Next Article in Journal
Extended-Spectrum Beta-Lactamase-Producing and Multidrug-Resistant Escherichia coli and Klebsiella spp. from the Human–Animal–Environment Interface on Cattle Farms in Burkina Faso
Previous Article in Journal
Biological Strategies to Minimize Fertilizer Use in Maize: Efficacy of Trichoderma harzianum and Bacillus subtilis
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microbiology Research
Volume 15
Issue 4
10.3390/microbiolres15040152
microbiolres-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Isolation and Molecular Characterization of Corynebacterium pseudotuberculosis from Goats in Andaman and Nicobar Islands, India

by
Jai Sunder
*,
Arun Kumar De
*,
Tamilvanan Sujatha
,
Gayatri Chakraborty
,
Srikoti Chandershekhar Mayuri
,
Debasis Bhattacharya
,
Rafeeque Rahman Alyethodi
and
Eaknath Bhanudasrao Chakurkar
Indian Council of Agricultural Research-Central Island Agricultural Research Institute, Port Blair 744 105, India
*
Authors to whom correspondence should be addressed.
Microbiol. Res. 2024, 15(4), 2274-2285; https://doi.org/10.3390/microbiolres15040152
Submission received: 4 October 2024 / Revised: 5 November 2024 / Accepted: 6 November 2024 / Published: 8 November 2024
Browse Figures
Review Reports Versions Notes

Abstract

:
Caseous lymphadenitis (CLA), caused by the bacteria Corynebacterium pseudotuberculosis, is a highly contagious disease of small ruminants, especially of goats and sheep. Here, we report an outbreak of the disease in goats for the first time from the Andaman and Nicobar Islands along with isolation and molecular characterization of the pathogen. A total of 22 goats were affected, with an attack rate of 12.02%, and six isolates were identified from the clinical samples. Molecular characterization of the pathogen was carried out based on the sequence information of 16S rRNA and RNA polymerase β subunit (rpoB) gene fragments. rpoB-based phylogenetic analysis indicated that the isolates belonged to Corynebacterium pseudotuberculosis biovar ovis. The antimicrobial resistance study revealed that the isolates were 100% resistant against erythromycin and rifampicin. Fifty percent resistance was found against amoxicillin/clavulanic acid, ciprofloxacin, penicillin, and vancomycin. All the isolates were sensitive to tetracycline, chloramphenicol, cotrimoxazole, sulphafurazole, ampicillin/cloxacillin, and oxytetracycline. In conclusion, the present study reports the occurrence of CLA in goats for the first time from an isolated archipelago of India and unveils the molecular signature and antibiotic resistance patten of the pathogen. The findings of this study will be helpful to control or eradicate the disease from the Andaman and Nicobar Islands.

1. Introduction

Caseous lymphadenitis (CLA) is an infectious disease of goats and sheep; however, the disease has also been reported from cattle, horses, camels, and buffalo [1,2]. The causative organism of the disease is Corynebacterium pseudotuberculosis, which is a Gram-positive facultative intracellular bacterium. The disease is mainly manifested by the formation of nodular abscesses in lymph nodes, skin, and in internal organs of livestock species [3,4]. Wounds mostly appear on the head, neck, and sternum region in small ruminants. Abscesses can also develop in the internal organs viz. the lungs, kidneys, liver, and spleen [5,6,7]. The zoonotic potential of the organism has also been demonstrated [8,9,10]. The virulence of the organism is mainly due to the production of an exotoxin called phospholipase D [11]. Bacteria are released from the wounds of the infected animals and contaminate the surrounding environment. Transmission of the bacteria to new hosts occurs through open wounds, abrasions, mucous membranes, or by oral or respiratory routes [12,13].
Caseous lymphadenitis is a highly contagious disease with a significant economic impact, particularly in sheep and goat husbandry. Economic losses occur due to a reduction in wool, hide, meat and milk production, loss of fertility, and culling of the affected animals [14,15]. As per the WOAH (World Organization for Animal Health), 64 countries of America, Africa, Europe, Asia, and Oceania declared that they had reported CLA [16]. The exact prevalence of this disease is underestimated in many countries since it is not a notifiable disease. Further, livestock owners are also not aware of the serious economic impact of this disease and usually do not seek for any veterinary help for the control of superficial abscesses. However, the prevalence of CLA ranges from 8 to 90% in different countries [17,18,19]. Very few reports on the occurrence of CLA in sheep and goats are available from India [20,21,22,23].
The diagnosis of CLA is generally based on a clinical examination of the lesions, followed by isolation of the causative organism (Corynebacterium pseudotuberculosis) and its identification by phenotypic, biochemical, and serological tests and by polymerase chain reaction (PCR) [3,14,24]. PCR-based diagnosis has been found to be very useful in the accurate diagnosis of the disease. PCR is based on the amplification of 16S rRNA, phospholipase D, and rpoB genes [25].
The Andaman and Nicobar Islands (ANI), an archipelago made up of 836 islands and islets, is situated in the intersection of the Andaman Sea (east side) and the Bay of Bengal (west side). Goat constitutes about 42.1% of the total livestock population on these islands, and these animals are an integral part of the livestock system [26,27]. The disease pattern in the goats indicated the sero-prevalence of Brucella melitensis, Mycoplasma capri, and Leptospirosis [28,29]. Other diseases like pox virus infection, contagious ecthyma (orf), enterotoxaemia, and gastrointestinal parasitism are also observed [28]. In recent years, seasonal and sporadic incidence of contagious ecthyma (orf) in goats has been observed on these islands. However, no reference on the occurrence of caseous lymphadenitis in goats is available on these islands. This communication describes the first confirmatory diagnosis of the caseous lymphadenitis outbreak in goats on the Andaman and Nicobar Islands. In the present study, we have isolated the causative organism from the clinical samples, and confirmation has been achieved by biochemical tests and by PCR. Moreover, the resistance pattern of the isolated organism against commonly used antibiotics has been evaluated.

2. Materials and Methods

2.1. Study Area

The current study was undertaken on the Andaman and Nicobar Islands, an archipelago located at the junction between the Andaman Sea (east side) and the Bay of Bengal (west side). The climate of the Andaman and Nicobar Islands is humid tropic with an average rainfall of about 3000 mm and average minimum and maximum temperature of about 23.34 °C and 30.16 °C, respectively. Goats constitute an important productive asset of landless, marginal, and small land holders of these islands, and they generate a flow of income and employment throughout the year [26]. The majority of farmers rear their goats under a kachcha house made of locally available resources like bamboo, coconut thatch, and tin. Goats are generally let loose for open grazing in the field for 6–7 h, and during the night time, very few farmers offer some supplemental feed, viz. rice, wheat, wheat flour, or some locally available tree leaves. No vaccination is performed on these islands for any disease.

2.2. History and Clinical Report

Goats with visible abscesses (Figure 1) in the neck, thigh, flank, and submandibular regions were reported from the LivestocK Farm Complex, ICAR-CIARI, Port Blair, Cofeebagicha village, Indiranagar village, and Garacharma village of the South Andaman district. A total of 22 goats were affected with suspected CLA cases, with an attack rate of 12.02%. The number of affected males was higher (68.18%) compared to females (31.82%). The consistency of the enlarged lymph nodes at different sites varied from soft to medium to hard without any pain on pressing.

2.3. Collection of Samples, Isolation of Bacteria, and Biochemical Tests

Areas affected with enlarged lymph node or abscess were shaved and cleaned with antiseptic solution. Pus exudate (six samples) was aspirated with the help of a sterile needle and transported to the Animal Science Division Laboratory, ICAR-CIARI, Port Blair, for isolation of the bacteria. The pus samples were inoculated into brain heart infusion broth (HiMedia, Thane, India) and grown overnight at 37 °C. Subsequently, the growth was streaked onto brain heart infusion agar (HiMedia, Thane, India) and incubated at 37 °C for 24 h. Colonies were examined for color, consistency, and stained with Gram’s stain. Gram-positive bacteria with coccobacilli arrangements were picked and kept for further processing. The isolated colonies were tested for catalase production, urease, nitrate reduction, sugar fermentation tests, etc., for preliminary identification and confirmation of Corynebacterium pseudotuberculosis.

2.4. Molecular Confirmation of Corynebacterium pseudotuberculosis

Genomic DNA was extracted from the isolated cultures using a DNA extraction kit (GCC Biotech India Pvt. Ltd., Bakrahat, India) according to the manufacturer’s instructions. The isolated DNA was then transferred to a clean tube and stored at −20 °C until used for PCR. 16S rRNA and rpoB genes were amplified using the primers listed in Table 1.
The reaction volume of the PCR mixture was 25 μL, which contained 12.5 μL PCR master mix (2X Hot Star G9 Taq PCR master mix, GCC Biotech India Pvt. Ltd., Bakrahat, India), forward and reverse primers 10 pMol each, template DNA 30 ng, and nuclease-free water to make up the volume. PCR was performed in a thermal cycler (Biometra, Göttingen, Germany). The PCR cycling condition was initial denaturation at 94 °C for 5 min followed by 35 cycles of denaturation at 94 °C for 30 s, annealing (at 56 °C for 60 s for 16S rRNA; 58 °C for 30 s for rpoB) and extension at 72 °C for 1 min and 30 s, followed by a final extension at 72 °C for 7 min for 16S rRNA and 10 min for rpoB. The PCR products were agarose gel electrophoresed containing ethidium bromide, and the gel was visualized and documented in a gel documentation system (Labmate Asia, Chennai, India). Sequence information for both 16S rRNA (3 isolates) and rpoB (2 isolates) was generated by Eurofins Scientific India Pvt. Ltd., Bengaluru, India. All the nucleotide sequences were deposited to the NCBI GenBank (Accession numbers PP348281-83 for 16S rRNA and PP355999 and PP356000 for rpoB).

2.5. Bioinformatics Analysis

For species identification, the generated sequences of 16S rRNA were analyzed using a local BLAST search (http://blast.ncbi.nlm.nih.gov/Blast.cgi accessed on 15 July 2024). In local BLAST (BLASTn) search, the generated sequences were used as query sequences, ‘rRNA/ITS’ as the database, and “16S ribosomal RNA sequences of Bacteria and Archaea” as the Targeted Loci Project Information, and the “megablast” program command was selected. Species identification was based on sequences from the database with the highest index of identity, highest score, and lowest e-value.
Biovar assignment of the isolated strains of C. pseudotuberculosis was conducted based on the sequence information of the rpoB gene. Representative sequences of C. pseudotuberculosis biovar ovis and equi were retrieved from GenBank (www.ncbi.nlm.nih.gov accessed on 7 June 2023) (Table 2). Sequence alignment was carried out in Molecular Evolutionary Genetics Analysis (MEGA X) [32] using Clustal W [33]. A phylogenetic tree was constructed by the Neighbor Joining (NJ) method [34] using the Tamura–Nei model [35]. The Bayesian phylogenetic relationship of the sequences was established in BEAST v 1.10.4 [36] using the MCMC model, and the median-joining network was constructed in PopART ver. 1.7 [37].

2.6. Antibiotic Sensitivity/Resistance Test

The isolated and confirmed strains of Corynebacterium pseudotuberculosis were tested for the antimicrobial resistance/sensitivity test as per the standard procedure of the Kirby–Bauer method of a disk diffusion assay [38]. The isolates were screened against 12 antimicrobial disks (HiMedia, Thane, India). The antibiotics used in this study were amikacin (AK) (30 µg), amoxicillin/clavulanic acid (AMC) (20/10 µg), ampicillin (AMP) (10 µg), ampicillin/cloxacillin (AX) (10 µg), chloramphenicol (C) (30 µg), ciprofloxacin (CIP) (5 µg), cotrimoxazole (COT) (23.75/1.25 µg), erythromycin (E) (15 µg), gentamicin (GEN) (10 µg), oxytetracycline (O) (30 µg), sulphafurazole (SF) (300 µg), and tetracycline (TE) (30 µg). The interpretation of the susceptibility or resistance was calculated as per the CLSI recommendation [39]. The isolates were then categorized as sensitive, intermediately resistant, or resistant.

3. Results

3.1. Outbreak Details

An outbreak of caseous lymphadenitis was observed in goats of South Andaman. A total of 22 goats were affected, with an attack rate of 12.02%. All the affected goats showed typical abscess formation in the neck, submandibular, thigh, and abdomen regions. The size of the affected lymph nodes ranged from 2 to 8 cm in diameter. The abscess was painless, and the color of the pus exudates was creamy white to yellowish white with a thick consistency. All isolates (n = 6) of C. pseudotuberculosis recovered from lymph node abscesses were Gram-positive coccobacilli to short bacilli, non-sporulated, non-capsulated, non-motile, and appeared as single, pairs in acute angles (like Chinese letter), or in palisade arrangements. All the isolates were positive for urease and catalase and negative for nitrate reduction and gelatin liquefaction, while the results of the sugar fermentation tests were glucose-positive, trehalose-negative, and other sugars of variable results.

3.2. Molecular Confirmation and Characterization

All the isolates were investigated for the presence of 16S rRNA and rpoB genes using specific primers. All the isolates of C. pseudotuberculosis gave positive results for the amplification of 16S rRNA and rpoB genes with fragment sizes of 815 bp and 446 bp, respectively (Figure 2).

3.2.1. Species Identification Test Using Local BLAST Based on 16S rRNA Sequence

The generated sequences of all three isolates showed 100% sequence similarity, indicating that the three isolates belong to the same species. The BLASTn search result (Table 3) using the Andaman isolate as a query indicated high identity (I) and score (S), as well as null e-values with Corynebacterium pseudotuberculosis (100% sequence identity), which indicated that Andaman isolates belong to Corynebacterium pseudotuberculosis.

3.2.2. Phylogenetic Analysis: Biover Assignment Based on rpoB Gene Fragments

Bacterial strains belonging to C. pseudotuberculosis are divided into two biovars: the biovar ovis and equi. The biovar ovis strains infect small ruminants, whereas biovar equi strains mainly infect horses and buffaloes [3,40]. In the present study, biovar assignment of C. pseudotuberculosis Andaman isolates was carried out based on the partial sequence information of rpoB. Based on NJ (Figure 3) and Bayesian (Figure 4) phylogenetic tree, it was found that Andaman isolates were under C. pseudotuberculosis biovar ovis. The network tree of C. pseudotuberculosis Andaman isolates with reference sequences of C. pseudotuberculosis biovar ovis and biovar equi indicated that Andaman isolates shared a close relationship with C. pseudotuberculosis biovar ovis (Figure 5).

3.3. Antimicrobial Susceptibility Patterns

A total of four isolates of C. pseudotuberculosis were tested for susceptibility to 14 antibiotics. As shown in Table 4, the susceptibility pattern of C. pseudotuberculosis to antimicrobial agents varied among isolates according to the CLSI 2018 [39]. Most of the isolates were absolutely sensitive to ampicillin/cloxacillin, chloramphenicol, cotrimoxazole, oxytetracycline, sulphafurazole, and tetracycline. Sensitivity of 75% was shown against gentamicin and trimethoprim. Fifty percent of the isolates were sensitive to amoxicillin/clavulanic acid, ciprofloxacin, penicillin, and vancomycin. Absolute resistance was found against erythromycin.

4. Discussion

On the Andaman & Nicobar Islands, cases of caseous lymphadenitis have never been reported before. An outbreak of CLA was reported from the South Andaman district of the Andaman and Nicobar Islands. This is the first report of a confirmative diagnosis of CLA in goats from the Andaman and Nicobar Islands. Caseous lymphadenitis causes significant economic losses to livestock farmers mainly because of a reduction in the quality of the wool, meat, and skin of affected animals. The present study shows that the attack rate of CLA in goats was 12.02% based on the clinical examination and molecular identification of the causative organism. Earlier reports from various places like Turkey, India, Egypt, and Australia showed that the incidence rate of CLA ranged from 1.65 to 30% [23,25,41,42,43]. CLA in goats and sheep manifests as both external and internal forms. However, the external forms are more common than the internal forms. In the present work, we also observed abscess formation in the superficial lymph nodes and subcutaneous tissues, mainly in the submandibular region, flank, and neck. Baird and Fontaine [3] also reported manifestation of the abscess formation in the lymph nodes and subcutaneous tissues. In the present study, only adult animals were found to be affected with CLA. A similar observation was also reported by Abebe and Tessema [44], who observed that caseous lymphadenitis was more common in adults than in young animals.
The diagnosis of CLA is mainly based on the clinical examination of the lesions followed by the isolation of the pathogen and its cultural identification [45,46]. The use of PCR-based confirmative diagnosis based on 16S rRNA, phospholipase D(PLD), and rpoB genes has been suggested by many researchers [25]. In the present study, we used both cultural isolation, identification, and PCR-based confirmation of Corynebacterium pseudotuberculosis. All six isolates were confirmed by PCR assay, which suggests that both cultural isolation and identification and PCR confirmation are standard procedures for the diagnosis of CLA. In our present study, we used 16S rRNA and rpoB genes in the PCR for the identification and confirmation of C. pseudotuberculosis. rpoB, pld, and 16S rRNA genes for the PCR amplification were also used by other researchers [25,47,48]. Khamis et al. [24] suggested using only rpoB gene sequencing for identification because of its smaller size than the 16S rRNA gene and ease of sequencing. In the present study, we found that the use of 16S rRNA and rpoB is equally important for the identification of Corynebacterium up to the species level. Various studies have been conducted to evaluate the ability of molecular diagnostic tests to identify Corynebacterium pseudotuberculosis [49,50]. The use of 16S rRNA and rpoB gene amplification and sequencing has been found to be the gold standard test for the identification of Corynebacterium pseudotuberculosis up to the species level. We found that the Andaman isolates belonged to the C. pseudotuberculosis biovar ovis based on the sequence information of the rpoB gene.
Varied sensitivity of C. pseudotuberculosis to different antimicrobials has been reported by many researchers [51,52,53,54]. In the present study, antimicrobial resistance was found to be 100% against erythromycin and rifampicin, followed by amikacin (75%). Fifty percent resistance was found against amoxicillin/clavulanic acid, ciprofloxacin, penicillin, and vancomycin. All the isolates were sensitive to ampicillin/cloxacillin, chloramphenicol, cotrimoxazole, oxytetracycline, sulphafurazole, and tetracycline. In the present study, the antibiotic resistance of C. pseudotuberculosis isolates was found to be less compared to the high antibiotic resistance observed against these antibiotics. This could be attributed to the lower degree of exposure of the isolates against antibiotics and less usage of antibiotics for the treatment of CLA on the Andaman and Nicobar Islands. Gallardo et al. [55] reported the high susceptibility of C. pseudotuberculosis to ciprofloxacin (65.4%), norfloxacin (46.2%), gentamycin (42%), and enrofloxacin (42.3%). We observed that all the isolates were sensitive to chloramphenicol. Similarly, Hammad et al. [56] also reported that 80% of the isolates were sensitive to chloramphenicol. El Tawab [57] also observed the high susceptibility of C. pseudotuberculosis isolates to chloramphenicol. Tatavarthy et al. [58] observed that the following first line of drugs, tetracycline, chloramphenicol, and trimethoprim, should be considered for use in the treatment of CLA infection. This will also help in minimizing antibiotic resistance against third- and fourth-generation antibiotics. From our present findings, we can suggest that ampicillin/cloxacillin (AX), chloramphenicol, cotrimoxazole, oxytetracycline, sulphafurazole, tetracycline, and trimethoprim are safe and can be used for the treatment of CLA in goats on the Andaman and Nicobar Islands.
Treatment of the affected animals was performed with oxytetracycline injection LA (20 mg/kg body weight I/M route) with the cleaning of the abscess with saline water and chlorhexidine. The response to treatment was found to be poor and prolonged. It is generally observed that the treatment of the affected animals with CLA is very difficult, and in most of the cases, the animals are discarded or culled. The affected animals spread the infection to other healthy animals through the oozing of pus. The bacteria can survive in the soil and environment for several months and can infect other animals [15,59]. There are reports of the zoonotic importance of this disease, as clinical cases of human lymphadenitis were reported to occur through the consumption of raw milk from infected sheep or through direct contact of persons with cracked skin with an external open abscess in animals [9]. Considering its zoonotic potential, a strategy for the control of this disease is very much essential in the endemic areas. On the Andaman and Nicobar Islands, the disease has never been reported. The present investigation suggests a risk of the outbreak of CLA in the endemic zone on these islands. The islands are generally free from many of the dreaded livestock and poultry diseases [28,29]. However, the occurrence of CLA with an overall attack rate of 12.02% is alarming and a threat to the goat population of these islands. Therefore, a strategy is needed to control and contain CLA on the islands. In the initial steps, the identified affected animals should be segregated and should not be allowed to graze with other animals. Subsequently, regular surveillance and monitoring mechanisms should be implemented for the disease’s eradication from the zone.

5. Conclusions

This communication is the first report on a confirmative diagnosis of caseous lymphadenitis in goats from the Andaman and Nicobar Islands. The causative organism was isolated and confirmed as Corynebacterium pseudotuberculosis based on biochemical- and molecular-based approaches. The phylogenetic analysis based on the rpoB gene confirmed that the isolates belonged to C. pseudotuberculosis biovar ovis.

Author Contributions

Conceptualization, J.S. and A.K.D.; methodology, A.K.D., T.S., G.C., S.C.M., and R.R.A.; software, A.K.D.; validation, D.B. and E.B.C.; formal analysis, A.K.D. and J.S.; investigation, J.S., A.K.D. and T.S.; resources, J.S.; data curation, A.K.D. and J.S.; writing—original draft preparation, A.K.D.; writing—review and editing, J.S.; visualization, D.B.; supervision, E.B.C.; project administration, J.S.; funding acquisition, J.S. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Indian Council of Agricultural research, New Delhi, India.

Institutional Review Board Statement

This animal study protocol was approved by the Institutional Animal Ethics Committee of ICAR-Central Island Agricultural Research Institute, Port Blair, Andaman and Nicobar Islands, India (protocol code ICAR-CIARI/AS/210 and date of approval 7 June 2023).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of the data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Anderson, D.E.; Rings, D.M.; Kowalski, J. Infection with Corynebacterium pseudotuberculosis in five alpacas. J. Am. Vet. Med. Assoc. 2004, 225, 1743–1747. [Google Scholar] [CrossRef] [PubMed]
  2. Braga, W.U.; Chavera, A.; Gonzalez, A. Corynebacterium pseudotuberculosis infection in highland alpacas (Lama pacos) in Peru. Vet. Rec. 2006, 159, 23–24. [Google Scholar] [CrossRef]
  3. Baird, G.J.; Fontaine, M.C. Corynebacterium pseudotuberculosis and its role in ovine caseous lymphadenitis. J. Comp. Pathol. 2007, 37, 179–210. [Google Scholar] [CrossRef] [PubMed]
  4. Baird, G.J. Caseous lymphadenitis. In Diseases of Sheep, 4th ed.; Aitken, I.D., Ed.; Blackwell Publishing: Victoria, Australia, 2007; pp. 306–312. [Google Scholar]
  5. Merchant, I.A.; Packer, R.A. The Genus Corynebacterium. In Veterinary Bacteriology and Virology; Merchant, I.A., Packer, R.A., Eds.; The Iowa State University Press: Ames, IA, USA, 1967; pp. 425–440. [Google Scholar]
  6. Piontkowski, M.D.; Shivvers, D.W. Evaluation of a commercially available vaccine against Corynebacterium pseudotuberculosis for use in sheep. J. Am. Vet. Med. Assoc. 1998, 212, 1765–1768. [Google Scholar] [CrossRef] [PubMed]
  7. Zavoshti, F.R.; Khoojine, A.; Helan, J.; Hassanzadeh, B.; Heydari, A.A. Frequency of caseous lymphadenitis (CLA) in sheep slaughtered in an abattoir in Tabriz: Comparison of bacterial culture and pathological study. Comp. Clin. Pathol. 2012, 21, 667–671. [Google Scholar] [CrossRef]
  8. Mills, A.E.; Mitchell, R.D.; Lim, E.K. Corynebacterium pseudotuberculosis is a cause of human necrotising granulomatous lymphadenitis. Pathology 1997, 29, 231–233. [Google Scholar] [CrossRef]
  9. Peel, M.M.; Palmer, G.G.; Stacpoole, A.M.; Kerr, T.G. Human lymphadenitis due to Corynebacterium pseudotuberculosis: Report of ten cases from Australia and review. Clin. Infect. Dis. 1997, 24, 185–191. [Google Scholar] [CrossRef]
  10. Heggelund, L.; Gaustad, P.; Håvelsrud, O.E.; Blom, J.; Borgen, L.; Sundset, A.; Sørum, H.; Frøland, S.S. Corynebacterium pseudotuberculosis Pneumonia in a Veterinary Student Infected During Laboratory Work. Open Forum Infect. Dis. 2015, 2, ofv053. [Google Scholar] [CrossRef]
  11. Bradford Smith, B.P. Large Animal Internal Medicine, 5th ed.; Mosby: St. Louis, MO, USA, 2014; pp. 1–1712. [Google Scholar]
  12. Windsor, P.A. Control of caseous lymphadenitis. Vet. Clin. N. Am. Food Anim. Pract. 2011, 27, 193–202. [Google Scholar] [CrossRef]
  13. Oreiby, A.F. Diagnosis of caseous lymphadenitis in sheep and goat. Small Rumin. Res. 2015, 23, 160–166. [Google Scholar] [CrossRef]
  14. Guimaraes, A.S.; Carmo, F.B.; Pauletti, R.B.; Seyffert, N.; Ribeiro, D.; Lage, A.P.; Heinemann, M.B.; Miyoshi, A.; Azevedo, V.; Gouveia, A.M.G. Caseous lymphadenitis epidemiology diagnosis and control. Integr. Omics Appl. Biotechnol. J. 2011, 2, 33–43. [Google Scholar]
  15. Williamson, L.H. Caseous lymphadenitis in small ruminants. Vet. Clin. N. Am. Food Anim. Pract. 2002, 17, 359–371. [Google Scholar] [CrossRef] [PubMed]
  16. WOAH. World Organization for Animal Health. 2009. Available online: https://www.woah.org/en (accessed on 23 August 2024).
  17. Kuria, J.; Holstad, G. A Seroepidemiological Investigation of Corynebacterium Pseudotuberculosis Infection in Sheep Flocks in Southern Norway. Acta Vet. Scand. 1989, 30, 107–108. [Google Scholar] [CrossRef]
  18. Middleton, M.J.; Epstein, V.M.; Gregory, G.G. Caseous lymphadenitis on Flinders Island: Prevalence and management surveys. Aust. Vet. J. 1991, 69, 311–313. [Google Scholar] [CrossRef]
  19. Stanford, K.; Brogden, K.A.; McClelland, L.A.; Kozub, G.C.; Audibert, F. The incidence of caseous lymphadenitis in Alberta sheep and assessment of impact by vaccination with commercial and experimental vaccines. Can. J. Vet. Res. 1988, 62, 38–43. [Google Scholar]
  20. Muthukumar, S.; Samuel, B.; Ronald, M.; Hemalatha, S.; Sundram, S.M.; Sughanth, M. Outbreak of caseous lymphadenitis in an organized goat farm. J. Entomol. Zool. Stud. 2020, 8, 9–11. [Google Scholar]
  21. Kumar, J.; Singh, F.; Tripathi, B.N.; Kumar, R.; Dixit, S.K.; Sonawane, G.G. Epidemiological, bacteriological and molecular studies on caseous lymphadenitis in Sirohi goats of Rajasthan India. Trop. Anim. Health Prod. 2012, 44, 1319–1322. [Google Scholar] [CrossRef]
  22. Mohan, P.; Vathsala, M.; Jayaprakasan, V. Comparative characterization of Corynebacterium pseudotuberculosis from goats in Kerala, India and reference strain. Small Rumin. Res. 2008, 74, 226–230. [Google Scholar] [CrossRef]
  23. Tripathi, B.N.; Kumar, J.; Sonawane, G.G.; Kumar, R.; Dixit, S.K. Microbiological and molecular investigation of clinically suspected caseous lymphadenitis cases in goats. Agric. Res. 2016, 5, 413–419. [Google Scholar] [CrossRef]
  24. Khamis, A.; Raoult, D.; La Scola, B. Comparison between rpoB and 16S rRNA gene sequencing for molecular identification of 168 clinical isolates of Corynebacterium. J. Clin. Microbiol. 2005, 43, 1934–1936. [Google Scholar] [CrossRef]
  25. Cetinkaya, B.; Karahan, M.; Atil, E.; Kalin, R.; De Baere, T.; Vaneechoutte, M. Identification of Corynebacterium pseudotuberculosis isolates from sheep and goats by PCR. Vet. Microbiol. 2002, 88, 75–83. [Google Scholar] [CrossRef] [PubMed]
  26. Sunder, J.; Kundu, A.; Kundu, M.S.; Sujatha, T.; De, A.K. Farming practices and morphometric characterization of Andaman Local Goat. Indian J. Anim. Res. 2019, 53, 1097–1103. [Google Scholar] [CrossRef]
  27. De, A.K.; Sawhney, S.; Sunder, J.; Muthiyan, R.; Ponraj, P.; Sujatha, T.; Malakar, D.; Mondal, S.; Bera, A.K.; Kumar, A.; et al. Peeping into mitochondrial diversity of Andaman goats: Unveils possibility of maritime transport with diversified geographic signaling. Genes 2023, 14, 784. [Google Scholar] [CrossRef] [PubMed]
  28. Sunder, J.; Rai, R.B.; Kundu, A.; Chatterjee, R.N.; Senani, S.; Jeyakumar, S. Incidence and prevalence of livestock diseases of A&N Islands. Indian J. Anim. Sci. 2005, 75, 1041–1043. [Google Scholar]
  29. Sunder, J. Status of livestock and poultry disease in A & N Islands: Strategies to make island disease free. Adv. Anim. Vet. Sci. 2014, 2, 42–47. [Google Scholar]
  30. Umer, M.; Abba, Y.; Abdullah, F.F.J.; Saleh, W.M.M.; Haron, A.W.; Saharee, A.A.; Ariff, A.B. Isolation and Identification of Corynebacterium pseudotuberculosis in Reproductive Organs and Pituitary Gland of Goats Vaccinated with Prototype Vaccine against Caseous Lymphadenitis. Saudi J. Pathol. Microbiol. 2017, 2, 70–77. [Google Scholar]
  31. Almeida, S.; Dorneles, E.M.S.; Diniz, C.; Vinicius, A.; Cassiana, S.; Jorianne, A.; Adriana, C.; Priscilla, B.; Sharon, S.; Debmalya, B.; et al. Quadruplex PCR assay for identification of Corynebacterium pseudotuberculosis differentiating biovar Ovis and Equi. BMC Vet. Res. 2017, 13, 290. [Google Scholar] [CrossRef]
  32. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
  33. Thompson, J.D.; Higgins, D.G.; Gibson, T.J. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22, 4673–4680. [Google Scholar] [CrossRef]
  34. Saitou, N.; Nei, M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar]
  35. Tamura, K.; Nei, M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 1993, 10, 512–526. [Google Scholar] [PubMed]
  36. Suchard, M.A.; Lemey, P.; Baele, G.; Ayres, D.L.; Drummon, A.J.; Rambaut, A. Bayesian phylogenetic and phylodynamic data integration using BEAST 1.10. Virus Evol. 2018, 4, vey016. [Google Scholar] [CrossRef] [PubMed]
  37. Leigh, J.W.; Bryant, D. Popart: Full-feature software for haplotype network construction. Methods Ecol. Evol. 2015, 6, 1110–1116. [Google Scholar] [CrossRef]
  38. Quinn, P.J.; Carter, M.E.; Markey, B.; Carter, G.R. Pseudomonas species. In Clinical Veterinary Microbiology; Quinn, P.J., Carter, M.E., Markey, B., Carter, G.R., Eds.; Wolfe: London, UK, 1994; pp. 237–242. [Google Scholar]
  39. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing; 27th Informational Supplement. M100-S28; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2018. [Google Scholar]
  40. Meng, W.; Chen, S.; Huang, L.; Yang, J.; Zhang, W.; Zhong, Z.; Zhou, Z.; Liu, H.; Fu, H.; He, T.; et al. Isolation, characterization, and pathogenicity assessment of Corynebacterium pseudotuberculosis biovar equi strains from alpacas (Vicugna pacos) in China. Front. Microbiol. 2023, 14, 1206187. [Google Scholar] [CrossRef]
  41. Al-Gaabary, M.H.; Osman, S.A.; Oreiby, A.F. Caseous lymphadenitis in sheep and goats: Clinical, epidemiological and preventive studies. Small Rumin. Res. 2009, 87, 116–121. [Google Scholar] [CrossRef]
  42. Mubarak, M.; Bastawrows, A.F.; Abdel-Hafeez, M.M.; Ali, M.M. Caseous lymphadenitis of sheep and goats in Assiut farms and abattoirs. Assiut Vet. Med. J. 1999, 42, 89–112. [Google Scholar]
  43. Paton, M.W.; Walker, S.B.; Rose, I.R.; Watt, G.F. Prevalence of caseous lymphadenitis and usage of caseous lymphadenitis vaccines in sheep flocks. Aust. Vet. J. 2003, 81, 91–95. [Google Scholar] [CrossRef]
  44. Abebe, D.; Sisay Tessema, T. Determination of Corynebacterium pseudotuberculosis prevalence and antimicrobial susceptibility pattern of isolates from lymph nodes of sheep and goats at an organic export abattoir, Modjo, Ethiopia. Lett. Appl. Microbiol. 2015, 61, 469–476. [Google Scholar] [CrossRef]
  45. Dorella, F.A.; Pacheco, L.G.C.; Oliveira, S.C. Corynebacterium pseudotuberculosis: Microbiology, biochemical properties, pathogenesis and molecular studies of virulence. Vet. Res. 2006, 37, 201–218. [Google Scholar] [CrossRef]
  46. D’Afonseca, V.; Moraes, P.M.; Dorella, F.A.; Pacheco, L.G.; Meyer, R.; Portela, R.W.; Miyoshi, A.; Azevedo, V. A description of genes of Corynebacterium pseudotuberculosis useful in diagnostics and vaccine applications. Genet. Mol. Res. 2008, 18, 252–260. [Google Scholar] [CrossRef]
  47. Pacheco, L.G.C.; Pena, R.R.; Castro, T.L.P.; Dorella, F.A.; Bahia, R.C.; Carminati, R.; Frota, M.N.L.; Oliveira, S.C.; Meyer, R.; Alves, F.S.F.; et al. Multiplex PCR assay for identification of Corynebacterium pseudotuberculosis from pure cultures and for rapid detection of this pathogen in clinical samples. J. Med. Microbiol. 2007, 56, 480–486. [Google Scholar] [CrossRef] [PubMed]
  48. Pavan, M.E.; Robles, C.; Cairó, F.M.; Marcellino, R.; Pettinari, M.J. Identification of Corynebacterium pseudotuberculosis from sheep by PCR-restriction analysis using the RNA polymerase β-subunit gene (rpoB). Res. Vet. Sci. 2012, 92, 202–206. [Google Scholar] [CrossRef] [PubMed]
  49. El-Sebay, N.A.; Mohamed, M.M.; El-Sergany, E.F.; Abbas, A.M.; Osman, R.M.; El-Moaty, D.A.M.A. Genetic Characterization of Corynebacterium pseudotuberculosis Isolates in Egypt. J. Appl. Vet. Sci. 2021, 6, 15–21. [Google Scholar] [CrossRef]
  50. Roux, V.; Drancourt, M.; Stein, A.; Riegel, P.; Raoult, D.; La Scola, B. Corynebacterium species isolated from bone and joint infections identified by 16S rRNA gene sequence analysis. J. Clin. Microbiol. 2004, 42, 2231–2233. [Google Scholar] [CrossRef]
  51. Muckle, C.A.; Gyles, C.L. Relation of lipid content and exotoxin production to virulence of Corynebacterium pseudotuberculosis in mice. Am. J. Vet. Res. 1983, 44, 1149–1153. [Google Scholar]
  52. Skalka, B.; Literák, I.; Michalík, I.; Skrivánek, M. Corynebacterium pseudotuberculosis infection in goats in the Czech Republic. Zentralbl Vet. B. 1998, 45, 31–35. [Google Scholar] [CrossRef]
  53. El Damaty, H.M.; El-Demerdash, A.S.; Abd El-Aziz, N.K.; Yousef, S.G.; Hefny, A.A.; Abo Remela, E.M.; Shaker, A.; Elsohaby, I. Molecular Characterization and Antimicrobial Susceptibilities of Corynebacterium pseudotuberculosis Isolated from Caseous Lymphadenitis of Smallholder Sheep and Goats. Animals 2023, 13, 2337. [Google Scholar] [CrossRef]
  54. Connor, K.M.; Fontaine, M.C.; Rudge, K.; Baird, G.J.; Donachie, W. Molecular genotyping of multinational ovine and caprine Corynebacterium pseudotuberculosis isolates using pulsed-field gel electrophoresis. Vet. Res. 2007, 38, 613–623. [Google Scholar] [CrossRef]
  55. Gallardo, A.A.; Toledo, R.A.; González Pasayo, R.A.; Azevedo, V.; Robles, C.; Paolicchi, F.A.; Estevao Belchior, S.G. Corynebacterium pseudotuberculosis biovar ovis: Evaluación de la sensibilidad antibiótica in vitro [Corynebacterium pseudotuberculosis biovar ovis: Evaluation of antibiotics susceptibility in vitro]. Rev. Argent. Microbiol. 2019, 51, 334–338. [Google Scholar]
  56. Hammad, O.M.; Hifnawy, T.; Omran, D.E.l.; Tantawi, M.A.; Girgis, N.I. Ceftriaxone versus Chloramphenicol for Treatment of Acute Typhoid Fever. Life Sci. J. 2011, 8, 100–105. [Google Scholar]
  57. El Tawab, A.A.A.; Rizk, A.M.; Afifi, S.E.; Mohamed, S.R. Corynebacterium Pseudotuberculosis infection in small ruminant and molecular study of virulence and resistance genes in Beni-Suef governorate. Benha Vet. Med. J. 2019, 37, 122–127. [Google Scholar]
  58. Tatavarthy, A.; Sanderson, R.; Peak, K.; Scilabro, G.; Davenhill, P.; Cannons, A.; Amuso, P. Molecular typing and resistance analysis of travel-associated Salmonella enterica serotype Typhi. J. Clin. Microbiol. 2012, 50, 2631–2638. [Google Scholar] [CrossRef] [PubMed]
  59. Soares, S.C.; Silva, A.; Trost, E.; Blom, J.; Ramos, R.; Carneiro, A.; Ali, A.; Santos, A.R.; Pinto, A.C.; Diniz, C.; et al. The pan-genome of the animal pathogen Corynebacterium pseudotuberculosis reveals differences in genome plasticity between the biovar ovis and equi strains. PLoS ONE 2013, 8, e53818. [Google Scholar] [CrossRef] [PubMed]
Microbiolres 15 00152 g001
Figure 1. CLA-affected goats.
Figure 1. CLA-affected goats.
Microbiolres 15 00152 g001
Microbiolres 15 00152 g002
Figure 2. Amplification of PCR product for 16S rRNA (A) and rpoB genes (B).
Figure 2. Amplification of PCR product for 16S rRNA (A) and rpoB genes (B).
Microbiolres 15 00152 g002
Microbiolres 15 00152 g003
Figure 3. Biovar assignment of C. pseudotuberculosis isolates based on rpoB gene fragments. Phylogenetic tree was constructed by the Neighbor Joining (NJ) method [34] using the Tamura–Nei model [35].
Figure 3. Biovar assignment of C. pseudotuberculosis isolates based on rpoB gene fragments. Phylogenetic tree was constructed by the Neighbor Joining (NJ) method [34] using the Tamura–Nei model [35].
Microbiolres 15 00152 g003
Microbiolres 15 00152 g004
Figure 4. Bayesian phylogenetic tree of C. pseudotuberculosis isolates established in BEAST v 1.10.4 [36].
Figure 4. Bayesian phylogenetic tree of C. pseudotuberculosis isolates established in BEAST v 1.10.4 [36].
Microbiolres 15 00152 g004
Microbiolres 15 00152 g005
Figure 5. Network map of C. pseudotuberculosis isolates. The network was constructed in PopART ver. 1.7 [37]. Numbers in brackets indicate number of mutations.
Figure 5. Network map of C. pseudotuberculosis isolates. The network was constructed in PopART ver. 1.7 [37]. Numbers in brackets indicate number of mutations.
Microbiolres 15 00152 g005
Table 1. Primers used in the present study.
Table 1. Primers used in the present study.
Target Gene Primer Sequence (5′–3′)Reference
16S rRNAForward: CCGCACTTTAGTGTGTGTG
Reverse: TCTCTACGCCGATCTTGTAT		[30]
rpoB Forward: CGTATGAACATCGGCCAGGT
Reverse: TCCATTTCGCCGAAGCGCTG		[31]
Table 2. rpoB sequences used in the present study.
Table 2. rpoB sequences used in the present study.
Accession NumberHostCountry
Corynebacterium pseudotuberculosis, Biovar ovis
HQ401568SheepChile
GU971389Sheep Germany
AY492239Pasteur isolateFrance
CP003385WildebeestSouth Africa
CP002924SheepArgentina
MT974533SheepIraq
MT974537SheepIraq
MT974528SheepIraq
ON993360SheepEgypt
CP034410SheepBrazil
CP019769SheepBrazil
CP026500GoatBrazil
CP035715GoatBrazil
CP035719GoatBrazil
HQ401569GoatChile
CP014543GoatMexico
CP014341SheepEgypt
CP015309GoatBrazil
CP020356GoatBrazil
MG692442SheepSudan
CP013146SheepEquatorial Guinea
CP017711GoatMexico
CP003407LlamaUSA
CP003152SheepScotland
Corynebacterium pseudotuberculosis, Biovar equi
OP946192AlpacaChina
OP946191AlpacaChina
OP946190AlpacaChina
GU818740EquineGermany
CP003082Equine field isolateUSA
CP003421BuffaloEgypt
CP003540HorseBelgium
HQ401570HorseChile
CP026501HorseUSA
CP024442HorseUSA
CP023395HorseUSA
CP017292HorseMexico
CP017291HorseMexico
CP012136HorseChile
Outgroups
AY492271Corynebacterium ulcerans
AY492230Corynebacterium diphtheriae
AY492279Corynebacterium propinquum
AY492275Corynebacterium urealyticum
AY492274Corynebacterium kroppenstedtii
AY492236Corynebacterium bovis
Table 3. BLASTn search results based on 16S rRNA (top 5 hits).
Table 3. BLASTn search results based on 16S rRNA (top 5 hits).
SpeciesTotal ScoreE-ValueQuery Coverage (%)Percent Identity
Corynebacterium pseudotuberculosis (NR_117210.1)14340.0100%100.00%
Corynebacterium pseudotuberculosis (NR_119175.1)14340.0100%100.00%
Corynebacterium pseudotuberculosis (NR_115562.1)14340.0100%100.00%
Corynebacterium ulcerans (NR_117211.1)14260.0100%99.87%
Corynebacterium pseudotuberculosis (NR_037070.1)14260.0100%99.74%
Table 4. Pattern of antibiotic resistance (number of isolates = 4) in Corynebacterium pseudotuberculosis.
Table 4. Pattern of antibiotic resistance (number of isolates = 4) in Corynebacterium pseudotuberculosis.
ClassAntibioticsNumber of Isolates
S I R
Aminoglycoside Amikacin (AK)103 (75%)
PenicillinAmoxicillin/clavulanic acid (AMC)112 (50%)
PenicillinAmpicillin/cloxacillin (AX)130
PhenicolChloramphenicol (C)400
Quinolone Ciprofloxacin (CIP)022 (50%)
SulfonamidesCotrimoxazole (COT)400
Macrolide Erythromycin (E)004 (100%)
Aminoglycoside Gentamicin (GEN)211 (25%)
Tetracycline Oxytetracycline (O)400
PenicillinPenicillin (P)202 (50%)
RifamycinRifampicin (Rf)004 (100%)
SulfonamidesSulphafurazole (SF)400
Tetracycline Tetracycline (TE)310
SulfonamidesTrimethoprim (Tri)321 (25%)
Glycopeptide antibiotics Vancomycin (V)202 (50%)
S = sensitive, I = intermediate, R = resistant.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Sunder, J.; De, A.K.; Sujatha, T.; Chakraborty, G.; Mayuri, S.C.; Bhattacharya, D.; Alyethodi, R.R.; Chakurkar, E.B. Isolation and Molecular Characterization of Corynebacterium pseudotuberculosis from Goats in Andaman and Nicobar Islands, India. Microbiol. Res. 2024, 15, 2274-2285. https://doi.org/10.3390/microbiolres15040152

AMA Style

Sunder J, De AK, Sujatha T, Chakraborty G, Mayuri SC, Bhattacharya D, Alyethodi RR, Chakurkar EB. Isolation and Molecular Characterization of Corynebacterium pseudotuberculosis from Goats in Andaman and Nicobar Islands, India. Microbiology Research. 2024; 15(4):2274-2285. https://doi.org/10.3390/microbiolres15040152

Chicago/Turabian Style

Sunder, Jai, Arun Kumar De, Tamilvanan Sujatha, Gayatri Chakraborty, Srikoti Chandershekhar Mayuri, Debasis Bhattacharya, Rafeeque Rahman Alyethodi, and Eaknath Bhanudasrao Chakurkar. 2024. "Isolation and Molecular Characterization of Corynebacterium pseudotuberculosis from Goats in Andaman and Nicobar Islands, India" Microbiology Research 15, no. 4: 2274-2285. https://doi.org/10.3390/microbiolres15040152

APA Style

Sunder, J., De, A. K., Sujatha, T., Chakraborty, G., Mayuri, S. C., Bhattacharya, D., Alyethodi, R. R., & Chakurkar, E. B. (2024). Isolation and Molecular Characterization of Corynebacterium pseudotuberculosis from Goats in Andaman and Nicobar Islands, India. Microbiology Research, 15(4), 2274-2285. https://doi.org/10.3390/microbiolres15040152

Article Metrics

Back to TopTop