun, S.; Sarkar, A.; Grundy, M.M.L.; Carrière, F.; et al. A standardised semi-dynamic: In vitro digestion method suitable for food-an international consensus. Food Funct. 2020, 11, 1702–1720. [Google Scholar] [PubMed]
  41. Sonalika, J.; Srujana, A.S.; Akhila, D.S.; Juliet, M.R.; Santhosh, K.S. Application of bacteriophages to control Salmonella enteritidis in raw eggs. Iran. J. Vet. Res. 2020, 21, 221. [Google Scholar]
  42. Akritidou, T.; Akkermans, S.; Smet, C.; Delens, V.; Van Impe, J.F.M. Effect of food structure and buffering capacity on pathogen survival during in vitro digestion. Food Res. Int. 2023, 164, 112305. [Google Scholar] [CrossRef]
  43. Cieplak, T.; Soffer, N.; Sulakvelidze, A.; Nielsen, D.S. A bacteriophage cocktail targeting Escherichia coli reduces E. coli in simulated gut conditions, while preserving a non-targeted representative commensal normal microbiota. Gut Microbes 2018, 9, 391–399. [Google Scholar] [PubMed]
  44. Sambrook, J.; Russell, D.W. Extraction of Bacteriophage λ DNA from Large-scale Cultures Using Proteinase K and SDS. Cold Spring Harb. Protoc. 2006, 1, pdb-prot3972. [Google Scholar] [CrossRef] [PubMed]
  45. Philipson, C.W.; Voegtly, L.J.; Lueder, M.R.; Long, K.A.; Rice, G.K.; Frey, K.G.; Biswas, B.; Cer, R.Z.; Hamilton, T.; Bishop-Lilly, K.A. Characterizing phage genomes for therapeutic applications. Viruses 2018, 10, 188. [Google Scholar] [CrossRef]
  46. Turner, D.; Adriaenssens, E.M.; Tolstoy, I.; Kropinski, A.M. Phage annotation guide: Guidelines for assembly and high-quality annotation. PHAGE Ther. Appl. Res. 2021, 2, 170–182. [Google Scholar] [CrossRef]
  47. Diemert, S.; Yan, T. Municipal wastewater surveillance revealed a high community disease burden of a rarely reported and possibly subclinical Salmonella enterica serovar derby strain. Appl. Environ. Microbiol. 2020, 86, e00814-20. [Google Scholar] [CrossRef] [PubMed]
  48. Martone-Rocha, S.; Dropa, M.; da Cruz, B.M.C.; Leite, D.B.M.O.; dos Santos, T.P.; Razzolini, M.T.P. Antimicrobial profile of non-typhoidal Salmonella isolated from raw sewage in the Metropolitan Region of São Paulo, Brazil. J. Infect. Dev. Ctries. 2023, 17, 86–92. [Google Scholar] [CrossRef]
  49. Dougherty, M.W.; Jobin, C. Intestinal bacteria and colorectal cancer: Etiology and treatment. Gut Microbes 2023, 15, 2185028. [Google Scholar] [CrossRef]
  50. Ruan, H.; Zhang, Z.; Tian, L.; Wang, S.; Hu, S.; Qiao, J.J. The Salmonella effector SopB prevents ROS-induced apoptosis of epithelial cells by retarding TRAF6 recruitment to mitochondria. Biochem. Biophys. Res. Commun. 2016, 478, 618–623. [Google Scholar] [CrossRef]
  51. Sepe, L.P.; Hartl, K.; Iftekhar, A.; Berger, H.; Kumar, N.; Goosmann, C.; Chopra, S.; Schmidt, S.C.; Gurumurthy, R.K.; Meyer, T.F. Genotoxic effect of Salmonella paratyphi a infection on human primary gallbladder cells. mBio 2020, 11, 1–39. [Google Scholar] [CrossRef]
  52. Castellanos, L.R.; van Der Graaf-van Bloois, L.; Donado-Godoy, P.; Veldman, K.; Duarte, F.; Acuña, M.; Jarquín, C.; Weill, F.X.; Mevius, D.; Wagenaar, J.; et al. Antimicrobial resistance in Salmonella enterica serovar paratyphi B variant Java in poultry from Europe and Latin America. Emerg. Infect. Dis. 2020, 26, 1164–1173. [Google Scholar] [CrossRef]
  53. Amancha, G.; Celis, Y.; Irazabal, J.; Falconi, M.; Villacis, K.; Thekkur, P.; Nair, D.; Perez, F.; Verdonck, K. High levels of antimicrobial resistance in Escherichia coli and Salmonella from poultry in Ecuador. Rev. Panam. De Salud Publica/Pan Am. J. Public Health 2023, 47, e15. [Google Scholar] [CrossRef] [PubMed]
  54. Zhang, Y.; Chu, M.; Liao, Y.T.; Salvador, A.; Wu, V.C.H. Characterization of two novel Salmonella phages having biocontrol potential against Salmonella spp. in gastrointestinal conditions. Sci. Rep. 2024, 14, 12294. [Google Scholar] [CrossRef] [PubMed]
  55. Ge, H.; Xu, Y.; Hu, M.; Zhang, K.; Zhang, S.; Chen, X. Isolation, characterization, and application in poultry products of a Salmonella-specific bacteriophage, S55. J. Food Prot. 2021, 84, 1202–1212. [Google Scholar] [CrossRef] [PubMed]
  56. Islam, M.S.; Hu, Y.; Mizan, M.F.R.; Yan, T.; Nime, I.; Zhou, Y.; Li, J. Characterization of Salmonella phage LPST153 that effectively targets most prevalent Salmonella serovars. Microorganisms 2020, 8, 1089. [Google Scholar] [CrossRef] [PubMed]
  57. Teklemariam, A.D.; Alharbi, M.G.; Al-Hindi, R.R.; Alotibi, I.; Aljaddawi, A.A.; Azhari, S.A.; Esmael, A. Isolation and characterization of Chi-like Salmonella bacteriophages infecting two Salmonella enterica Serovars, Typhimurium and Enteritidis. Pathogens 2022, 11, 1480. [Google Scholar] [CrossRef]
  58. Jurczak-Kurek, A.; Gąsior, T.; Nejman-Faleńczyk, B.; Bloch, S.; Dydecka, A.; Topka, G.; Necel, A.; Jakubowska-Deredas, M.; Narajczyk, M.; Richert, M. Biodiversity of bacteriophages: Morphological and biological properties of a large group of phages isolated from urban sewage. Sci. Rep. 2016, 6, 34338. [Google Scholar] [CrossRef]
  59. Elsayed, M.M.; Elkenany, R.M.; EL-Khateeb, A.Y.; Nabil, N.M.; Tawakol, M.M.; Hassan, H.M. Isolation and encapsulation of bacteriophage with chitosan nanoparticles for biocontrol of multidrug-resistant methicillin-resistant Staphylococcus aureus isolated from broiler poultry farms. Sci. Rep. 2024, 14, 4702. [Google Scholar] [CrossRef]
  60. Wójcicki, M.; Średnicka, P.; Błażejak, S.; Gientka, I.; Kowalczyk, M.; Emanowicz, P.; Świder, O.; Sokołowska, B.; Juszczuk-Kubiak, E. Characterization and genome study of novel lytic bacteriophages against prevailing saprophytic bacterial microflora of minimally processed plant-based food products. Int. J. Mol. Sci. 2021, 22, 12460. [Google Scholar] [CrossRef]
  61. Unverdi, A.; Erol, H.B.; Kaskatepe, B.; Babacan, O. Characterization of Salmonella phages isolated from poultry coops and its effect with nisin on food bio-control. Food Sci. Nutr. 2024, 12, 2760–2771. [Google Scholar] [CrossRef]
  62. Jeon, G.; Ahn, J. Evaluation of phage adsorption to Salmonella Typhimurium exposed to different levels of pH and antibiotic. Microb. Pathog. 2021, 150, 12460. [Google Scholar] [CrossRef]
  63. Shang, Y.; Sun, Q.; Chen, H.; Wu, Q.; Chen, M.; Yang, S.; Du, M.; Zha, F.; Ye, Q.; Zhang, J. Isolation and characterization of a novel Salmonella phage vB_SalP_TR2. Front. Microbiol. 2021, 12, 664810. [Google Scholar] [CrossRef]
  64. Khan, M.A.S.; Islam, Z.; Barua, C.; Sarkar, M.M.H.; Ahmed, M.F.; Rahman, S.R. Phenotypic characterization and genomic analysis of a Salmonella phage L223 for biocontrol of Salmonella spp. in poultry. Sci. Rep. 2024, 14, 15347. [Google Scholar] [CrossRef] [PubMed]
  65. Holtappels, D.; Alfenas-Zerbini, P.; Koskella, B. Drivers and consequences of bacteriophage host range. FEMS Microbiol. Rev. 2023, 47, fuad038. [Google Scholar] [CrossRef] [PubMed]
  66. Whittle, M.J.; Bilverstone, T.W.; Van Esveld, R.J.; Lücke, A.C.; Lister, M.M.; Kuehne, S.A.; Minton, N.P. A novel bacteriophage with broad host range against Clostridioides difficile ribotype 078 supports slpa as the likely phage receptor. Microbiol. Spectr. 2022, 10, e02295-21. [Google Scholar] [CrossRef] [PubMed]
  67. Suleman, M.; Clark, J.R.; Bull, S.; Jones, J.D. Ethical argument for establishing good manufacturing practice for phage therapy in the UK. J. Med. Ethics 2024, 10. [Google Scholar] [CrossRef] [PubMed]
  68. Pinto, G.; Shetty, S.A.; Zoetendal, E.G.; Gonçalves, R.F.; Pinheiro, A.C.; Almeida, C.; Azeredo, J.; Smidt, H. An in vitro fermentation model to study the impact of bacteriophages targeting Shiga toxin-encoding Escherichia coli on the colonic microbiota. NPJ Biofilms Microbiomes 2022, 8, 74. [Google Scholar] [CrossRef]
  69. Dlamini, S.B.; Gigante, A.M.; Hooton, S.P.T.; Atterbury, R.J. Efficacy of different encapsulation techniques on the viability and stability of diverse phage under simulated gastric conditions. Microorganisms 2023, 11, 2389. [Google Scholar] [CrossRef]
  70. Abdelsattar, A.S.; Abdelrahman, F.; Dawoud, A.; Connerton, I.F.; El-Shibiny, A. Encapsulation of E. coli phage ZCEC5 in chitosan–alginate beads as a delivery system in phage therapy. AMB Express 2019, 9, 87. [Google Scholar] [CrossRef]
  71. Chen, C.; Tao, Z.; Li, T.; Chen, H.; Zhao, Y.; Sun, X. Isolation and characterization of novel bacteriophage vB_KpP_HS106 for Klebsiella pneumonia K2 and applications in foods. Front. Microbiol. 2023, 14, 1227147. [Google Scholar] [CrossRef]
  72. Harrell, J.E.; Hahn, M.M.; D’Souza, S.J.; Vasicek, E.M.; Sandala, J.L.; Gunn, J.S.; McLachlan, J.B. Salmonella biofilm formation, chronic infection, and immunity within the intestine and hepatobiliary tract. Front. Cell. Infect. Microbiol. 2021, 10, 624622. [Google Scholar]
  73. Fernández, L.; Gutiérrez, D.; García, P.; Rodríguez, A. The perfect bacteriophage for therapeutic applications—A quick guide. Antibiotics 2019, 8, 126. [Google Scholar] [CrossRef] [PubMed]
Viruses 16 01711 g001
Figure 1. (A) Morphology of lysis plaques and (B) structural features of Phylax-28 bacteriophage virions. The clarity and size of the plaques reflect the lytic activity and efficacy of the bacteriophage against Salmonella. The virions exhibit an icosahedral structure, characterized by a capsid composed of 20 equidistant triangular faces. The phage tails are subtly perceptible and are indicated by the red arrows.
Figure 1. (A) Morphology of lysis plaques and (B) structural features of Phylax-28 bacteriophage virions. The clarity and size of the plaques reflect the lytic activity and efficacy of the bacteriophage against Salmonella. The virions exhibit an icosahedral structure, characterized by a capsid composed of 20 equidistant triangular faces. The phage tails are subtly perceptible and are indicated by the red arrows.
Viruses 16 01711 g001
Viruses 16 01711 g002
Figure 2. Replication curve of bacteriophage Phylax-28 using Salmonella as the host bacterium. The replication dynamics are depicted under two conditions: with chloroform (blue line), which indicates the formation of intracellular virions, and without chloroform (black line), which shows the release of virions into the extracellular medium.
Figure 2. Replication curve of bacteriophage Phylax-28 using Salmonella as the host bacterium. The replication dynamics are depicted under two conditions: with chloroform (blue line), which indicates the formation of intracellular virions, and without chloroform (black line), which shows the release of virions into the extracellular medium.
Viruses 16 01711 g002
Viruses 16 01711 g003
Figure 3. Kinetics of Phylax-28 bacteriophage concentration reduction at various temperatures. (A) No significant reduction was observed at 60 °C (black line) and 65 °C (blue line). However, at 70 °C (green line), the reduction follows first-order kinetics with an r2 value of 0.991. (B) Experimental results on the stability of Phylax-28 at 28 °C, measured monthly over six months, were compared with the model’s predicted stability. The phage concentration is expressed as the log10 of PFU/mL. The model’s accuracy was expressed as a percentage.
Figure 3. Kinetics of Phylax-28 bacteriophage concentration reduction at various temperatures. (A) No significant reduction was observed at 60 °C (black line) and 65 °C (blue line). However, at 70 °C (green line), the reduction follows first-order kinetics with an r2 value of 0.991. (B) Experimental results on the stability of Phylax-28 at 28 °C, measured monthly over six months, were compared with the model’s predicted stability. The phage concentration is expressed as the log10 of PFU/mL. The model’s accuracy was expressed as a percentage.
Viruses 16 01711 g003
Viruses 16 01711 g004
Figure 4. Stability of Phylax-28 bacteriophage under simulated gastrointestinal conditions. In the oral cavity, no significant reduction in phage concentration was observed, indicating high stability in this phase. A slight loss of viability was noted in the gastric environment, but the phage retained functionality. In the intestinal phase, the phage concentration remained stable with no significant changes. The different letters appearing above the bars in the graph indicate that there are statistically significant differences among the treatments. Error bars represent the standard deviation of the measurements, reflecting variability across replicate experiments.
Figure 4. Stability of Phylax-28 bacteriophage under simulated gastrointestinal conditions. In the oral cavity, no significant reduction in phage concentration was observed, indicating high stability in this phase. A slight loss of viability was noted in the gastric environment, but the phage retained functionality. In the intestinal phase, the phage concentration remained stable with no significant changes. The different letters appearing above the bars in the graph indicate that there are statistically significant differences among the treatments. Error bars represent the standard deviation of the measurements, reflecting variability across replicate experiments.
Viruses 16 01711 g004
Viruses 16 01711 g005
Figure 5. The lytic activity of bacteriophage Phylax-28 against Salmonella in trypticase soy broth (TSB). The red line indicates the normal growth of Salmonella without bacteriophage treatment, serving as the control. The black, green, and blue lines represent treatments with Phylax-28 at multiplicities of infection (MOI) of 0.1, 0.01, and 0.001, respectively. A significant reduction in bacterial growth is observed across all MOI levels, with Phylax-28 showing pronounced efficacy in reducing Salmonella concentrations, even at the lowest MOI.
Figure 5. The lytic activity of bacteriophage Phylax-28 against Salmonella in trypticase soy broth (TSB). The red line indicates the normal growth of Salmonella without bacteriophage treatment, serving as the control. The black, green, and blue lines represent treatments with Phylax-28 at multiplicities of infection (MOI) of 0.1, 0.01, and 0.001, respectively. A significant reduction in bacterial growth is observed across all MOI levels, with Phylax-28 showing pronounced efficacy in reducing Salmonella concentrations, even at the lowest MOI.
Viruses 16 01711 g005
Viruses 16 01711 g006
Figure 6. Effect of bacteriophage and ciprofloxacin on the concentration of Salmonella and probiotic bacteria in a simulated intestinal environment. The graph displays Salmonella growth (red line) in the absence of ciprofloxacin, Salmonella in the presence of ciprofloxacin (black line), probiotic bacteria without ciprofloxacin (dashed green line), probiotic bacteria with ciprofloxacin (dashed dark blue line), Salmonella in the presence of bacteriophage (dotted light blue line), and probiotic bacteria with bacteriophage (dotted dark green line). The probiotic bacteria used includes five strains: Bacillus clausii, Bacillus coagulans, Lactobacillus paracasei, Lactobacillus rhamnosus, and Limosilactobacillus reuteri, mixed in equal proportions. The magnitude of error bars, represented as standard deviation, are not discernible on the graph.
Figure 6. Effect of bacteriophage and ciprofloxacin on the concentration of Salmonella and probiotic bacteria in a simulated intestinal environment. The graph displays Salmonella growth (red line) in the absence of ciprofloxacin, Salmonella in the presence of ciprofloxacin (black line), probiotic bacteria without ciprofloxacin (dashed green line), probiotic bacteria with ciprofloxacin (dashed dark blue line), Salmonella in the presence of bacteriophage (dotted light blue line), and probiotic bacteria with bacteriophage (dotted dark green line). The probiotic bacteria used includes five strains: Bacillus clausii, Bacillus coagulans, Lactobacillus paracasei, Lactobacillus rhamnosus, and Limosilactobacillus reuteri, mixed in equal proportions. The magnitude of error bars, represented as standard deviation, are not discernible on the graph.
Viruses 16 01711 g006
Viruses 16 01711 g007
Figure 7. Graphical representation of the genome of bacteriophage Phylax-28. Arrows indicate the genes encoded within the genome, with the function of each gene illustrated by a color. No genes encoding virulence factors, mechanisms for lysogenic cycle establishment, or allergenicity-related genes were identified.
Figure 7. Graphical representation of the genome of bacteriophage Phylax-28. Arrows indicate the genes encoded within the genome, with the function of each gene illustrated by a color. No genes encoding virulence factors, mechanisms for lysogenic cycle establishment, or allergenicity-related genes were identified.
Viruses 16 01711 g007
Table 1. List of oligonucleotide sequences used for the amplification of genes in Salmonella strains encoding effector proteins linked to the promotion of precancerous lesions and tumorigenesis.
Table 1. List of oligonucleotide sequences used for the amplification of genes in Salmonella strains encoding effector proteins linked to the promotion of precancerous lesions and tumorigenesis.
OligonucleotideSequenceGeneFragment Size (bp)
AvrA-FCCTGTATTGTTGAGCGTCTGGavrA422
AvrA-RAGAAGAGCTTCGTTGAATGTCC
SopB-FTCAGAAGRCGTCTAACCACTCsopB517
SopB-RTACCGTCCTCATGCACACTC
CdtB-FGAAACAAGTCAGGCATTGCCcdtB819
CdtB-RGAATGGCTCATAAACACGCC
PltA-FGTGGGACTATCATCGTGCAGpltA729
PltA-RAGGGTGATCAACGTAACCAC
PltB-FGCCGGAAGTACCTGTGTTATpltB414
PltB-RAGTAGTGAAAACCCATCGCG
Table 2. Composition of fluids in each phase of the simulated gastrointestinal tract.
Table 2. Composition of fluids in each phase of the simulated gastrointestinal tract.
ReagentOral Phase (mmol/L)Gastric Phase (mmol/L)Intestinal Phase (mmol/L)
KCl15.16.96.8
KH2PO43.70.90.8
NaHCO313.62585
NaCl-47.238.4
MgCl2(H2O)60.150.120.33
(NH4)2CO30.060.5-
CaCl2(H2O)21.50.150.6
Enzymes
α-amylase150 U/mL--
Pepsin-4000 U/mL-
Lipase-120 U/mL-
Pancreatin--200 U/mL (based on trypsin activity)
Bile salts--10 mM
Table 3. Antimicrobial resistance profiles and virulence factors of Salmonella strains isolated from urban wastewater. IMP, imipenem; SXT, trimethoprim–sulfamethoxazole; GEN, gentamicin; AMP, ampicillin; CIP, ciprofloxacin; NAL, nalidixic acid; CHL, chloramphenicol; TET, tetracycline; COL, colistin; AMC, amoxicillin–clavulanate; CFP, cefoperazone; AMK, amikacin. The symbol ‘+’ indicates that the strain carries the virulence gene listed in the table header, while the symbol ‘-’ signifies that the gene was not detected in the strain.
Table 3. Antimicrobial resistance profiles and virulence factors of Salmonella strains isolated from urban wastewater. IMP, imipenem; SXT, trimethoprim–sulfamethoxazole; GEN, gentamicin; AMP, ampicillin; CIP, ciprofloxacin; NAL, nalidixic acid; CHL, chloramphenicol; TET, tetracycline; COL, colistin; AMC, amoxicillin–clavulanate; CFP, cefoperazone; AMK, amikacin. The symbol ‘+’ indicates that the strain carries the virulence gene listed in the table header, while the symbol ‘-’ signifies that the gene was not detected in the strain.
Antimicrobials and Average Inhibition Diameter (mm)Virulence Genes Associated with the Potential to Induce Precancerous Lesions
Bacterial StrainIMPSXTGENAMPCIPNALCHLTETCOLAMCCFPAMKavrAsopBcdtBpltApltB
Salmonella sal0126211615161424198212417-++-+
Salmonella sal0226241819252125229102418+++++
Salmonella sal0322181916222117198172219+-+++
Salmonella sal0425241814221722187182118+-+-+
Salmonella sal0529262122312123208222419+++++
Salmonella sal0626221821302123209221717+---+
Salmonella sal0727251821312131192017816+++++
Salmonella sal0815181715141221278221919+-+++
Salmonella sal0929252331222429924192519+++++
Salmonella sal1026241823302226229222419+++--
Salmonella sal1126251621292024199222619+++++
Salmonella sal1226241821252125229232418+++++
Salmonella sal1322221921302124199212219+-+-+
Salmonella sal1425231822322222189222818+--++
Salmonella sal1529202122312123208222419+++++
Salmonella sal1626241821302123209222317++++-
Salmonella sal1721191221222131212518822+-+++
Salmonella sal1925261722322021278222319+++++
Salmonella sal20221816211920181910182620+++++
Salmonella sal2126241821252124229232418+++++
Salmonella sal2122241921302122199212219+-++-
Salmonella sal2325241822322222189222818+++++
Salmonella sal2429262122312123208222419+-+++
Salmonella sal2526241821302123209222317+++++
Salmonella sal2621191821152131211518821+-+++
Salmonella sal2722261718171221278222319+-+++
Salmonella sal28121413149122098101413+++++
Salmonella sal2926241823302226229222419+-+-+
Salmonella sal3026251621292024199222618+++++
Salmonella sal3119201817141917229191618+++++
Salmonella sal3218161718181620199192219+-+++
Salmonella sal3324241822322222189222818+-+++
Salmonella sal3426222122312123208222419+++++
Salmonella sal3526241821302123209222317+++-+
Salmonella sal3621251821312131212518822+++++
Salmonella sal3725181722321418168222312+++-+
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Amarillas, L.; Padilla-Lafarga, F.; León Chan, R.G.; Padilla, J.; Lugo-Melchor, Y.; López Avendaño, J.E.; Lightbourn-Rojas, L.; Estrada-Acosta, M. Isolation and Characterization of a Bacteriophage with Potential for the Control of Multidrug-Resistant Salmonella Strains Encoding Virulence Factors Associated with the Promotion of Precancerous Lesions. Viruses 2024, 16, 1711. https://doi.org/10.3390/v16111711

AMA Style

Amarillas L, Padilla-Lafarga F, León Chan RG, Padilla J, Lugo-Melchor Y, López Avendaño JE, Lightbourn-Rojas L, Estrada-Acosta M. Isolation and Characterization of a Bacteriophage with Potential for the Control of Multidrug-Resistant Salmonella Strains Encoding Virulence Factors Associated with the Promotion of Precancerous Lesions. Viruses. 2024; 16(11):1711. https://doi.org/10.3390/v16111711

Chicago/Turabian Style

Amarillas, Luis, Fedra Padilla-Lafarga, Rubén Gerardo León Chan, Jorge Padilla, Yadira Lugo-Melchor, Jesús Enrique López Avendaño, Luis Lightbourn-Rojas, and Mitzi Estrada-Acosta. 2024. "Isolation and Characterization of a Bacteriophage with Potential for the Control of Multidrug-Resistant Salmonella Strains Encoding Virulence Factors Associated with the Promotion of Precancerous Lesions" Viruses 16, no. 11: 1711. https://doi.org/10.3390/v16111711

APA Style

Amarillas, L., Padilla-Lafarga, F., León Chan, R. G., Padilla, J., Lugo-Melchor, Y., López Avendaño, J. E., Lightbourn-Rojas, L., & Estrada-Acosta, M. (2024). Isolation and Characterization of a Bacteriophage with Potential for the Control of Multidrug-Resistant Salmonella Strains Encoding Virulence Factors Associated with the Promotion of Precancerous Lesions. Viruses, 16(11), 1711. https://doi.org/10.3390/v16111711

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop