Next Article in Journal
Adenovirus-Mediated Expression of Dengue Virus 2 Envelope Ferritin Nanoparticles Induced Virus-Specific Immune Responses in BALB/c Mice
Previous Article in Journal
Unveiling the Full Protein Effectorome of the Black Sigatoka Pathogen Pseudocercospora fijiensis—An In Silico Approach
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microbiology Research
Volume 15
Issue 3
10.3390/microbiolres15030127
microbiolres-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Nitrogen Fixation, Carbohydrate Contents, and Bacterial Microbiota in Unelongated Stem of Manure Compost-Applied Rice at Panicle Initiation

by
Zhalaga Ao
1,
Miu Tsuchiya
2,
Juan Xia
1,
Chie Hayakawa
3,
Yukitsugu Takahashi
4,
Hideaki Hirai
3 and
Isamu Maeda
1,2,*
1
Department of Applied Life Science, United Graduate School of Agricultural Science, Tokyo University of Agriculture and Technology, Fuchu 183-8509, Japan
2
Department of Applied Biological Chemistry, School of Agriculture, Utsunomiya University, Utsunomiya 321-8505, Japan
3
Department of Agrobiology and Bioresources, School of Agriculture, Utsunomiya University, Utsunomiya 321-8505, Japan
4
University Farm, School of Agriculture, Utsunomiya University, Moka 321-4415, Japan
*
Author to whom correspondence should be addressed.
Microbiol. Res. 2024, 15(3), 1900-1912; https://doi.org/10.3390/microbiolres15030127
Submission received: 5 July 2024 / Revised: 24 August 2024 / Accepted: 11 September 2024 / Published: 15 September 2024
Browse Figures
Review Reports Versions Notes

Abstract

:
In rice, symbiotic N2 fixation via nodule bacteroids does not take place naturally. Although N2 fixation by endophytic and associative diazotrophs has been reported in rice, the main organs and seasonal regulation for the N2 fixation have not been elucidated. In this study, seasonal changes in nitrogenase (acetylene reduction) activity and carbohydrate contents in elongated culm (EC), unelongated stem (US), and crown root (CR) were investigated in manure compost (MC)- and chemical fertilizer (CF)-applied rice. Nitrogenase activity increased after rooting (June) and reached the highest activity in US of MC-applied rice at panicle initiation (August). The sucrose content in EC continued to increase after rooting regardless of the applied materials, whereas the glucose content in US increased after rooting only in CF-applied rice, suggesting higher consumption of glucose in US of MC-applied rice. There were significant differences among bacterial microbiota in EC, US, and CR at panicle initiation. In addition, Clostridia class anaerobes were more abundant in US of MC-applied rice than in EC and CR of MC-applied rice. Such difference was not observed in US of CF-applied rice. These results suggest the suitability of US of MC-applied rice at panicle initiation as a site of N2 fixation under anaerobic conditions.

1. Introduction

Symbiotic diazotrophic bacteria play a crucial role in biological N2 fixation (BNF) under catalysis of nitrogenases, which can partly supply N compounds to host plants. N2 fixation in the symbiotic associations between legume plants and diazotrophs inside root nodules is well known in agricultural systems. Dicarboxylates (fumarate, succinate, and L-malate) are supplied from legume plants to nodule bacteroids via the dicarboxylic-acid transport system, and these organic acids fuel the energy for nitrogenase activity [1].
In the non-symbiotic systems, rhizosphere-associative diazotrophic bacteria fix N2 by using C and energy sources supplied from the environment, and they release the fixed N probably after lysis of the bacterial cells [2]. In addition, endophytic diazotrophs are often observed in a wide variety of plant roots, including cereals [3,4]. Dinitrogenase-reductase-encoding gene, nifH, and its expression have been detected in agronomically significant non-legume plants and their rhizosphere, such as the maize stems and roots, the maize rhizosphere soil, the sorghum roots and rhizosphere, the switch grass shoots and roots, the sugarcane stems and roots, the sugarcane leaf sheath, and the sweet potato stems and storage tubers [2,5,6]. It has been reported that the carbohydrate-rich mucilage secreted from the aerial roots of the maize landrace has nitrogenase activity, and it is enriched in many known diazotrophic species and the homologs of genes encoding nitrogenase subunits [7,8].
In terms of N2 fixation in paddy rice fields, the interface of the root–soil system has been reported as the important site of N2 fixation, and the rhizosphere-associated bacteria responsible for the N2 fixation were thought to be heterotrophic diazotrophs, such as Azotobacter and Clostridia bacteria [9]. BNF by the methane-oxidizing methanotrophs takes place in the root tissues and in the surface soil. The functional genes for methane oxidation and plant association were abundant in rice roots under low levels of N fertilizer application [10]. It has been shown that methane oxidation and N2 fixation are simultaneously activated in the root zone of rice in low-N paddy fields, and both processes are likely controlled by the OsCCaMK gene encoding Ca2+/calmodulin-dependent protein kinase, which is the central component of the common symbiosis pathway [11]. The short filaments and coiled masses of N2-fixing cyanobacteria were observed near the epidermis and cortex of roots and shoot tissues [12]. It has been suggested that rice rhizosphere-associative diazotrophs compete with methanogens or sulfate-reducing bacteria for C and energy sources supplied from the environment [13]. However, there is limited information about the main organs and seasonal regulation for N2 fixation of rice cultured in paddy fields.
A rice stem has 13–16 nodes, which are composed of the upper 4 to 5 nodes and the residual basal nodes [14]. The node is a junction of vasculatures connecting to leaves, stems, panicles, and roots. The long internodes are separated by the upper nodes and they participate in the height of elongated culm (EC) [15]. On the other hand, basal nodes form an unelongated stem (US) and they are connected to crown roots (CR). It has been reported that the endophytic bacteria seem to enter the root of rice from the rhizosphere, and colonize in roots (the intracellular spaces, the aerenchyma, and the cortical cells) and leaves and stems (the vascular tissue, the xylem vessels, the epidermal cells, the intracellular spaces, and the substomatal cavities) [16,17,18]. Therefore, rice roots are exposed to and associated with various kinds of rhizospheric bacteria, including diazotrophs, whereas the rice vasculatures contain abundant carbohydrates produced by photosynthetic apparatus, which could be metabolized by diazotrophs to fuel BNF.
In a previous study, long-term manure compost (MC) application to the paddy soil increased soil potential nitrogenase activity and bacterial alpha diversity in summer and winter, compared to those in the long-term chemical fertilizer (CF) application [19]. On the other hand, soil ammonia availability decreased with the MC application. It has been reported that MC contains one order of magnitude lower contents of ammonia-N and nitrate-N compared to total N contents, while N components of CF are mainly composed of ammonia-N [20]. The difference in bacterial N availability between MC and CF applications to soil might affect soil bacterial microbiota. The relative abundance of Nitrospira, a class of ammonia-oxidizing bacteria, was lower, and the relative abundance of alpha-Proteobacteria was higher in the MC-applied soils than in the CF-applied soils, as reported previously [19]. If rice is cultured in the long-term MC-applied and CF-applied paddy soil, the differences in soil bacterial microbiota and chemical compositions may affect endophytic and associative bacterial microbiota, nitrogenase activity, and carbohydrate consumption in the rice. In this study, therefore, seasonal changes in nitrogenase activity and non-structural carbohydrate contents in EC, US, and CR of the MC- and CF-applied rice were investigated from transplanting of seedlings to ripening in order to clarify the effect of the material application on N2 fixation in these rice parts at different cultivation stages. Bacterial microbiota of the rice part, in which the highest nitrogenase activity was detected, was compared to other bacterial microbiota so as to evaluate the contribution of specific bacteria to enhancement of N2 fixation in the rice part.

2. Materials and Methods

2.1. Rice Cultivation and Sampling

A rice plant, Oryza sativa L. japonica, which is a relatively short plant with narrow dark-green leaves, medium-height tillers, and short and roundish grains [21], cultivar Udai 21 was cultured in the research farm at Utsunomiya University (Moka, Japan; latitude +36.49° (Northern Hemisphere) and longitude +139.99° (east)). Annual precipitation was 1101.5 mm in 2022 and 1420.5 mm in 2023. Annual average temperature was 14.3 °C in 2022 and 15.3 °C in 2023. Rice was cultivated from spring (May) to summer (August) and harvested in early autumn (September). Cow MC prepared on the research farm was composed of water (67.7%), total N (2.4%), total C (26.1%), P2O5 (4.6%), CaO (6.8%), MgO (0.6%), and K2O (3.9%). CF (Japan Agricultural Cooperatives) was composed of ammonia-N (12%), P2O5 (18%), and K2O (16%). MC and CF have been separately applied to allophanic Andosol fields since 1991 [22]. In May and July, CF equivalent to 3 kg N/1000 m2 was applied, while in March, MC equivalent to 9.2 kg N/1000 m2 was applied. Three (2022) and five (2023) stocks of rice plant were collected from 180 m2 (MC) and 270 m2 (CF) plots in June 2022 (rooting), July 2022 (tillering), August 2022 and 2023(panicle initiation), and September 2022 (ripening). Soil of the rice stocks was shaken off from the root, the aerial part was removed by scissors, and the residual part was washed with a gentle stream of tap water. The residual part was cut and divided into 1–2 cm-length US: EC that was the 5 cm upper section of US, and CR that had the 5 cm outer and lower sections of US, by scissors sterilized with 70% ethanol (Figure 1). The rice specimens were stored in plastic bags both at 4 °C and −30 °C.

2.2. Measurement of Nitrogenase Activity

Bacterial nitrogenase activity was measured by the acetylene reduction assay [23]. The rice specimens stored at 4 °C were used on the day of sampling. Approximately 10 g of the fresh-weight specimen was poured into a 100 mL Erlenmeyer flask (AGC techno glass, Haibara-gun, Japan) without addition of external energy and electron sources, such as glucose. After covering the flask with a double cap (Kokugo, Tokyo, Japan), the flasks were sealed with plastic tape. After injection of 5 mL of acetylene through a needle and syringe, the flasks were incubated at 30 °C for 24 h.
After incubation, 100 µL of gas phase in the flask was taken by Gastight syringe 81,000 (Hamilton, Reno, NV, USA), and the ethylene formed was quantified by a gas chromatograph GC-4000 (GL Sciences, Tokyo, Japan) equipped with a flame ionization detector and a capillary column Rt-Alumina BOND/KCl (30 m, 0.32 mm ID, 5 µm df, Restek, Tokyo, Japan). N2 was used as a carrier gas at a flow rate of 3 mL/min. The injector and column temperatures were kept at 200 °C and 100 °C, respectively.

2.3. Measurements of Sucrose and Glucose Contents

The rice specimens stored at −30 °C were used. Plant extracts containing carbohydrates were prepared by treating 0.04–1.44 g fresh-weight rice specimens with 5 mL of boiling ethanol/water (4/1, v/v) 1–2 times [24]. Glass tubes for extraction were capped with glass marbles and heated at 80–85 °C for 10 min in an aluminum alloy block placed on a hot stirrer. The ethanol/water extracts were put together, and volumes of the ethanol/water solution were measured. Sucrose and glucose concentrations in the ethanol/water solution were measured using Enzytex liquid sucrose/D-glucose (J.K. International, Tokyo, Japan) and Glucose CII-test Wako (Fujifilm Wako Pure Chemical, Osaka, Japan), respectively.

2.4. Rarefaction Curve, Alpha Diversity, Beta Diversity, and Relative Taxonomic Abundance in Bacterial Microbiota

The rice specimens stored at −30 °C were used. DNA in rice EC, US, and CR was extracted using the DNeasy Plant Mini Kit (Qiagen, Tokyo, Japan). In DNA extraction from the rice plant, a 3 mm-diameter stainless-steel bead (SUS304, Taitec, Koshigaya, Japan) was put in NucleoSpin Bead Tubes Type A (Macherey-Nagel, Düren, Germany). Rice plant pieces placed in the bead tubes were subjected to bead beater treatment using a bead crusher µT-12 (Taitec). Construction of the metagenomic library targeting the 16S rRNA gene V3 and V4 regions and sequencing by a sequencer MiSeq (Illumina, San Diego, CA, USA) were performed with the metagenome sequencing service (Macrogen, Tokyo, Japan). The primer sequences were trimmed, the paired sequence reads were merged, and the merged reads comprising 400–470 nucleotides were extracted using Geneious Prime ver. 2019.2.3 (Tomy Digital Biology, Tokyo, Japan). Sequence data were analyzed by mothur (v. 1.48.1) [25]. During the data processing, chloroplast, mitochondria, and archaea sequences were identified and removed. Unclassified bacterial sequences at phylum and class levels were also removed. Analyses of the rarefaction curve, alpha diversity (Shannon and inverse Simpson indices), beta diversity (the principal coordinate analysis (PCoA)), calculated using the Bray–Curtis dissimilarity matrix [26], and relative taxonomic abundance were performed using mothur. The sequences were classified with the Greengenes reference database.

2.5. Quantification of nifH/Bacterial 16S rRNA Gene

Bacterial genes were amplified using quantitative PCR with KOD SYBR qPCR Mix (Toyobo, Osaka, Japan) and primer sets of PolF (TGCGAYCCSAARGCBGACTC)/PolR (ATSGCCATCATYTCRCCGGA) for nifH (sequence position 115–457 with reference to the Azotobacter vinelandii nifH, GenBank accession number M20568) [27] and Univ-341-F (CCTACGGGAGGCAGCAG)/Univ-907-R (CCCCGTCAATTCCTTTGAGTTT) for the 16S rRNA gene [28,29]. The cycle threshold (Ct) of each DNA sample extracted from the rice specimens was determined with the ABI7500 real-time PCR system (ThermoFisher Scientific, Tokyo, Japan). Relative copy numbers for nifH and 16S rRNA genes were calculated using an equation of 1/2Ct. A ratio of the nifH copy number to the bacterial 16S rRNA gene copy number was calculated to evaluate the abundance of diazotrophic bacteria.

2.6. Statistical Analyses

Significant difference among three or more groups was detected with the one-way analysis of variance (ANOVA). Pairwise multiple comparisons were performed with Tukey’s test. Means of paired groups (MC- and CF-applied rice parts) were compared using Student’s t-test. The homogeneity of variances for the paired groups was evaluated with the F-test (α < 0.05).

3. Results

3.1. Changes in Nitrogenase Activity and Non-Structural Carbohydrate Contents in the Rice Parts

In order to investigate endophytic and associative bacterial N2 fixation in the rice parts, rice stocks were collected from CF and MC plots in the period of June to September in 2022. Nitrogenase activity markedly increased in US at panicle initiation on day 77 (August) compared to US at rooting on day 21 (June) in multiple comparisons, regardless of the materials applied (Table 1). The increases in nitrogenase activity in EC and CR were observed only in CF-applied rice at ripening on day 133 (September) and only in CF-applied rice at tillering on day 49 (July), respectively.
Sucrose content markedly increased in EC on day 133 compared to EC on day 21 in multiple comparisons, regardless of the materials applied (Table 1). There were no significant seasonal changes in sucrose content in US and CR. In multiple comparisons, glucose content in US and CR of CF-applied rice tended to increase through the rice cultivation period, whereas no significant increases were observed in glucose content in US and CR of MC-applied rice. Sucrose and glucose contents were low or not detected in CR throughout the cultivation period.
As the marked increase in nitrogenase activity was observed in US of MC-applied rice at panicle initiation, the nitrogenase activity, ratio of nifH copy number to bacterial 16S rRNA gene copy number, sucrose content, and glucose content were evaluated in EC, US, and CR of MC- and CF-applied rice at panicle initiation. US of MC-applied rice exhibited higher nitrogenase activity than US of CF-applied rice in multiple comparisons (F = 36.9, p = 7.0 × 10−7; Figure 2A). Nitrogenase activity in US of MC-applied rice was also higher than that in EC and CR of MC-applied rice. There were no differences in the ratio of the nifH copy number to the bacterial 16S rRNA gene copy number between the same parts of MC- and CF-applied rice in multiple comparisons (F = 10.3, p = 0.00052; Figure 2B). However, the ratio was higher in CR of MC-applied rice than in CR of CF-applied rice in the t-test (p = 0.034). The result showed that diazotrophs occupied in the bacterial community might be abundant in CR of MC-applied rice. There were no differences in sucrose content between the same parts of MC- and CF-applied rice (F = 23.1, p = 0.0015; Figure 2C). No and scarce sucrose was detected in US and CR regardless of the applied materials. There were no differences in glucose content between the same parts of MC- and CF-applied rice (F = 7.94, p = 0.0016; Figure 2D). However, glucose content was lower in EC of MC-applied rice than in EC of CF-applied rice on day 77 in the t-test (p = 0.049). These results indicate the importance of the existence of a C source, such as glucose, and the abundance of diazotrophs in the bacterial community for the enhancement of nitrogenase activity in US.

3.2. Bacterial Microbiota in the Parts of MC- and CF-Applied Rice at Panicle Initiation

As the marked increase of nitrogenase activity was observed in US of MC-applied rice at panicle initiation, bacterial microbiota was evaluated in EC, US, and CR of MC- and CF-applied rice at panicle initiation. There were no obvious differences in increases of the numbers of observed operational taxonomic units (OTUs) with given sequence numbers in the rarefaction curves (Figure S1). Alpha diversity within the bacterial microbiota of rice parts at panicle initiation was measured with Shannon and inverse Simpson indices. The indices were not significantly different between the MC- and CF-applied rice parts (Figure S2).
Beta diversity among the bacterial microbiota of rice parts was compared with PCoA. The dissimilarity of bacterial microbiota was observed among EC, US, and CR (Figure 3). The bacterial microbiota in EC, US, and CR was not distinguished between MC- and CF-applied rice.

3.3. Relative Taxonomic Abundances in Bacterial Microbiota of Rice Parts at Panicle Initiation

The multiple comparison analysis was performed among the relative taxonomic abundances in different rice parts of different material-applied rice (Figure 4A). The taxonomic classifications to OTUs were summarized in Table S1. Regardless of the applied materials, alpha-Proteobacteria abundance was higher in EC than in CR (F = 16.6, p = 5.0 × 10−5). On the other hand, beta-Proteobacteria abundance increased in CR of CF-applied rice compared to EC of CF-applied rice (F = 10.7, p = 0.00043), and gamma-Proteobacteria increased in CR of MC-applied rice compared to US of MC-applied rice (F = 13.5, p = 0.00015). There were no differences in the relative abundances of Actinobacteria (F = 1.6, p = 0.24), delta-Proteobacteria (F = 11.9, p = 0.00026), and others (F = 0.78, p = 0.58) in multiple comparisons. Clostridia class in MC-applied rice was specifically higher in US than in EC and CR (F = 16.9, p = 4.5 × 10−5). There were no significant differences in the class-level relative taxonomic abundances between MC- and CF-applied rice parts. An unclassified species of Clostridiales order was also higher in US of MC-applied rice than in EC of MC-applied rice (F = 13.1, p = 0.00016; Figure 4B). The higher abundances of Clostridia class and species of Clostridiales order might contribute to the increase in nitrogenase activity in US of MC-applied rice at panicle initiation.

3.4. Nitrogenase Activity, nifH Abundance, and Non-Structural Carbohydrate Contents in Rice Parts at Panicle Initiation

The enhancement of nitrogenase activity in US of MC-applied rice at panicle initiation was reproduced in 2023. Significant differences in ANOVA were observed among means for nitrogenase activity (F = 41, p = 5.8 × 10−11), nifH copy number/16S rRNA gene copy number (F = 24, p = 1.2 × 10−8), and sucrose (F = 26, p = 2.0 × 10−6) and glucose (F = 41, p = 5.9 × 10−11) contents in EC, US, and CR of MC- and CF-applied rice. In multiple comparisons, nitrogenase activity was higher in US than in EC and CR, and it was also higher in US of MC-applied rice than in US of CF-applied rice (Figure 5A). The ratio of nifH to 16S rRNA gene copy number was higher in CR than in EC in multiple comparisons, and it was higher in CR of MC-applied rice than in CR of CF-applied rice in the t-test (p = 0.014; Figure 5B). Sucrose content was higher in EC than in US and CR (Figure 5C). Glucose content was lower in EC of MC-applied rice than in EC of CF-applied rice in multiple comparisons, and it was higher in CR of MC-applied rice than in CR of CF-applied rice in the t-test (p = 0.0046; Figure 5D). These results showed that US might be a hot part of N2 fixation at panicle initiation and the nifH abundance in CR and glucose consumption in EC might affect the enhancement of nitrogenase activity in US of MC-applied rice.

4. Discussion

Sucrose originated from C assimilation in leaves is transported and translocated from photosynthetic apparatus to non-photosynthetic sinks, such as fruits, seeds, and developing tubers [30]. The synergy between abscisic acid and sucrose increased grain yield and quality by improving the source–sink relationship. Thus, sucrose is an energy source of plants and a signaling molecule that regulates plant development. This study showed that the sucrose content increased after rooting (June) in rice EC. The increase in sucrose content is correlated with the development of photosynthetic apparatus in rice to serve non-structural carbohydrates to EC and US after rooting. It has been reported that the upper leaf sheath of rice serves as a temporary starch sink before heading, and it subsequently becomes a C source tissue to the growing panicle in the post-heading stage. The time of sink–source transition in upper leaf sheaths is highly correlated with the panicle exertion [31]. It has been reported that sucrose is temporarily stored in rice culm and sheath before heading, and it is reallocated to developing grains after heading for grain filling [32]. In this study, however, the sucrose contents in US were two orders of magnitude lower than those in EC after panicle initiation. On the other hand, the glucose contents in US were one order of magnitude higher than the sucrose contents in US after panicle initiation. Considering the significantly higher nitrogenase activity in US compared to those in EC at panicle initiation, glucose, instead of sucrose, may be a candidate C source for the endophytic bacteria in US to fuel the nitrogenase activity. It is considered that the translocated sucrose might be hydrolyzed into glucose and fructose by various isoforms of invertase, as shown previously [33]. Grasses, including rice, have the ability to buffer the sink–source interaction by transiently storing carbohydrates in stem tissue when production from the source is greater than the whole-plant demand [34]. Cells surrounding the rice stem small vascular bundles accumulated more abundant non-structural carbohydrates than those surrounding large vascular bundles before heading via enhancing sucrose hydrolysis and starch accumulation in small vascular bundles [33]. It has been shown through cultivation of the rice genotypes for two years that the stem N-fixing (acetylene reduction) activity was correlated with the stem levels of soluble sugars [35]. In this study, the glucose content in US of CF-applied rice increased after tillering, suggesting that the glucose contents detected in US might originate from the translocated sucrose, and the glucose contents might sustain the nitrogenase activity in US after tillering. On the other hand, such glucose increase was not observed in US of MC-applied rice after tillering, and the glucose content was lower in EC of MC-applied rice than in EC of CF-applied rice, suggesting that the glucose demand to sustain the higher nitrogenase activity might be larger in US of MC-applied rice than in US of CF-applied rice at panicle initiation. The rice basal nodes, as a junction of the vascular systems, are important in distribution of iron and zinc, which are taken up by the root, to the leaf sheath, developing tiller bud, and panicle [36,37]. Considering the possibility that rhizosphere bacteria enter the root and might be distributed to the rice parts through the vascular systems, as shown in the cases of iron and zinc, the basal nodes could be the first part for the endophytic bacteria to contact to high concentrations of non-structural carbohydrates. The results in this study, together with the knowledge from previous studies [33,34,35], suggested that basal nodes of US might be a main part for N2 fixation by endophytic diazotrophs at panicle initiation, which would be sustained by the contents of translocated non-structural carbohydrates, such as glucose and its metabolites. It would be necessary to evaluate the impact of the enhanced N2 fixation in US of MC-applied rice on the distribution of total N to rice parts after panicle initiation using the 15N2 stable-isotope labeling technique.
This study revealed that the ratio of the nifH gene copy number to the bacterial 16S rRNA gene copy number was higher in CR of MC-applied rice than in EC of MC-applied rice. In addition, the ratio of the nifH gene copy number to the 16S rRNA gene copy number was higher in CR of MC-applied rice than in CR of CF-applied rice. These results are supported by the report that the potential nitrogenase activity was higher in the MC-applied paddy soil than in the CF-applied paddy soil [19]. These results suggest that the higher nifH abundance of bacterial microbiota in CR of MC-applied rice might affect the bacterial microbiota of US of MC-applied rice. It has been shown that nifH gene copy numbers are not significantly correlated with N-fixing activities in soil, even in the presence of external glucose and malate solution [38,39,40]. Considering that no or trace amounts of sucrose and glucose were detected in CR throughout the rice cultivation period, several factors, such as the poor C source content, may restrict nitrogenase activity and mask the potential of diazotrophs detected in CR.
PCoA and the comparison of relative taxonomic abundances in rice bacterial microbiota at panicle initiation indicated the dissimilarity of bacterial community structures among EC, US, and CR. The class of alpha-Proteobacteria was more abundant in EC than in CR regardless of the applied materials, whereas the class of beta-Proteobacteria in CF-applied rice was more abundant in CR than in EC, and the class of gamma-Proteobacteria in MC-applied rice was more abundant in CR than in US. The phylum abundances of rice root and stem have been demonstrated in the preceded studies. Endophytic bacterial diversity in rice root consists of alpha, beta, gamma, delta, and epsilon subclasses of Proteobacteria, and Cytophaga/Flexibacter/Bacteroides (CFB) phylum [41], and the dominant group was beta-Proteobacteria [42,43]. In the stems of four rice genotypes, the classification by class levels revealed that alpha-Proteobacteria is the most prevalent at the heading stage [35]. The previously shown dominant classes, beta-Proteobacteria in root and alpha-Proteobacteria in stem, are consistent with the dominant classes shown in this study. The most remarkable finding with the comparison of relative taxonomic abundances in this study was that Clostridia class and Clostridiales species were more abundant in US of MC-applied rice than in EC of MC-applied rice. BNF by some diazotrophic bacteria, such as Azotobacter, Clostridium, Azospirillum, Herbaspirillum, Burkholderia, and Rhizobium, can substitute for urea-N in CF [44]. Uncultivated diazotrophs, such as Costridiaceae, dominated the communities of responsive phylotypes in anaerobic soil microcosms amended with glucose and glucose plus urea [45]. Therefore, the dominance of Clostridia class bacteria in US might be correlated with higher occurrence of N2 fixation under hypoxic or anoxic environmental conditions in US.

5. Conclusions

Nitrogenase activity was increased after rooting and reached a plateau in US at panicle initiation (August). The enhancement of nitrogenase activity was more markedly observed in MC-applied rice than in CF-applied rice. After panicle initiation, no or scarce sucrose was detected in US, whereas the glucose contents in US were one order of magnitude higher than the sucrose contents in US, suggesting that glucose might be one of the candidate C sources to fuel nitrogenase activity. The glucose content was lower in EC of MC-applied rice than in EC of CF-applied rice at panicle initiation, and there was no increase in the glucose content after tillering in US of MC-applied rice, suggesting higher consumption of glucose in EC and US of MC-applied rice. Clostridia class abundance was higher in US of MC-applied rice than in EC and CR of MC-applied rice at panicle initiation. The increased abundance of anaerobes, such as Clostridia class bacteria, might be correlated with the suitability of rice US for bacterial anaerobic metabolisms, such as N2 fixation.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/microbiolres15030127/s1, Table S1: Numbers of OTUs and their classifications; Figure S1: Rarefaction curves of operational taxonomic units (OTUs) observed in the bacterial microbiota of the rice parts at panicle initiation; Figure S2: Shannon and inverse Simpson indices in the bacterial microbiota of the rice parts at panicle initiation.

Author Contributions

Conceptualization, I.M., H.H., C.H. and Y.T.; methodology, I.M., H.H., C.H. and Y.T.; software, I.M.; formal analysis, Z.A., M.T. and J.X.; resources, H.H., C.H. and Y.T.; data curation, Z.A. and I.M.; writing—original draft preparation, I.M.; writing—review and editing, I.M.; funding acquisition, I.M. and H.H. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by a Grant-in-Aid for Scientific Research (C) from the Japan Society for the Promotion of Science (17K07709).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The raw data associated with this study were deposited into the DNA Data Bank of Japan (DDBJ) BioProject database (accession: PRJDB18695).

Acknowledgments

This work was carried out based on management in paddy rice production by staff of Utsunomiya University Farm.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Lodwig, E.M.; Hosie, A.H.; Bourdes, A.; Findlay, K.; Allaway, D.; Karunakaran, R.; Downie, J.; Poole, P.S. Amino-acid cycling drives nitrogen fixation in the legume–Rhizobium symbiosis. Nature 2003, 422, 722–726. [Google Scholar] [CrossRef] [PubMed]
  2. Mahmud, K.; Makaju, S.; Ibrahim, R.; Missaoui, A. Current progress in nitrogen fixing plants and microbiome research. Plants 2020, 9, 97. [Google Scholar] [CrossRef] [PubMed]
  3. Bennett, A.B.; Pankievicz, V.C.; Ané, J.-M. A model for nitrogen fixation in cereal crops. Trends Plant Sci. 2020, 25, 226–235. [Google Scholar] [CrossRef] [PubMed]
  4. Guo, K.; Yang, J.; Yu, N.; Luo, L.; Wang, E. Biological nitrogen fixation in cereal crops: Progress, strategies, and perspectives. Plant Commun. 2023, 4, 100499. [Google Scholar] [CrossRef]
  5. Soumare, A.; Diedhiou, A.G.; Thuita, M.; Hafidi, M.; Ouhdouch, Y.; Gopalakrishnan, S.; Kouisni, L. Exploiting biological nitrogen fixation: A route towards a sustainable agriculture. Plants 2020, 9, 1011. [Google Scholar] [CrossRef]
  6. Yoneyama, T.; Terakado-Tonooka, J.; Bao, Z.; Minamisawa, K. Molecular analyses of the distribution and function of diazotrophic rhizobia and methanotrophs in the tissues and rhizosphere of non-leguminous plants. Plants 2019, 8, 408. [Google Scholar] [CrossRef]
  7. Pankievicz, V.C.S.; Delaux, P.-M.; Infante, V.; Hirsch, H.H.; Rajasekar, S.; Zamora, P.; Jayaraman, D.; Calderon, C.I.; Bennett, A.; Ané, J.-M. Nitrogen fixation and mucilage production on maize aerial roots is controlled by aerial root development and border cell functions. Front. Plant Sci. 2022, 13, 977056. [Google Scholar] [CrossRef]
  8. Van Deynze, A.; Zamora, P.; Delaux, P.-M.; Heitmann, C.; Jayaraman, D.; Rajasekar, S.; Graham, D.; Maeda, J.; Gibson, D.; Schwartz, K.D. Nitrogen fixation in a landrace of maize is supported by a mucilage-associated diazotrophic microbiota. PLoS Biol. 2018, 16, e2006352. [Google Scholar] [CrossRef] [PubMed]
  9. Yoneyama, T.; Terakado-Tonooka, J.; Minamisawa, K. Exploration of bacterial N2-fixation systems in association with soil-grown sugarcane, sweet potato, and paddy rice: A review and synthesis. Soil Sci. Plant Nutr. 2017, 63, 578–590. [Google Scholar] [CrossRef]
  10. Ikeda, S.; Sasaki, K.; Okubo, T.; Yamashita, A.; Terasawa, K.; Bao, Z.; Liu, D.; Watanabe, T.; Murase, J.; Asakawa, S. Low nitrogen fertilization adapts rice root microbiome to low nutrient environment by changing biogeochemical functions. Microbes Environ. 2014, 29, 50–59. [Google Scholar] [CrossRef]
  11. Bao, Z.; Watanabe, A.; Sasaki, K.; Okubo, T.; Tokida, T.; Liu, D.; Ikeda, S.; Imaizumi-Anraku, H.; Asakawa, S.; Sato, T. A rice gene for microbial symbiosis, Oryza sativa CCaMK, reduces CH4 flux in a paddy field with low nitrogen input. Appl. Environ. Microbiol. 2014, 80, 1995–2003. [Google Scholar] [CrossRef] [PubMed]
  12. Bidyarani, N.; Prasanna, R.; Chawla, G.; Babu, S.; Singh, R. Deciphering the factors associated with the colonization of rice plants by cyanobacteria. J. Basic Microbiol. 2015, 55, 407–419. [Google Scholar] [CrossRef]
  13. Maeda, I. Potential of phototrophic purple nonsulfur bacteria to fix nitrogen in rice fields. Microorganisms 2021, 10, 28. [Google Scholar] [CrossRef]
  14. Yamaji, N.; Sasaki, A.; Xia, J.X.; Yokosho, K.; Ma, J.F. A node-based switch for preferential distribution of manganese in rice. Nat. Commun. 2013, 4, 2442. [Google Scholar] [CrossRef] [PubMed]
  15. Yamamuro, C.; Ihara, Y.; Wu, X.; Noguchi, T.; Fujioka, S.; Takatsuto, S.; Ashikari, M.; Kitano, H.; Matsuoka, M. Loss of function of a rice brassinosteroid insensitive1 homolog prevents internode elongation and bending of the lamina joint. Plant Cell 2000, 12, 1591–1605. [Google Scholar] [CrossRef] [PubMed]
  16. Gyaneshwar, P.; James, E.K.; Mathan, N.; Reddy, P.M.; Reinhold-Hurek, B.; Ladha, J.K. Endophytic colonization of rice by a diazotrophic strain of Serratia marcescens. J. Bacteriol. 2001, 183, 2634–2645. [Google Scholar] [CrossRef]
  17. James, E.K.; Gyaneshwar, P.; Mathan, N.; Barraquio, W.L.; Reddy, P.M.; Iannetta, P.P.; Olivares, F.L.; Ladha, J.K. Infection and colonization of rice seedlings by the plant growth-promoting bacterium Herbaspirillum seropedicae Z67. Mol. Plant-Microbe Interact. 2002, 15, 894–906. [Google Scholar] [CrossRef]
  18. Mano, H.; Morisaki, H. Endophytic bacteria in the rice plant. Microbes Environ. 2008, 23, 109–117. [Google Scholar] [CrossRef]
  19. Ao, Z.; Xia, J.; Seino, H.; Inaba, K.; Takahashi, Y.; Hayakawa, C.; Hirai, H.; Maeda, I. Adaptations of potential nitrogenase activity and microbiota with long-term application of manure compost to paddy soil. Environments 2023, 10, 103. [Google Scholar] [CrossRef]
  20. Liu, J.; Xu, X.-h.; Li, H.-t.; Xu, Y. Effect of microbiological inocula on chemical and physical properties and microbial community of cow manure compost. Biomass Bioenergy 2011, 35, 3433–3439. [Google Scholar] [CrossRef]
  21. Cordero-Lara, K.I. Temperate japonica rice (Oryza sativa L.) breeding: History, present and future challenges. Chil. J. Agric. Res. 2020, 80, 303–314. [Google Scholar] [CrossRef]
  22. Takahashi, T.; Nanzyo, M.; Shoji, S. Proposed revisions to the diagnostic critera for andic and vitric horizons and qualifiers of ardosols in the world reference base for soil resources. Soil Sci. Plant Nutr. 2004, 50, 431–437. [Google Scholar] [CrossRef]
  23. Stewart, W.; Fitzgerald, G.; Burris, R. In situ studies on N2 fixation using the acetylene reduction technique. Proc. Natl. Acad. Sci. USA 1967, 58, 2071–2078. [Google Scholar] [CrossRef]
  24. Chow, P.S.; Landhäusser, S.M. A method for routine measurements of total sugar and starch content in woody plant tissues. Tree Physiol. 2004, 24, 1129–1136. [Google Scholar] [CrossRef]
  25. Schloss, P.D.; Westcott, S.L.; Ryabin, T.; Hall, J.R.; Hartmann, M.; Hollister, E.B.; Lesniewski, R.A.; Oakley, B.B.; Parks, D.H.; Robinson, C.J. Introducing mothur: Open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl. Environ. Microbiol. 2009, 75, 7537–7541. [Google Scholar] [CrossRef] [PubMed]
  26. Bray, J.R.; Curtis, J. An ordination of the upland forest communities of southern Wisconsin. Ecol. Monogr. 1957, 27, 325–349. [Google Scholar] [CrossRef]
  27. Poly, F.; Monrozier, L.J.; Bally, R. Improvement in the RFLP procedure for studying the diversity of nifH genes in communities of nitrogen fixers in soil. Res. Microbiol. 2001, 152, 95–103. [Google Scholar] [CrossRef]
  28. Muyzer, G.; De Waal, E.C.; Uitterlinden, A. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 1993, 59, 695–700. [Google Scholar] [CrossRef]
  29. Teske, A.; Wawer, C.; Muyzer, G.; Ramsing, N.B. Distribution of sulfate-reducing bacteria in a stratified fjord (Mariager Fjord, Denmark) as evaluated by most-probable-number counts and denaturing gradient gel electrophoresis of PCR-amplified ribosomal DNA fragments. Appl. Environ. Microbiol. 1996, 62, 1405–1415. [Google Scholar] [CrossRef]
  30. Chen, T.; Li, G.; Islam, M.R.; Fu, W.; Feng, B.; Tao, L.; Fu, G. Abscisic acid synergizes with sucrose to enhance grain yield and quality of rice by improving the source-sink relationship. BMC Plant Biol. 2019, 19, 525. [Google Scholar] [CrossRef]
  31. Chen, H.-J.; Wang, S.-J. Molecular regulation of sink–source transition in rice leaf sheaths during the heading period. Acta Physiol. Plant. 2008, 30, 639–649. [Google Scholar] [CrossRef]
  32. Li, G.; Cui, K.; Hu, Q.; Wang, W.; Pan, J.; Zhang, G.; Shi, Y.; Nie, L.; Huang, J.; Peng, S. Phloem unloading in developing rice caryopses and its contribution to non-structural carbohydrate translocation from stems and grain yield formation. Plant Cell Physiol. 2022, 63, 1510–1525. [Google Scholar] [CrossRef] [PubMed]
  33. Zhang, G.; Cui, K.; Li, G.; Pan, J.; Huang, J.; Peng, S. Stem small vascular bundles have greater accumulation and translocation of non-structural carbohydrates than large vascular bundles in rice. Physiol. Plant. 2022, 174, e13695. [Google Scholar] [CrossRef] [PubMed]
  34. Slewinski, T.L. Non-structural carbohydrate partitioning in grass stems: A target to increase yield stability, stress tolerance, and biofuel production. J. Exp. Bot. 2012, 63, 4647–4670. [Google Scholar] [CrossRef] [PubMed]
  35. Okamoto, T.; Shinjo, R.; Nishihara, A.; Uesaka, K.; Tanaka, A.; Sugiura, D.; Kondo, M. Genotypic variation of endophytic nitrogen-fixing activity and bacterial flora in rice stem based on sugar content. Front. Plant Sci. 2021, 1610, 719259. [Google Scholar] [CrossRef]
  36. Che, J.; Yamaji, N.; Ma, J.F. Role of a vacuolar iron transporter OsVIT2 in the distribution of iron to rice grains. New Phytol. 2021, 230, 1049–1062. [Google Scholar] [CrossRef]
  37. Mu, S.; Yamaji, N.; Sasaki, A.; Luo, L.; Du, B.; Che, J.; Shi, H.; Zhao, H.; Huang, S.; Deng, F. A transporter for delivering zinc to the developing tiller bud and panicle in rice. Plant J. 2021, 105, 786–799. [Google Scholar] [CrossRef]
  38. Knelman, J.E.; Legg, T.M.; O’Neill, S.P.; Washenberger, C.L.; González, A.; Cleveland, C.C.; Nemergut, D.R. Bacterial community structure and function change in association with colonizer plants during early primary succession in a glacier forefield. Soil Biol. Biochem. 2012, 46, 172–180. [Google Scholar] [CrossRef]
  39. Tang, Y.; Zhang, M.; Chen, A.; Zhang, W.; Wei, W.; Sheng, R. Impact of fertilization regimes on diazotroph community compositions and N2-fixation activity in paddy soil. Agric. Ecosyst. Environ. 2017, 247, 1–8. [Google Scholar] [CrossRef]
  40. Wang, Q.; Wang, J.; Li, Y.; Chen, D.; Ao, J.; Zhou, W.; Shen, D.; Li, Q.; Huang, Z.; Jiang, Y. Influence of nitrogen and phosphorus additions on N2-fixation activity, abundance, and composition of diazotrophic communities in a Chinese fir plantation. Sci. Total Environ. 2018, 619, 1530–1537. [Google Scholar] [CrossRef]
  41. Ramšak, A.; Peterka, M.; Tajima, K.; Martin, J.C.; Wood, J.; Johnston, M.E.; Aminov, R.I.; Flint, H.J.; Avguštin, G. Unravelling the genetic diversity of ruminal bacteria belonging to the CFB phylum. FEMS Microbiol. Ecol. 2000, 33, 69–79. [Google Scholar] [CrossRef] [PubMed]
  42. Sun, L.; Qiu, F.; Zhang, X.; Dai, X.; Dong, X.; Song, W. Endophytic bacterial diversity in rice (Oryza sativa L.) roots estimated by 16S rDNA sequence analysis. Microb. Ecol. 2008, 55, 415–424. [Google Scholar] [CrossRef] [PubMed]
  43. Yasuda, M.; Dastogeer, K.M.; Sarkodee-Addo, E.; Tokiwa, C.; Isawa, T.; Shinozaki, S.; Okazaki, S. Impact of Azospirillum sp. B510 on the rhizosphere microbiome of rice under field conditions. Agronomy 2022, 12, 1367. [Google Scholar] [CrossRef]
  44. Choudhury, A.; Kennedy, I. Prospects and potentials for systems of biological nitrogen fixation in sustainable rice production. Biol. Fertil. Soils 2004, 39, 219–227. [Google Scholar] [CrossRef]
  45. Wei, G.; Lianfeng, W.; Zhongjun, J. Heterotrophy-coordinated diazotrophy is associated with significant changes of rare taxa in soil microbiome. Pedosphere 2022, 32, 402–413. [Google Scholar]
Microbiolres 15 00127 g001
Figure 1. The parts of rice cultured in a wetland rice field at Utsunomiya University, Moka, Japan, and collected at panicle initiation. The indicated parts were cut from the whole plant (A). The rice parts from chemical fertilizer (CF)-applied rice (B) and manure compost (MC)-applied rice (C) are shown. The centimeter scale is shown.
Figure 1. The parts of rice cultured in a wetland rice field at Utsunomiya University, Moka, Japan, and collected at panicle initiation. The indicated parts were cut from the whole plant (A). The rice parts from chemical fertilizer (CF)-applied rice (B) and manure compost (MC)-applied rice (C) are shown. The centimeter scale is shown.
Microbiolres 15 00127 g001
Microbiolres 15 00127 g002
Figure 2. Properties related to nitrogen fixation in elongated culm (EC), unelongated stem (US), and crown root (CR) of manure compost (MC)- and chemical fertilizer (CF)-applied rice at panicle initiation in 2022. Columns with error bars for nitrogenase activity (A), nifH copy number/16S rRNA gene copy number (B), sucrose content (C), and glucose content (D) indicate means ± SD (n = 3). Different lowercase letters show significant differences in multiple comparisons among different material-applied rice specimens in different parts (p < 0.05). ND = not detected.
Figure 2. Properties related to nitrogen fixation in elongated culm (EC), unelongated stem (US), and crown root (CR) of manure compost (MC)- and chemical fertilizer (CF)-applied rice at panicle initiation in 2022. Columns with error bars for nitrogenase activity (A), nifH copy number/16S rRNA gene copy number (B), sucrose content (C), and glucose content (D) indicate means ± SD (n = 3). Different lowercase letters show significant differences in multiple comparisons among different material-applied rice specimens in different parts (p < 0.05). ND = not detected.
Microbiolres 15 00127 g002
Microbiolres 15 00127 g003
Figure 3. The principal coordinate analysis (PCoA) of the bacterial microbiota in the parts of manure compost (MC)-applied and chemical fertilizer (CF)-applied rice at panicle initiation. Coordinate points for elongated culm (EC; green), unelongated stem (US; blue), and crown root (CR; red) of MC-applied (closed) and CF-applied (open) rice are shown. Drawings indicate 95% confidence ellipses for EC (green), US (blue), and CR (red) of MC-applied (solid) and CF-applied (dashed) rice.
Figure 3. The principal coordinate analysis (PCoA) of the bacterial microbiota in the parts of manure compost (MC)-applied and chemical fertilizer (CF)-applied rice at panicle initiation. Coordinate points for elongated culm (EC; green), unelongated stem (US; blue), and crown root (CR; red) of MC-applied (closed) and CF-applied (open) rice are shown. Drawings indicate 95% confidence ellipses for EC (green), US (blue), and CR (red) of MC-applied (solid) and CF-applied (dashed) rice.
Microbiolres 15 00127 g003
Microbiolres 15 00127 g004
Figure 4. Class-level and species-level taxonomic profiles in elongated culm (EC), unelongated stem (US), and crown root (CR) of manure compost (MC)- and chemical fertilizer (CF)-applied rice at panicle initiation. A divided bar chart with error bars is composed of columns showing class-level relative abundance + SD (n = 3) (A). Columns with error bars indicate means of relative abundance for Clostridiales species ± SD (n = 3) (B). Different lowercase letters show significant difference in multiple comparisons among the relative taxonomic abundances in different rice parts of different material-applied rice (p < 0.05).
Figure 4. Class-level and species-level taxonomic profiles in elongated culm (EC), unelongated stem (US), and crown root (CR) of manure compost (MC)- and chemical fertilizer (CF)-applied rice at panicle initiation. A divided bar chart with error bars is composed of columns showing class-level relative abundance + SD (n = 3) (A). Columns with error bars indicate means of relative abundance for Clostridiales species ± SD (n = 3) (B). Different lowercase letters show significant difference in multiple comparisons among the relative taxonomic abundances in different rice parts of different material-applied rice (p < 0.05).
Microbiolres 15 00127 g004
Microbiolres 15 00127 g005
Figure 5. Properties related to nitrogen fixation in elongated culm (EC), unelongated stem (US), and crown root (CR) of manure compost (MC)- and chemical fertilizer (CF)-applied rice at panicle initiation in 2023. Columns with error bars for nitrogenase activity (A), nifH copy number/16S rRNA gene copy number (B), sucrose content (C), and glucose content (D) indicate means ± SD (n = 5). Different lowercase letters show significant differences in multiple comparisons among different material-applied rice specimens in different parts (p < 0.05). ND = not detected.
Figure 5. Properties related to nitrogen fixation in elongated culm (EC), unelongated stem (US), and crown root (CR) of manure compost (MC)- and chemical fertilizer (CF)-applied rice at panicle initiation in 2023. Columns with error bars for nitrogenase activity (A), nifH copy number/16S rRNA gene copy number (B), sucrose content (C), and glucose content (D) indicate means ± SD (n = 5). Different lowercase letters show significant differences in multiple comparisons among different material-applied rice specimens in different parts (p < 0.05). ND = not detected.
Microbiolres 15 00127 g005
Table 1. Seasonal changes in nitrogenase activity and non-structural carbohydrate contents in the parts of rice cultured in a wetland rice field at Utsunomiya University, Moka, Japan, in 2022.
Table 1. Seasonal changes in nitrogenase activity and non-structural carbohydrate contents in the parts of rice cultured in a wetland rice field at Utsunomiya University, Moka, Japan, in 2022.
Rice PartMaterialDay after Transplanting of Seedlingsp
214977133
Nitrogenase
(nmol/g fresh wt/h)		ECCF0.39 ± 0.03 a0.54 ± 0.14 a1.90 ± 1.40 ab3.89 ± 0.63 b0.0018
MC0.40 ± 0.07 a0.54 ± 0.06 a2.75 ± 0.86 a4.42 ± 3.63 a0.084
USCF0.39 ± 0.15 a2.68 ± 0.48 ab7.89 ± 1.51 bc9.24 ± 2.41 c0.00020
MC0.65 ± 0.05 a4.52 ± 0.60 ab15.29 ± 2.95 b11.65 ± 5.03 ab0.0011
CRCF0.16 ± 0.05 a2.72 ± 0.85 b1.14 ± 0.47 ab0.20 ± 0.04 a0.00062
MC0.17 ± 0.03 a2.09 ± 0.35 a1.98 ± 1.02 a0.37 ± 0.20 a0.0038
Sucrose
(mg/g fresh wt)		ECCF2.69 ± 1.77 a9.58 ± 3.49 ab12.66 ± 3.23 ab14.27 ± 1.34 b0.0029
MC2.11 ± 1.56 a6.65 ± 0.66 ab10.36 ± 2.42 ab16.82 ± 4.01 b0.00088
USCF0.93 ± 0.87 a1.65 ± 0.98 aND0.40 ± 0.56 a0.25
MC1.47± 0.43 a1.57 ± 0.62 a0.28 ± 0.81 aND0.087
CRCF0.79 ± 0.27NDNDNDND
MC1.18 ± 0.66NDNDNDND
Glucose
(mg/g fresh wt)		ECCF2.78 ± 1.85 a4.43 ± 1.26 a4.52 ± 1.30 a5.06 ± 1.23 a0.31
MC4.89 ± 1.94 a3.62 ± 1.38 a1.90 ± 0.97 a3.55 ± 2.04 a0.23
USCF0.11 ± 0.10 a4.08 ± 1.16 b5.15 ± 1.01 b8.96 ± 0.48 c0.0000075
MC0.91 ± 0.23 a3.18 ± 0.82 a3.52 ± 2.28 a3.67 ± 2.20 a0.21
CRCF0.19 ± 0.17 a0.68 ± 0.17 bc0.45 ± 0.05 ab0.96 ± 0.04 c0.00038
MC0.14 ± 0.16 a0.67 ± 0.10 a0.66 ± 0.35 a1.14 ± 0.85 a0.15
Values are means ± SD (n = 3). The p-values in ANOVA are indicated. The means with different lowercase letter show significant differences in multiple comparisons among rice specimens collected at the different cultivation stages within the same part (elongated culm (EC), unelongated stem (US), and crown root (CR)) and same material (manure compost (MC) and chemical fertilizer (CF)) (p < 0.05). ND = not detected or not determined.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ao, Z.; Tsuchiya, M.; Xia, J.; Hayakawa, C.; Takahashi, Y.; Hirai, H.; Maeda, I. Nitrogen Fixation, Carbohydrate Contents, and Bacterial Microbiota in Unelongated Stem of Manure Compost-Applied Rice at Panicle Initiation. Microbiol. Res. 2024, 15, 1900-1912. https://doi.org/10.3390/microbiolres15030127

AMA Style

Ao Z, Tsuchiya M, Xia J, Hayakawa C, Takahashi Y, Hirai H, Maeda I. Nitrogen Fixation, Carbohydrate Contents, and Bacterial Microbiota in Unelongated Stem of Manure Compost-Applied Rice at Panicle Initiation. Microbiology Research. 2024; 15(3):1900-1912. https://doi.org/10.3390/microbiolres15030127

Chicago/Turabian Style

Ao, Zhalaga, Miu Tsuchiya, Juan Xia, Chie Hayakawa, Yukitsugu Takahashi, Hideaki Hirai, and Isamu Maeda. 2024. "Nitrogen Fixation, Carbohydrate Contents, and Bacterial Microbiota in Unelongated Stem of Manure Compost-Applied Rice at Panicle Initiation" Microbiology Research 15, no. 3: 1900-1912. https://doi.org/10.3390/microbiolres15030127

APA Style

Ao, Z., Tsuchiya, M., Xia, J., Hayakawa, C., Takahashi, Y., Hirai, H., & Maeda, I. (2024). Nitrogen Fixation, Carbohydrate Contents, and Bacterial Microbiota in Unelongated Stem of Manure Compost-Applied Rice at Panicle Initiation. Microbiology Research, 15(3), 1900-1912. https://doi.org/10.3390/microbiolres15030127

Article Metrics

Back to TopTop