Next Article in Journal
Evaluation of the Allelopathic Activity of Albizia procera (Roxb.) Benth. as a Potential Source of Bioherbicide to Control Weeds
Previous Article in Journal
On Using the Allium Test for Waterbody Biomonitoring in the Murmansk Region
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJPB
Volume 13
Issue 4
10.3390/ijpb13040041
ijpb-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

SCR Suppressor Mutants: Role in Hypocotyl Gravitropism and Root Growth in Arabidopsis thaliana

by
Archana Sharma
1,*,
Zahida Hassan Pervaiz
2 and
Joanna Wysocka-Diller
2
1
Biology Department, Tuskegee University, Tuskegee, AL 36088, USA
2
Biological Sciences, Auburn University, Auburn, AL 36849, USA
*
Author to whom correspondence should be addressed.
Int. J. Plant Biol. 2022, 13(4), 506-522; https://doi.org/10.3390/ijpb13040041
Submission received: 20 September 2022 / Revised: 20 October 2022 / Accepted: 2 November 2022 / Published: 7 November 2022
Browse Figures
Versions Notes

Abstract

:
The SCARECROW (SCR) transcription factor plays a key role in plant growth and development. However, we know very little about the role of SCR regulated pathways in plant development. Here, we used the homozygous scr1 mutant Arabidopsis thaliana (Wassilewskija ecotype), which had a T-DNA insertion in the SCR coding region and lacks a detectable SCR transcript. This scr1 mutant has a determinate mode of root growth, shoot agravitropism and abnormal internal architecture in all organs examined. To screen for mutants that suppress the scr1 abnormal phenotypes, we exposed homozygous scr1 seeds to ethyl methane sulphonate (EMS) mutagen. Upon growth out of these mutagenized seeds, thirteen suppressor mutant-harboring strains were identified. All thirteen suppressor-harboring strains were homozygous for scr1 and lacked the SCR transcript. Ten scr hypocotyl gravitropic suppressor lines showed improved hypocotyl gravitropic response. These ten suppressors fall into six complementation groups suggesting six different gene loci. Similarly, three independent scr root length suppressor lines rescued only the root growth phenotype and fell into three complementation groups, suggesting the involvement of three different gene loci. These suppressors might identify novel functions of the SCR gene in plant development.

1. Introduction

Screening of mutants with desired phenotypes followed by identification of the corresponding genes is an important first step in defining key regulatory components of a biological pathway in living organisms [1,2,3,4]. Suppressor mutations can hide or suppress the phenotypic effects of other mutation(s). Suppressor screening starts with inactivation (or mutagenesis) of a known gene followed by the identification of second-site mutations (suppressor mutations) that occur at sites distinct from the original mutation. The second site mutation suppresses the original mutant phenotype [5,6,7]. An important mutagenesis method commonly used in A. thaliana mutagenesis is ethyl methane sulfonate (EMS), which preferentially induces guanine to adenine transitions. EMS is one of the most powerful and frequently used chemical mutagens, commonly inducing multiple point mutations in each resultant progeny [8]. This high rate of mutagenesis makes it possible to identify plants with the phenotype of interest while screening relatively few plants [9,10]. Thus, screening of known mutants using mutagenesis can help us understand the functions of novel genes that might interact with the parental mutant gene.
The SCR gene is a transcriptional regulator in A. thaliana and is essential for the radial patterning of the root, development of endodermis of the shoot, normal shoot gravitropism and indeterminate root growth [11,12]. It has been reported that scr mutants of A. thaliana exhibited a determinate mode of root growth (short roots), shoot agravitropism (fails to respond to gravity) and abnormal internal architecture in all organs examined [11,13]. Further analysis of the shoot’s internal architecture also revealed that both hypocotyl and inflorescence stems had defective radial patterns [11,14]. Another scr phenotype is the absence of a root ground tissue layer reportedly due to the lack of asymmetric cell division, responsible for the development of cortex and endodermis from the cortex/endodermis initials [15,16]. It is also reported that one ground tissue layer was missing in the stems and no stem cell layer contained sedimented amyloplast. According to the “starch-statolith hypothesis” gravity sensing involves sedimentation of amyloplasts (statoliths) in specific cells (statocytes) [17,18,19,20]. Studies have suggested that the endodermis of the stem acts as statocyte cells and participates in gravity sensing; therefore, the missing layer could be the endodermis [14]. Although there are several recent studies on the functions of SCR in Arabidopsis [21,22], we still do not fully understand its functions in hypocotyl gravity sensing and indeterminate root length growth.
The GRAS proteins, named after the three founding members, GIBBERELLIC ACID INSENSITIVE (GAI), REPRESSOR OF GA1 (RGA), and SCARECROW (SCR), are a well-defined family of plant-specific transcription factors and currently 33 GRAS genes have been described in Arabidopsis [16,23,24]. SCR was the first identified member of the GRAS family [25]. SCR along with SHORTROOT (SHR, also a member of the GRAS family) plays a key role in radial patterning, root meristem maintenance, and endodermal differentiation in Arabidopsis [26,27]. The quiescent center (QC), a group of slowly dividing cells located at the center of the root tip, is necessary for the maintenance of “stem” cell phenotype (maintain their undifferentiated state) of the root tip. Both QC and stem cells, together, form the stem niche and both are required for indeterminate growth of the root [28,29]. In addition, other studies have reported the role of QC in root development [30,31]; however, further research is needed to unravel the regulatory mechanism and molecular aspects behind it.
Furthermore, it has been demonstrated that the SCR protein is essential for the repression of initial differentiation in the QC [15,21]. The QC identity is lost in the scr mutants, thus resulting in the loss of stem cell activity in initials surrounding the QC that leads to the “short root” phenotype.
Although there have been many studies on the SCR gene [27,32,33,34,35], there is little information regarding the genes that are controlled by, or that interact with, SCR. We hypothesized that SCR, a transcription factor, works via interaction with target genes and gene products in SCR-regulated pathways. We reasoned that these target genes might be identified by a suppressor mutation strategy that restores SCR-regulated phenotypes in a parental scr1 mutant line. Therefore, we have used a forward genetic approach of generating and screening the scr1 suppressors (suppressors of the scr1 mutant). Homozygous seeds of scr1 mutants with a transposon-DNA (T-DNA) insertion in SCR coding region were mutagenized with EMS. This T-DNA insertion causes the loss of SCR gene function in scr1 mutants. The length of T-DNA in scr1 is approximately 17 kb, and as EMS usually induces point mutations it is highly unlikely that EMS mutagenesis could restore SCR function. Therefore, EMS-treated scr1 mutant lines that show improved phenotypic traits likely represent second-site mutations. We have identified thirteen suppressors, ten with improved hypocotyl gravitropism (scr hypocotyl gravitropic suppressors; shs) and three with improved root growth (scr root length suppressors; srs). All thirteen suppressors are homozygous for scr1 and do not carry a functional copy of the SCR gene. A detailed phenotypic analysis of these suppressors revealed that both srs and shs only have rescued root growth and hypocotyl gravitropic responses respectively, while retaining abnormal radial patterns.

2. Materials and Methods

2.1. Plant Materials and Growth Conditions

Arabidopsis thaliana, Wassilewskija (WS) and Columbia (Col) ecotypes were used as wildtype. The scr1 mutant used for suppressor screening in this study is the WS ecotype background [25]. For screening and phenotypic characterization of suppressors, seeds were surface sterilized and grown on Murashige and Skoog (MS) agar plates as described by Fukaki et al. [36]. Plants were transferred to pots from MS agar plates and grown under white light at 23 ± 1 °C in long-day light conditions (16 h light). These plants were used for inflorescence stem gravitropic studies, self-fertilization, and homozygous seed production.

2.2. Mutagenesis and Mutant Screening

Homozygous seeds of scr1 were mutagenized with EMS as described by Levin et al. [37], seeds were washed with 0.1% Tween-20 for 15 min, treated with 0.2% EMS (volume/volume in water) for 12 h, rinsed with water eight times, soaked in the last rinse for 15 min, followed by several rinses with 0.1% Tween-20 for a total of 5.5 h. Mutagenized seeds (M0 generation) were plated on MS agarose plates containing 4.5% sucrose, kept in the dark at 4 °C for 3 days to synchronize the seed germination and then transferred to a growth chamber at 20 °C (16 h daylight) for germination. Two weeks after germination vigorous seedlings were transferred to soil, allowed to self-fertilize, and heir seeds were pooled (M1 generation) from 40–100 plants. M1 generation seeds were grown and allowed to self-fertilize, and seeds were collected (M2 generation) as described above. M2 generation seeds were germinated, and the resultant seedlings were used to identify the potential scr suppressor harboring plants with improved phenotypic characters such as hypocotyl gravitropic response and longer root length.
To determine hypocotyl gravitropic responses, M2 generation seeds were surface sterilized and plated in rows on 4.5% sucrose MS agar plates and germinated as above for mutagenized seeds. Plates with germinated seedlings were covered with aluminum foil and left in a vertical position for 1 day. These 24 h plates were photographed (0-h photographs), covered again with foil and reoriented by 90 degrees. Plates were photographed again 48 h after reorientation (48-h photographs). These photographic images (Kodak Image Station440CF) were used to compare the gravitropic responses. Seedlings with improved hypocotyl gravitropic responses were transferred to pots. The original plates without improved hypocotyl gravitropic seedlings were left in the growth chamber for approximately two more weeks to identify the potential suppressors with improved root growth. Seedlings with longer roots were transferred to pots. Seedlings in pots were allowed to self-pollinate and eventually seeds were collected for further screening.

2.3. Confirmation of Suppressors’ Genotypes

WS, scr1 and potential scr1 suppressor seeds were germinated as above. DNA was extracted from seedlings as described previously [38]. The DNA extracted from potential suppressors were amplified by using three primers SCRF344 5′ACCGTGGTGGTCGGAATGTTATGA, SCRR1956 5′AGTCGCTTGTGTAGCTGCATTTCC and T-DNA right border primer RBF 5′ CCAAACGTAAAACGGCTTGTC (Supplementary Figure S1). The polymerase chain reaction (PCR) contained 0.2 mM of each primer, 1.5–3.0 mM MgCl2 (optimized for each pair of primers), 0.5 U Taq polymerase (Promega), 0.2 mM each dNTP (Promega) and ~100 ng of DNA template. Amplification was initiated at 94 °C for 1 min followed by primer annealing temperature of 54 °C for 1 min, followed by extension at 72 °C for 1 min and 30 s for 10 cycles. The entire program was repeated for 24 cycles with shorter denaturation time (30 s) at 94 °C, primer annealing at 54 °C for 30 s, extension at 72 °C for 1 min and 30 s and final elongation at 72 °C for 4 min.
To confirm the continued absence of the SCR transcript, RNA was extracted from the hypocotyl of WS, scr1 and scr hypocotyl gravitropic suppressors according to the RNeasy Plant Mini Kit (Qiagen, Germantown, MD, USA). cDNAs were synthesized with SuperScript® VILO™ cDNA Synthesis Kit (InvitrogenTM). SCR gene-specific primers were used to perform RT-PCR (SCRF836 5′AGGCAGAAGCAAGACGAAG, and SCRR1870 5′CTTCACCGCTTCTCGATGGT). The RT-PCR reaction contained 0.2 mM of each primer, 1.5–3.0 mM MgCl2, 0.5 U Taq polymerase (Promega), 0.2 mM each dNTP (Promega) and 50–100 ng of DNA template. Amplification was initiated at 94 °C for 1 min followed by primer annealing temperature of 54 °C for 1 min, followed by extension at 72 °C for 1 min and 30 s for 10 cycles. The entire program was repeated for 24 cycles with shorter denaturation time (30 s) at 94 °C, primer annealing at 54 °C for 30 s, extension at 72 °C for 1.5 min, and the final elongation at 72 °C for 4 min. PCR generated fragments were analyzed in agarose gels.

2.4. Phenotype Analysis of Potential Suppressors

Forty seeds of each genotype WS, scr1 and each suppressor were grown on the same 4.5% sucrose MS plate, surface-sterilized, germinated and analyzed for hypocotyl gravitropic response as described above. “Imagej 1.48 v” software was used to calculate curvature as the increment over the initial angle for each individual hypocotyl. Curvature values are reported as the mean angle ± standard deviation (SD) and used to categorize the suppressors.
The inflorescence gravitropism of the suppressors was analyzed as described previously [14]. Briefly, pots with WS, scr1 and each suppressor plant (one genotype/pot) that were grown upright until inflorescence stems reached 6–8 cm length were placed in the dark on their sides (90-degree re-orientation). This was marked as the beginning of the experiment and was referred to as time 0 h. Inflorescence gravitropic response was measured 24 h after reorientation.
Root growth rate and final root lengths were determined for both shs and srs suppressor plants and compared to both WS and scr1. Forty seeds of each genotype were germinated as above. Root growth was analyzed for 15 days after germination (DAG). Kodak Image Station 440CF was used to photograph and analyze root length. Calculated root lengths are reported as mean length ± standard deviation (SD).
Hypocotyl lengths of shs plants were determined and compared to WS and scr1. Seeds of each shs suppressor line, WS and scr1 were plated as above. Plates with germinating seedlings were covered with aluminum foil and left in vertical position for 7 days. Hypocotyl length of seedlings grown in dark condition for 7 days was measured using “Imagej 1.48 v” software. Hypocotyl lengths were characterized by calculating the mean value ± standard deviation (SD). Unless otherwise stated, we used ANOVA followed by the Fisher’s test to determine the statistically significant differences between phenotypes of wild type, scr1, suppressors.
For cross sections, hypocotyl, and root fragments of shs1-10 and srs1-3, respectively, were embedded in plastic media as follows. Seedlings grown in dark for 3 days after germination were cut and hypocotyl fragments of shs1-10 and root fragments of srs1-3 were selected for further procedure. Samples were fixed at 4 °C overnight in fixative containing 3% glutaraldehyde in 0.05 M phosphate buffer. Thereafter, samples were washed with phosphate buffer and dehydrated in a graded ethanol series. Samples were treated 15–30 min in each of: 10%, 30%, 50%, 75%, 95% and 95% ethanol. JB-4 embedding kit (Sigma-Aldrich) was used for infiltration and embedding in plastic embedding medium. Finally, the embedded tissues were mounted and 2–3 µm thick cross-sections taken via microtome. The cross sections were heat-fixed to slides, stained with 0.05% Toluidine blue O (TBO) in 1% boric acid for 1 min and rinsed with water. Nikon Biophot microscope with a Nikon D-70 digital camera attached was used for examination of cross sections.
To identify the presence and location of amyloplasts in shs suppressors the whole mount amyloplast staining was performed as described by Fukaki et al., 1998 [14]. WS, scr1 and shs suppressor seedlings were grown vertically in darkness for 1 day after germination on MS plates without sucrose, as described above. Only those seedlings which were growing in an upright direction were fixed in FAA solution for 24 h at 4 °C. After fixation, seedlings were rinsed with 50% [v/v] ethanol and stained with IKI solution (2% (w/v) iodine, 5% (w/v) potassium iodide and 20% (w/v) chloral hydrate) for 1 min and mounted with a drop of clearing solution (a mix of 8 gm chloral hydrate, 2 mL water, and 1 mL glycerol). Slides with mounted seedlings were examined and pictures were taken with the use of a Nikon Biophot microscope with a Nikon D-70 digital camera attachment.

2.5. Genetic Analysis of Suppressors

To determine if shs and srs suppressors are homozygous recessive or dominant and if they represent single gene mutations, backcrosses with scr1 mutant were performed. Pollen of scr1 mutant (male) were used to cross the ovary of each suppressor. A Chi square (χ2) test was performed to accept goodness of fit of observed ratio with expected ratio in the segregated generations.
Complementation tests were performed to determine the number of different loci affected by mutations identified in the screens. Pair-wise crosses of all shs and srs suppressors were performed. Each shs suppressor was crossed with the other nine. Similarly, each srs suppressor was crossed with the other two. Chi square (χ2) test was performed to accept goodness of fit of observed ratio with expected ratio in the segregated generations. Based on the results of these crosses, suppressors complementation groups were determined.

3. Results

3.1. Mutagenesis and Suppressor Screen

The EMS mutagenesis was performed in batches of 2000 scr1 seeds. The mutagenized seeds (M0 generation) were grown to maturity and allowed to self-pollinate and (M1 generation) seeds were collected in pools. Eventually, 51 pools were generated representing ~3000 independent lines, M1 generation seeds were again grown and allowed to self-pollinate. The resultant seeds represent the M2 generation. M2 generation seeds were analyzed to identify the potential suppressors. The seedlings with improved phenotypes such as long roots and improved hypocotyl gravitropic response were selected as potential suppressors and transferred to soil for M3 generation seed collection.
In the primary screen, 438 seedlings (M2 generation) with suppressor phenotypic characters were selected and transferred to the soil for seed production. Seeds were collected from only 235 of these primary screen candidate suppressors. These 235 seedlings (M3 generation), selected as candidate suppressors, represented 30 pools out of 44 pools screened. To confirm that the phenotype was maintained in the next generation, seeds from these candidate suppressor lines were subjected to secondary screening (M4 generation). After the secondary screening, 38 potential suppressors with improved hypocotyl gravitropism and/or improved root length were identified. Seedlings of these 38 lines were transferred to soil and next generation (M5 generation) seeds were collected. These 38 potential suppressor lines were rescreened for two additional generations to confirm the stability of the potential suppressor phenotypes and only the suppressors with the ability to retain their improved phenotypes for two additional generations were selected as the confirmed suppressor lines. Out of the initial 38 lines, only 13 lines retained their suppressor phenotypes for the next two generations, 10 with improved hypocotyl gravitropism (shs) and three with improved root growth (srs). These 13 lines were isolated from 11 different pools, potentially representing 11 different loci.
The SCR genetic background of the thirteen confirmed suppressors was evaluated by PCR using the three primers (Figure 1A,B). As mentioned earlier, the scr1 mutant allele has a T-DNA insertion in the SCR coding region. To confirm that these suppressors are homozygous for the scr1 allele and do not carry a WT copy of the SCR gene, we designed and used appropriate primers. The primers were designed in such a way that SCR forward and reverse primers are positioned on either side of the T-DNA insertion of the scr1 allele, and third primer was RB-forward positioned at T-DNA right border (Supplementary Figure S1). Wild type does not have T-DNA insertion and generates a 1.6 kb PCR product with SCR F344 and SCR R1954 primers. The scr1 mutant and suppressors should have a 17 kb T-DNA insertion in the SCR gene and therefore should amplify 0.7 kb product with T-DNA RBF and SCR R1954 primers. The PCR analysis confirmed that all 13 predicted suppressors were on scr1 background, consistent with second-site mutations (Figure 1A,B).
To confirm that improved phenotypic responses of the suppressor lines are not due to an SCR reversion, using RT-PCR, we could not identify any SCR transcripts present in our predicted suppressors while wild type SCR strains yielded the expected ~0.9 kb fragment. Taken together, the positive genomic PCR for the T-DNA insertions and the RT-PCR results (absent of any SCR transcript) gives us confidence that all 13 suppressors were in the original scr1 mutant background (Supplementary Figure S2).

3.2. Shoot Gravitropic Responses of Suppressors

In the absence of light, the orientation of an SCR wild-type seedling is based solely on the gravity vector. The preliminary hypocotyl gravitropic response analysis suggested that all ten scr hypocotyl gravitropic suppressors (shs1, shs2, shs3, shs4, shs5, shs6, shs7, shs8, shs9 and shs10) exhibited gravitropic responses above the level of scr1 but below the WS. It had been reported earlier that scr mutants are hypocotyl agravitropic [14,39]. However, our results indicate that scr1 mutant seedlings harbor some hypocotyl gravitropic responses. Therefore, the scope and the time courses of gravitropic responses of the 10 shs, scr1 and WS were compared simultaneously (Figure 2). For the quantification of hypocotyl gravitropic responses, 35 seedlings of each genotype (shs1–10, scr1 and WS) were used and compared. The mean angles ± standard deviation of hypocotyl gravitropic responses were calculated in degrees and graphically represented (Figure 2). The WS hypocotyls showed negative gravitropic responses by the reorientation of growth by 39.8 ± 11.7 degrees after 12 h. All 10 shs suppressor lines showed significant but lower than WS gravitropic responses in the range of 20–28 degrees after 12 h (Figure 2). One suppressor, the shs1, exhibited a stronger response than other suppressors and was closest to the WS response at all three time points used in this analysis (Figure 2). Both WS and shs1 hypocotyls exhibited the final angle of deflection in the range of 53–59 degrees after 48 h of reorientation to a new gravity vector (Figure 2). The other nine suppressors showed hypocotyl gravitropic responses significantly above the level of scr1 (16.7 ± 11.1 degrees) with the range of 36–47 degrees after 48 h of reorientation (Figure 2). In addition to the improved gravitropic responses of the shs lines, these results demonstrate that scr1 hypocotyls possess some residual gravitropic responses.
The improved root length suppressors (srs1–srs3) exhibited the same level of hypocotyl gravitropic response as scr1 (Figure 3B). Inflorescence gravitropic responses were assessed by placing pots on their sides in the dark. Inflorescence stems of WS plants could turn 90 degrees upward within two hours after reorientation. It was reported that scr1 mutants exhibited complete inflorescence agravitropism [14,40]. The WS, scr1 and 13 confirmed suppressors were evaluated for the inflorescence gravitropism. Neither scr1 nor any of the confirmed scr1 suppressors (shown only for shs1 and srs1) showed any inflorescence gravitropic responses within 24 h after reorientation (Figure 3C).

3.3. Root Growth of Suppressors

Roots of A. thaliana grow continuously throughout their life (indeterminate growth). The scr1 mutant shows determinate root growth with a short root phenotype at an early stage of life [41,42]. To evaluate if our suppressors were able to rescue the indeterminate root growth phenotype, all the confirmed suppressors (srs and shs) were assessed for root growth. Root lengths were calculated as mean value ± standard deviation (SD). As expected, the WS showed indeterminate (long roots: lengths mean value ± SD) and scr1 exhibited determinate root length (short roots: lengths mean value ± SD). Only three suppressors srs1, srs2 and srs3 exhibited significantly longer roots (lengths mean value ± SD) than scr1 (Figure 4A,B). However, all three srs suppressors still had determinate root growth (lengths mean value ± SD) (Figure 4B). Two of these, srs1 and srs2 grew faster and for longer periods of time than scr1 and achieved their final length at 15 DAG (Figure 4A,B). None of the 10 shs showed any significant improvement in their root lengths (Supplementary Figure S3).

3.4. Genetic Analysis of Suppressors

All suppressors were backcrossed to scr1 and the F1 and F2 progeny were analyzed. All the F1 progeny of backcrosses of shs and srs suppressors with scr1 mutant were agravitropic and had short roots, respectively. The χ2 analysis confirmed that the F2 progeny fit the ratio of 3:1 (Table 1 and Table 2), confirming that each suppressor represents a single recessive allele.
The complementation test is a method used to determine whether two mutations associated with a similar phenotype are in the same gene (alleles) or are alleles of two different genes involved in the same pathway. The complementation test is appropriate for recessive mutations and, as shown earlier, all the suppressors were single-gene recessive alleles. In the complementation test, the suppressors were crossed with each other. If the mutations of both suppressors are in the same gene, then all F1 progeny should have a suppressor phenotype. However, if suppressors have mutations in two different genes, all F1 progeny should have a parent scr1 phenotype, and thus the two genes complement each other. Failure to complement suggests that two mutations lie in the same gene and are allelic.
The pair-wise crosses between 10 hypocotyl gravitropic suppressors and between three root growth suppressors were performed. The F1 generation progeny of shs1Xshs2, shs1Xshs5, shs6Xshs7 and shs6Xshs4 showed hypocotyl gravitropic responses over the level of scr1 (Supplementary Figure S4). Therefore, shs1, shs2 and shs5 represented one complementation group. Similarly, shs4, shs6 and shs7 were in another complementation group. The F1 progeny of all other pair-wise crosses between shs1, shs3, shs4, shs8, shs9 and shs10 showed hypocotyl agravitropism (same response as scr1). The χ2 analysis confirmed that F2 generation progeny segregation fit 9:7 ratios for agravitropic and gravitropic seedlings, respectively (Table 3). This suggests that shs1, shs3, shs4, shs8, shs9 and shs10 were all alleles of different genes. Eventually, all ten scr hypocotyl gravitropic suppressors were grouped into six complementation groups that represented six different loci (genes) involved in the hypocotyl gravitropic pathway.
F1 progeny of pair-wise crosses between srs1, srs2, and srs3 showed short root phenotypes. Their F2 generation progeny segregation fit 9:7 ratios for the short root and long root phenotypes, respectively (Table 4). These data suggest that srs1, srs2, and srs3 are alleles of different genes. In conclusion, three scr root length suppressors were grouped into three complementation groups that represented three different loci (genes) involved in the root growth.

3.5. Phenotypic Characterization of Suppressors

The hypocotyl is the embryonic stem that bears the cotyledons (embryonic leaves) and plumule. From apex to base, the Arabidopsis hypocotyl has approximately twenty cells and after germination, no significant cortical and epidermal divisions occur [43]. However, the hypocotyl may increase more than 10-fold in length with cell elongation being entirely responsible for this postembryonic hypocotyl growth. Numerous factors, such as light, temperature, touch, and plant hormones, have a strong influence on hypocotyl elongation [44,45]. When grown in the dark, the WT hypocotyls are at least 1.5-fold longer than that of the scr1 mutants. However, all the suppressors have similar hypocotyl length to the scr1 mutant (Figure 5A). No significant difference between hypocotyl lengths of scr1 and any of the suppressors were observed on day seven after germination in the dark.
In A. thaliana both the root and shoot exhibit an invariable radial pattern of cell arrangement. In roots, the stele that includes the vascular system is surrounded by the single layers of endodermis, cortex, and epidermis. There has been report of the scr of A. thaliana exhibiting abnormal internal architecture (one missing ground tissue layer) in all organs examined [11]. To determine the radial pattern of all the suppressors, the cross-sections of the hypocotyl of WT, scr1, and all ten shs and cross-sections of the root of WT, scr1 and all three srs were generated and observed under a microscope (Figure 5B,C). The radial patterns of the hypocotyl of all ten shs were similar to scr1 mutant (Figure 5B, shown only for shs1). Similarly, radial patterns of the root of all three srs were similar to the scr1 mutant root shown in Figure 5C, (shown only for srs1). The suppressors have not rescued the radial pattern defects observed in scr1 mutants.
To gain a better understanding of the gravity-sensing mechanism in plant shoots and to confirm the most favored hypothesis of this complex mechanism—the “starch-statolith hypothesis”, which postulates that gravity sensing involves sedimentation of amyloplasts (statoliths) in specific cells (statocytes) [18,46,47,48]—whole-mount amyloplast staining was performed. It has been reported that in scr of A. thaliana no hypocotyl layer contains sedimented amyloplast [14]. The results show that all shs suppressors resemble scr1 for the presence of sedimented amyloplast in hypocotyl layers rather than the WS (Figure 6, shown only for shs1). As shown in Figure 6, when seedlings were grown on MS agar plate without sucrose and were stained with IKI solution the presence of sedimented amyloplast was detected only in the WS endodermal layer while in scr1 and shs suppressors no sedimented amyloplasts could be detected.

4. Discussion

We used EMS mutagenesis on scr 1 mutant A. thaliana to screen for suppressor mutations to identify other genes involved in the SCR-regulated developmental pathways. Thousands of scr1 mutant seeds were mutagenized with EMS and ~3000 independent lines were screened to identify potential scr1 suppressor lines. After two rounds of screening, thirteen suppressor lines were selected as confirmed true scr1 suppressors. Ten suppressors rescued only hypocotyl agravitropic phenotype and were named scr hypocotyl gravitropic suppressors (shs1–10). The other three suppressors exhibited only longer root phenotype and were named as scr root length suppressors (srs1–3). These suppressors might find application in the study of developmental pathways in plants.
All suppressors were shown to lack the functional copy of the SCR gene or any detectable level of SCR transcripts. These results confirm that all suppressors identify second-site mutations and not scr1 revertants. The backcross results indicate that each suppressor represents a recessive allele of a single locus. Furthermore, the complementation tests established that ten of the shs suppressors fall into six complementation groups and three srs suppressors fall into three complementation groups. Thus, the suppressors correspond to six loci involved in the hypocotyl gravitropic pathway, and three loci participated in the root meristem maintenance pathway.
In addition to the identification of shs suppressors, we also determined that scr1 itself is not completely agravitropic and retains some residual hypocotyl gravitropic response (Figure 2). All three srs suppressors showed gravitropic responses similar to scr1 mutants (Figure 3B), thus indicating that these three loci are functionally unrelated to gravitropism.
Several genes that play key roles in gravitropism have been identified with the help of mutational analysis [20,49]. Characterizations of these genes have suggested that root, hypocotyl, and inflorescence stem do not share identical pathways for their gravitropic responses [50,51]. Mutation in the SCR gene is only responsible for the shoot (hypocotyl and inflorescence stem) agravitropism because scr roots have normal (wildtype) root gravitropism in response to the gravity vector [14,52]. All thirteen of the suppressors exhibited complete inflorescence agravitropism similar to the scr1 (Figure 3C). As expected, the roots of all thirteen suppressors have WT positive gravitropic responses. These observations support the theory that root, hypocotyl and inflorescence stem did not have identical pathways or molecular mechanisms for their gravitropic responses [53,54,55,56]. It is also possible that hypocotyl suppressor genes only work in the hypocotyl gravitropic pathway and are not involved in the gravitropic pathway of other organs.
Three scr root length suppressors showed improvement in their root growth. The root length of all three root suppressors is greater than scr mutants but below the level of wildtype plants (Figure 4A). However, all the root growth suppressors still had determinate root growth. All ten hypocotyl gravitropic suppressors did not show any significant improvement in their root growth (Supplementary Figure S3). The only phenotype rescued by the srs is longer root length; therefore, it is highly likely that root suppressor genes engage in root development. The indeterminate type of root growth phenotype requires that the SCR gene be expressed in the quiescent center (QC). Recent studies performed on A. thaliana suggest that SCR maintains the stem cell niche in the root by enhancing the expression of genes that control telomere integrity [57]. It has also been reported that when the SCR gene is only expressed in QC of scr mutant roots, only indeterminate root growth was rescued; however, plants still exhibited an abnormal radial pattern [21,42]. All three srs mutants showed the abnormal radial pattern as in scr1, suggesting that srs genes function in QC and are possibly involved in meristem maintenance.
The orientation of germinating seedlings in the absence of light is mostly dictated by the hypocotyl gravitropism. Therefore, hypocotyl gravitropism is an essential phenotype for plant survival and seedling growth following germination. It is noteworthy that we identified six different genes involved in the hypocotyl gravitropic pathway suggesting that there may be at least one alternative pathway to achieve this essential phenotype to ensure seedling survival.
Since numbers of hypocotyl cells are fixed at an embryonic stage, hypocotyl length depends upon cell elongation. Mutant scr1 plants have much shorter hypocotyls than the WS (Figure 5A), suggesting that scr1 hypocotyl may be defective in cell elongation. When considering that asymmetric cell elongation is essential for the gravitropic response, it could be speculated that the weak gravitropic response of scr1 mutant hypocotyls is due to impaired cell elongation. To address this hypothesis, the lengths of the hypocotyls of all suppressors, grown in the dark were examined. The hypocotyl lengths of all the suppressors were very similar to scr1 but significantly shorter than WS (Figure 5A). These results suggest that hypocotyl length and thus normal cell elongation might not be an essential factor for the gravitropic response. These data also suggest that SCR was essential for normal hypocotyl cell elongation, and that none of the suppressor genes participate in hypocotyl cell elongation.
We have shown that all six shs rescued the gravitropic responses but neither the radial pattern of the hypocotyl architecture nor amyloplast sedimentation in any endodermal layers was restored (Figure 5B and Figure 6). Amyloplast sedimentation is entirely absent in scr1 mutants; however, it was observed that scr1 itself retains some residual gravitropic response. These findings support the view that the presence of normal statocyte cells and/or amyloplast sedimentation are not necessary for gravitropic sensing and hypocotyl gravitropic perception relies on at least two separate mechanisms [17,19,58,59]. It has been postulated that the gravireceptors lie in between the plasma membrane and the cell wall and would be mechanically stimulated for the initial sensing of gravity vector in any mechanism [42,58]. According to the “gravitational pressure model”, the reorientation of the organ can cause a subtle change in cytoplasmic pressure, and is sufficient to generate a perceivable signal [60,61]. The gravireceptors could perceive subtle changes in compression pressure resulting from the reorientation of protoplast in the displaced organs [62]. As is the case of scr1 mutants and hypocotyl gravitropic suppressors, perhaps changes in pressure of cytoplasm are responsible for gravity perception. The stronger hypocotyl gravitropic responses of suppressors, even though they have not rescued the amyloplast sedimentation and WT architecture, could be because the gravireceptors have an enhanced sensitivity to the detection of any subtle changes in the cytoplasmic pressure and gravity vector [63,64]. Furthermore, it can be speculated that since SCR is a transcription factor and is required for the expression of downstream genes in several developmental pathways [65], it could be responsible for turning “on” or “off” other genes involved in shoot gravitropic pathways. It could be that some of the suppressors have a mutation in regulatory regions regulated by the SCR. The mutation may eliminate the need for SCR to turn it “on” or “off.” Another possibility is that the gene products need to interact directly with the SCR protein to be activated, and that the mutation produces a constitutively active product. Until the identities of mutated genes are revealed, we can only speculate on the type of product they encode and their involvement in gravity sensing. Finally, these data indicate that hypocotyls can perceive gravity even in the absence of the endodermal layer and amyloplast sedimentation. This also suggests that scr1 mutants might be primarily defective in gravity sensing mechanisms and no other aspects of gravitropic responses.

5. Conclusions

Thirteen confirmed suppressors have been identified by scr suppressor screening of A. thaliana. Ten hypocotyl gravitropic suppressors that represent six different genes involved in hypocotyl gravitropic pathway and three root length suppressors that represent three different genes involved in root development pathway were identified. None of the suppressors exhibited both a hypocotyl gravitropic response and a long root phenotype. No suppressor with improved inflorescence gravitropism was identified. Each of these suppressors represents a recessive allele of a single locus. Hypocotyl gravitropic suppressors rescued only the hypocotyl gravitropic phenotypes, while they retain abnormal radial patterns and do not exhibit the amyloplast sedimentation. These results indicate that in hypocotyl there is at least one alternative gravity sensing pathway that does not involve the endodermal layer and/or amyloplast sedimentation.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijpb13040041/s1, Figure S1. Schematic of SCR gene in scr1 allele with the position of T-DNA and PCR primers presented, Figure S2. RT-PCR analysis of suppressors, Figure S3. Root growth of hypocotyl gravitropic suppressors (shs), Figure S4. Complementation test analysis.

Author Contributions

J.W.-D. and A.S. conceived and designed the experiments. A.S. performed the experiments. A.S., Z.H.P. and J.W.-D. analyzed the data and wrote the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the NSF Integrative organismal section (IOS) with award ID number 0544403.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

We would like to thank John Ross, Vijaya K. Mekala, and Archana S. Reddy for providing the technical support during this project. We sincerely thank David M. Donovan for reading and correcting the manuscript. This work was supported by the NSF integrative organismal section (IOS) with award ID number 0544403. Authors are thankful for funding from NSF Integrative organismal section (IOS).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Szurman-Zubrzycka, M.E.; Zbieszczyk, J.; Marzec, M.; Jelonek, J.; Chmielewska, B.; Kurowska, M.M.; Krok, M.; Daszkowska-Golec, A.; Guzy-Wrobelska, J.; Gruszka, D.; et al. HorTILLUS—A Rich and Renewable Source of Induced Mutations for Forward/Reverse Genetics and Pre-Breeding Programs in Barley (Hordeum vulgare L.). Front. Plant Sci. 2018, 9, 216. [Google Scholar] [CrossRef] [PubMed]
  2. Ahmar, S.; Gill, R.A.; Jung, K.-H.; Faheem, A.; Qasim, M.U.; Mubeen, M.; Zhou, W. Conventional and Molecular Techniques from Simple Breeding to Speed Breeding in Crop Plants: Recent Advances and Future Outlook. Int. J. Mol. Sci. 2020, 21, 2590. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Konstantinova, N.; Korbei, B.; Luschnig, C. Auxin and Root Gravitropism: Addressing Basic Cellular Processes by Exploiting a Defined Growth Response. Int. J. Mol. Sci. 2021, 22, 2749. [Google Scholar] [CrossRef] [PubMed]
  4. Izzo, L.G.; Aronne, G. Root Tropisms: New Insights Leading the Growth Direction of the Hidden Half. Plants 2021, 10, 220. [Google Scholar] [CrossRef]
  5. Fay, D.; Johnson, W. Genetic Mapping and Manipulation: Chapter 10—Suppressor Mutations. WormBook 2006, 1–4. [Google Scholar] [CrossRef]
  6. von Wettstein, D. From Analysis of Mutants to Genetic Engineering. Annu. Rev. Plant Biol. 2007, 58, 1–20. [Google Scholar] [CrossRef]
  7. Gao, C. Genome Engineering for Crop Improvement and Future Agriculture. Cell 2021, 184, 1621–1635. [Google Scholar] [CrossRef]
  8. Gillmor, C.S.; Lukowitz, W. EMS Mutagenesis of Arabidopsis Seeds. In Plant Embryogenesis: Methods and Protocols; Bayer, M., Ed.; Methods in Molecular Biology; Springer: New York, NY, USA, 2020; pp. 15–23. ISBN 978-1-07-160342-0. [Google Scholar]
  9. Döring, F.; Billakurthi, K.; Gowik, U.; Sultmanis, S.; Khoshravesh, R.; Das Gupta, S.; Sage, T.L.; Westhoff, P. Reporter-Based Forward Genetic Screen to Identify Bundle Sheath Anatomy Mutants in A. Thaliana. Plant J. 2019, 97, 984–995. [Google Scholar] [CrossRef] [Green Version]
  10. Song, J.H.; Kwak, S.-H.; Nam, K.H.; Schiefelbein, J.; Lee, M.M. QUIRKY Regulates Root Epidermal Cell Patterning through Stabilizing SCRAMBLED to Control CAPRICE Movement in Arabidopsis. Nat. Commun. 2019, 10, 1744. [Google Scholar] [CrossRef] [Green Version]
  11. Wysocka-Diller, J.W.; Helariutta, Y.; Fukaki, H.; Malamy, J.E.; Benfey, P.N. Molecular Analysis of SCARECROW Function Reveals a Radial Patterning Mechanism Common to Root and Shoot. Development 2000, 127, 595–603. [Google Scholar] [CrossRef]
  12. Ito, T.; Fukazawa, J. SCARECROW-LIKE3 Regulates the Transcription of Gibberellin-Related Genes by Acting as a Transcriptional Co-Repressor of GAI-ASSOCIATED FACTOR1. Plant Mol. Biol. 2021, 105, 463–482. [Google Scholar] [CrossRef] [PubMed]
  13. Cui, H.; Kong, D.; Liu, X.; Hao, Y. SCARECROW, SCR-LIKE 23 and SHORT-ROOT Control Bundle Sheath Cell Fate and Function in Arabidopsis thaliana. Plant J. 2014, 78, 319–327. [Google Scholar] [CrossRef]
  14. Fukaki, H.; Wysocka-Diller, J.; Kato, T.; Fujisawa, H.; Benfey, P.N.; Tasaka, M. Genetic Evidence That the Endodermis Is Essential for Shoot Gravitropism in Arabidopsis thaliana. Plant J. 1998, 14, 425–430. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Salvi, E.; Di Mambro, R.; Pacifici, E.; Dello Ioio, R.; Costantino, P.; Moubayidin, L.; Sabatini, S. SCARECROW and SHORTROOT Control the Auxin/Cytokinin Balance Necessary for Embryonic Stem Cell Niche Specification. Plant Signal. Behav. 2018, 13, e1507402. [Google Scholar] [CrossRef] [PubMed]
  16. Chen, W.-Q.; Drapek, C.; Li, D.-X.; Xu, Z.-H.; Benfey, P.N.; Bai, S.-N. Histone Deacetylase HDA19 Affects Root Cortical Cell Fate by Interacting with SCARECROW. Plant Physiol. 2019, 180, 276–288. [Google Scholar] [CrossRef] [Green Version]
  17. Kiss, J.; Hertel, R.; Sack, F. Amyloplasts are necessary for full gravitropic sensitivity in roots of Arabidopsis thaliana. Planta 1989, 177, 198–206. [Google Scholar] [CrossRef]
  18. Sack, F.D. Plastids and gravitropic sensing. Planta 1997, 203, S63–S68. [Google Scholar] [CrossRef]
  19. Caspar, T.; Pickard, B.G. Gravitropism in a starchless mutant of Arabidopsis. Planta 1989, 177, 185–197. [Google Scholar] [CrossRef]
  20. Nakamura, M.; Nishimura, T.; Morita, M. Gravity sensing and signal conversion in plant gravitropism. J. Exp. Bot. 2019, 70, 3495–3506. [Google Scholar] [CrossRef]
  21. Shimotohno, A.; Heidstra, R.; Blilou, I.; Scheres, B. Root Stem Cell Niche Organizer Specification by Molecular Convergence of PLETHORA and SCARECROW Transcription Factor Modules. Genes Dev. 2018, 32, 1085–1100. [Google Scholar] [CrossRef]
  22. Kobayashi, A.; Miura, S.; Kozaki, A. INDETERMINATE DOMAIN PROTEIN Binding Sequences in the 5′-Untranslated Region and Promoter of the SCARECROW Gene Play Crucial and Distinct Roles in Regulating SCARECROW Expression in Roots and Leaves. Plant Mol. Biol. 2017, 94, 1–13. [Google Scholar] [CrossRef] [PubMed]
  23. To, V.-T.; Shi, Q.; Zhang, Y.; Shi, J.; Shen, C.; Zhang, D.; Cai, W. Genome-Wide Analysis of the GRAS Gene Family in Barley (Hordeum vulgare L.). Genes 2020, 11, 553. [Google Scholar] [CrossRef] [PubMed]
  24. Xu, X.; Feng, G.; Huang, L.; Yang, Z.; Liu, Q.; Shuai, Y.; Zhang, X. Genome-Wide Identification, Structural Analysis and Expression Profiles of GRAS Gene Family in Orchardgrass. Mol. Biol. Rep. 2020, 47, 1845–1857. [Google Scholar] [CrossRef] [PubMed]
  25. Laurenzio, L.D.; Wysocka-Diller, J.; Malamy, J.E.; Pysh, L.; Helariutta, Y.; Freshour, G.; Hahn, M.G.; Feldmann, K.A.; Benfey, P.N. The SCARECROW Gene Regulates an Asymmetric Cell Division That Is Essential for Generating the Radial Organization of the Arabidopsis Root. Cell 1996, 86, 423–433. [Google Scholar] [CrossRef] [Green Version]
  26. Kim, G.; Dhar, S.; Lim, J. The SHORT-ROOT Regulatory Network in the Endodermis Development of Arabidopsis Roots and Shoots. J. Plant Biol. 2017, 60, 306–313. [Google Scholar] [CrossRef]
  27. Crook, A.D.; Willoughby, A.C.; Hazak, O.; Okuda, S.; VanDerMolen, K.R.; Soyars, C.L.; Cattaneo, P.; Clark, N.M.; Sozzani, R.; Hothorn, M.; et al. BAM1/2 Receptor Kinase Signaling Drives CLE Peptide-Mediated Formative Cell Divisions in Arabidopsis Roots. Proc. Natl. Acad. Sci. USA 2020, 117, 32750–32756. [Google Scholar] [CrossRef]
  28. Reyes-Hernández, B.J.; Shishkova, S.; Amir, R.; Quintana-Armas, A.X.; Napsucialy-Mendivil, S.; Cervantes-Gamez, R.G.; Torres-Martínez, H.H.; Montiel, J.; Wood, C.D.; Dubrovsky, J.G. Root Stem Cell Niche Maintenance and Apical Meristem Activity Critically Depend on THREONINE SYNTHASE1. J. Exp. Bot. 2019, 70, 3835–3849. [Google Scholar] [CrossRef]
  29. García-Gómez, M.L.; Garay-Arroyo, A.; García-Ponce, B.; Sánchez, M.D.L.P.; Álvarez-Buylla, E.R. Hormonal Regulation of Stem Cell Proliferation at the Arabidopsis thaliana Root Stem Cell Niche. Front. Plant Sci. 2021, 12, 84. [Google Scholar] [CrossRef]
  30. Timilsina, R.; Kim, J.H.; Nam, H.G.; Woo, H.R. Temporal Changes in Cell Division Rate and Genotoxic Stress Tolerance in Quiescent Center Cells of Arabidopsis Primary Root Apical Meristem. Sci. Rep. 2019, 9, 3599. [Google Scholar] [CrossRef] [Green Version]
  31. Matosevich, R.; Efroni, I. The Quiescent Center and Root Regeneration. J. Exp. Bot. 2021, 72, 6739–6745. [Google Scholar] [CrossRef]
  32. Uraguchi, S.; Sone, Y.; Yoshikawa, A.; Tanabe, M.; Sato, H.; Otsuka, Y.; Nakamura, R.; Takanezawa, Y.; Kiyono, M. SCARECROW Promoter-Driven Expression of a Bacterial Mercury Transporter MerC in Root Endodermal Cells Enhances Mercury Accumulation in Arabidopsis Shoots. Planta 2019, 250, 667–674. [Google Scholar] [CrossRef] [PubMed]
  33. Rakusová, H.; Han, H.; Valošek, P.; Friml, J. Genetic Screen for Factors Mediating PIN Polarization in Gravistimulated Arabidopsis thaliana Hypocotyls. Plant J. 2019, 98, 1048–1059. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Hughes, T.E.; Langdale, J.A. SCARECROW Is Deployed in Distinct Developmental Contexts during Rice and Maize Leaf Development. Development 2022, 149, dev200410. [Google Scholar] [CrossRef]
  35. Aoyanagi, T.; Ikeya, S.; Kobayashi, A.; Kozaki, A. Gene Regulation via the Combination of Transcription Factors in the INDETERMINATE DOMAIN and GRAS Families. Genes 2020, 11, 613. [Google Scholar] [CrossRef] [PubMed]
  36. Fukaki, H.; Fujisawa, H.; Tasaka, M. SGR1, SGR2, and SGR3: Novel Genetic Loci Involved in Shoot Gravitropism in Arabidopsis thaliana. Plant Physiol. 1996, 110, 945–955. [Google Scholar] [CrossRef] [Green Version]
  37. Levin, J.Z.; Fletcher, J.C.; Chen, X.; Meyerowitz, E.M. A Genetic Screen for Modifiers of UFO Meristem Activity Identifies Three Novel FUSED FLORAL ORGANS Genes Required for Early Flower Development in Arabidopsis. Genetics 1998, 149, 579–595. [Google Scholar] [CrossRef]
  38. Edwards, K.; Johnstone, C.; Thompson, C. A Simple and Rapid Method for the Preparation of Plant Genomic DNA for PCR Analysis. Nucleic Acids Res. 1991, 19, 1349. [Google Scholar] [CrossRef]
  39. Kitazawa, D.; Hatakeda, Y.; Kamada, M.; Fujii, N.; Miyazawa, Y.; Hoshino, A.; Iida, S.; Fukaki, H.; Morita, M.T.; Tasaka, M.; et al. Shoot Circumnutation and Winding Movements Require Gravisensing Cells. Proc. Natl. Acad. Sci. USA 2005, 102, 18742–18747. [Google Scholar] [CrossRef] [Green Version]
  40. Morita, M.T.; Tasaka, M.; Taniguchi, M. Identification and Analysis of Novel Genes Involved in Gravitropism of Arabidopsis thaliana. In Proceedings of the 39th COSPAR Scientific Assembly, Mysore, India, 14–22 July 2012; Volume 39, p. 1279. [Google Scholar]
  41. Dhondt, S.; Coppens, F.; De Winter, F.; Swarup, K.; Merks, R.M.H.; Inzé, D.; Bennett, M.J.; Beemster, G.T.S. SHORT-ROOT and SCARECROW Regulate Leaf Growth in Arabidopsis by Stimulating S-Phase Progression of the Cell Cycle. Plant Physiol. 2010, 154, 1183–1195. [Google Scholar] [CrossRef] [Green Version]
  42. Sabatini, S.; Heidstra, R.; Wildwater, M.; Scheres, B. SCARECROW Is Involved in Positioning the Stem Cell Niche in the Arabidopsis Root Meristem. Genes Dev. 2003, 17, 354–358. [Google Scholar] [CrossRef]
  43. Gendreau, P.L.; Petitto, J.M.; Schnauss, R.; Frantz, K.J.; Van Hartesveldt, C.; Gariépy, J.-L.; Lewis, M.H. Effects of the Putative Dopamine D3 Receptor Antagonist PNU 99194A on Motor Behavior and Emotional Reactivity in C57BL/6J Mice. Eur. J. Pharmacol. 1997, 337, 147–155. [Google Scholar] [CrossRef]
  44. Boron, A.K.; Vissenberg, K. The Arabidopsis thaliana Hypocotyl, a Model to Identify and Study Control Mechanisms of Cellular Expansion. Plant Cell Rep. 2014, 33, 697–706. [Google Scholar] [CrossRef] [PubMed]
  45. Collett, C.E.; Harberd, N.P.; Leyser, O. Hormonal Interactions in the Control of Arabidopsis Hypocotyl Elongation1. Plant Physiol. 2000, 124, 553–562. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  46. Zhang, Y.; He, P.; Ma, X.; Yang, Z.; Pang, C.; Yu, J.; Wang, G.; Friml, J.; Xiao, G. Auxin-mediated statolith production for root gravitropism. New Phytol. 2019, 224, 761–774. [Google Scholar] [CrossRef] [PubMed]
  47. Vandenbrink, J.P.; Kiss, J.Z. Plant responses to gravity. Semin. Cell Dev. Biol. 2019, 92, 122–125. [Google Scholar] [CrossRef] [PubMed]
  48. Roychoudhry, S.; del Bianco, M.; Kepinski, S. Deciphering the Emergence of Angle Dependence in Gravity Sensing Columella Cells. In Proceedings of the 44th COSPAR Scientific Assembly, Online, 16–24 July 2022; Volume 44, p. 2607. [Google Scholar]
  49. Jiao, Z.; Du, H.; Chen, S.; Huang, W.; Ge, L. LAZY Gene Family in Plant Gravitropism. Front. Plant Sci. 2021, 11, 2096. [Google Scholar] [CrossRef]
  50. Hashiguchi, Y.; Tasaka, M.; Morita, M.T. Mechanism of Higher Plant Gravity Sensing. Am. J. Bot. 2013, 100, 91–100. [Google Scholar] [CrossRef] [Green Version]
  51. Hill, J.L.; Hollender, C.A. Branching out: New Insights into the Genetic Regulation of Shoot Architecture in Trees. Curr. Opin. Plant Biol. 2019, 47, 73–80. [Google Scholar] [CrossRef]
  52. Kato, T.; Morita, M.; Tasaka, M. Role of Endodermal Cell Vacuoles in Shoot Gravitropism. J. Plant Growth Regul. 2002, 21, 113–119. [Google Scholar] [CrossRef]
  53. Watahiki, M.K.; Yamamoto, K.T. The massugu1 mutation of Arabidopsis identified with failure of auxin-induced growth curvature of hypocotyl confers auxin insensitivity to hypocotyl and leaf. Plant Physiol. 1997, 115, 419–426. [Google Scholar] [CrossRef]
  54. Yamauchi, Y.; Fukaki, H.; Fujisawa, H.; Tasaka, M. Mutations in the SGR4, SGR5 and SGR6 Loci of Arabidopsis thaliana Alter the Shoot Gravitropism. Plant Cell Physiol. 1997, 38, 530–535. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  55. Reboulet, J.C.; Kumar, P.; Kiss, J.Z. DIS1 and DIS2 play a role in tropisms in Arabidopsis thaliana. Environ. Exp. Bot. 2010, 67, 474–478. [Google Scholar] [CrossRef] [Green Version]
  56. Kumar, P.; Millar, K.D.L.; Kiss, J.Z. Inflorescence stems of the mdr1 mutant display altered gravitropism and phototropism. Environ. Exp. Bot. 2011, 70, 244–250. [Google Scholar] [CrossRef]
  57. Wang, B.; Shi, X.; Gao, J.; Liao, R.; Fu, J.; Bai, J.; Cui, H. SCARECROW Maintains the Stem Cell Niche in Arabidopsis Root by Ensuring Telomere Integrity. bioRxiv 2021. [Google Scholar] [CrossRef]
  58. Edelmann, H.G. Graviperception in Maize Plants: Is Amyloplast Sedimentation a Red Herring? Protoplasma 2018, 255, 1877–1881. [Google Scholar] [CrossRef] [Green Version]
  59. Huang, L.; Wang, W.; Zhang, N.; Cai, Y.; Liang, Y.; Meng, X.; Yuan, Y.; Li, J.; Wu, D.; Wang, Y. LAZY2 controls rice tiller angle through regulating starch biosynthesis in gravity-sensing cells. New Phytol. 2021, 231, 1073–1087. [Google Scholar] [CrossRef]
  60. Blancaflor, E.B.; Masson, P.H. Plant Gravitropism. Unraveling the Ups and Downs of a Complex Process. Plant Physiol. 2003, 133, 1677–1690. [Google Scholar] [CrossRef] [Green Version]
  61. Su, S.-H.; Keith, M.A.; Masson, P.H. Gravity Signaling in Flowering Plant Roots. Plants 2020, 9, 1290. [Google Scholar] [CrossRef]
  62. Telewski, F.W. A Unified Hypothesis of Mechanoperception in Plants. Am. J. Bot. 2006, 93, 1466–1476. [Google Scholar] [CrossRef]
  63. Morita, M.T.; Tasaka, M. Gravity Sensing and Signaling. Curr. Opin. Plant Biol. 2004, 7, 712–718. [Google Scholar] [CrossRef]
  64. Ditengou, F.A.; Teale, W.D.; Palme, K. Settling for Less: Do Statoliths Modulate Gravity Perception? Plants 2020, 9, 121. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  65. Pardal, R.; Heidstra, R. Root Stem Cell Niche Networks: It’s Complexed! Insights from Arabidopsis. J. Exp. Bot. 2021, 72, 6727–6738. [Google Scholar] [CrossRef] [PubMed]
Ijpb 13 00041 g001 550
Figure 1. PCR amplification products in wild type, scr1 and suppressor lines to confirm the presence or absence of T-DNA insertion in the SCR gene in (A). Lane 1. 100 bp ladder; Lane 2. Wild Type WS (1.6 kb amplification products generated with SCR-F344 and SCR-R1954 primers); Lane 3–12. The scr hypocotyl gravitropic suppressors (shs), 1 to 10 (0.7 kb amplification products generated with T-DNA RBF and SCR-R1954 primers); Lane 13. scr1 (0.7 kb amplification products generated with T-DNA RBF and SCR-R1954 primers); Lane 14. 100 bp ladder. SCR-F344 and SCR-R1954 primers cannot amplify the scr1 allele because of the presence of large T-DNA insertion in the genomic region. Green arrows point to 1.3 kb and 0.7 kb marker bands. (B). Lane 1. 1 kb ladder; Lane 2. Wild Type WS (1.6 kb amplification products generated with SCR-F344 and SCR-R1954 primers); Lane 3–5. scr root length suppressors (srs), 1 to 3 (0.7 kb amplification products generated with T-DNA RBF and SCR-R1954 primers); Lane 6: scr1 (0.7 kb amplification products generated with T-DNA RBF and SCR-R1954 primers). Green arrows point to 1.3 kb and 0.7 kb marker bands.
Figure 1. PCR amplification products in wild type, scr1 and suppressor lines to confirm the presence or absence of T-DNA insertion in the SCR gene in (A). Lane 1. 100 bp ladder; Lane 2. Wild Type WS (1.6 kb amplification products generated with SCR-F344 and SCR-R1954 primers); Lane 3–12. The scr hypocotyl gravitropic suppressors (shs), 1 to 10 (0.7 kb amplification products generated with T-DNA RBF and SCR-R1954 primers); Lane 13. scr1 (0.7 kb amplification products generated with T-DNA RBF and SCR-R1954 primers); Lane 14. 100 bp ladder. SCR-F344 and SCR-R1954 primers cannot amplify the scr1 allele because of the presence of large T-DNA insertion in the genomic region. Green arrows point to 1.3 kb and 0.7 kb marker bands. (B). Lane 1. 1 kb ladder; Lane 2. Wild Type WS (1.6 kb amplification products generated with SCR-F344 and SCR-R1954 primers); Lane 3–5. scr root length suppressors (srs), 1 to 3 (0.7 kb amplification products generated with T-DNA RBF and SCR-R1954 primers); Lane 6: scr1 (0.7 kb amplification products generated with T-DNA RBF and SCR-R1954 primers). Green arrows point to 1.3 kb and 0.7 kb marker bands.
Ijpb 13 00041 g001
Ijpb 13 00041 g002 550
Figure 2. Hypocotyl gravitropic responses of A. thaliana wild type (WS), scr1 and 10 confirmed scr hypocotyl gravitropic suppressors (shs1–10). Gravitropic responses to new gravity vectors of all the samples were measured in degrees at three time points. The X-axis represents the time interval in hours and the Y-axis represents the angle of deflection of hypocotyls. All 10 scr hypocotyl gravitropic suppressors (shs1–10) have gravitropic responses above the level of scr1 but below WS. Error bars represent the means ± standard deviation (SD). The lack of shared letters on the bars indicates a significant difference. To determine the significant differences between wild type and mutant seedlings, we used ANOVA followed by Fisher’s test.
Figure 2. Hypocotyl gravitropic responses of A. thaliana wild type (WS), scr1 and 10 confirmed scr hypocotyl gravitropic suppressors (shs1–10). Gravitropic responses to new gravity vectors of all the samples were measured in degrees at three time points. The X-axis represents the time interval in hours and the Y-axis represents the angle of deflection of hypocotyls. All 10 scr hypocotyl gravitropic suppressors (shs1–10) have gravitropic responses above the level of scr1 but below WS. Error bars represent the means ± standard deviation (SD). The lack of shared letters on the bars indicates a significant difference. To determine the significant differences between wild type and mutant seedlings, we used ANOVA followed by Fisher’s test.
Ijpb 13 00041 g002
Ijpb 13 00041 g003 550
Figure 3. Hypocotyl and Inflorescence gravitropism in A. thaliana. (A) Hypocotyl gravitropic responses in the dark of the scr1, WS and shs1. The seedlings of scr1, WS and shs1 (scr hypocotyl gravitropic suppressor1) are shown at reorientation (0 h) and 48 h (48 h) after reorientation. Arrows indicate the direction of the gravity vector. (B) Hypocotyl gravitropic responses in the dark of srs1–3. The seedlings of srs1–3 are shown at reorientation (0 h) and 48 h (48 h) after reorientation. Arrows indicate the direction of the gravity vector. (C) Inflorescence gravitropic response in the dark of the WS, scr1, shs1 and srs1 (scr root length suppressor1). Inflorescences of the WS, scr1, shs1 and srs1 are shown at reorientation (0 h) and 24 h (24 h) after reorientation in the dark. Arrows indicate the direction of the gravity vector.
Figure 3. Hypocotyl and Inflorescence gravitropism in A. thaliana. (A) Hypocotyl gravitropic responses in the dark of the scr1, WS and shs1. The seedlings of scr1, WS and shs1 (scr hypocotyl gravitropic suppressor1) are shown at reorientation (0 h) and 48 h (48 h) after reorientation. Arrows indicate the direction of the gravity vector. (B) Hypocotyl gravitropic responses in the dark of srs1–3. The seedlings of srs1–3 are shown at reorientation (0 h) and 48 h (48 h) after reorientation. Arrows indicate the direction of the gravity vector. (C) Inflorescence gravitropic response in the dark of the WS, scr1, shs1 and srs1 (scr root length suppressor1). Inflorescences of the WS, scr1, shs1 and srs1 are shown at reorientation (0 h) and 24 h (24 h) after reorientation in the dark. Arrows indicate the direction of the gravity vector.
Ijpb 13 00041 g003
Ijpb 13 00041 g004 550
Figure 4. Root growth analysis of A. thaliana. (A) Root growth of WS, srs1–3 and scr1 were measured at different time points (points at the X-axis). Three suppressors srs1, srs2 and srs3 exhibit significantly longer roots than scr1 but shorter than WS. Error bars represent means ± standard deviation (SD). (B) Root length of srs1, srs3, scr1, srs2, and WS at 20 days after germination (DAG).
Figure 4. Root growth analysis of A. thaliana. (A) Root growth of WS, srs1–3 and scr1 were measured at different time points (points at the X-axis). Three suppressors srs1, srs2 and srs3 exhibit significantly longer roots than scr1 but shorter than WS. Error bars represent means ± standard deviation (SD). (B) Root length of srs1, srs3, scr1, srs2, and WS at 20 days after germination (DAG).
Ijpb 13 00041 g004
Ijpb 13 00041 g005 550
Figure 5. Phenotypic characterization of A. thaliana suppressors (A) Hypocotyl lengths. Seedlings of hypocotyl gravitropic suppressors shs1 to shs10, along with wildtype (WS) and scr1 were grown in dark for seven days after germination. Length of hypocotyls was measured in mm. The X-axis represents the type of seedling (genotype), and Y-axis represents the length in mm. Error bars represent the means ± standard deviation (SD). The lack of shared letters on the bars indicates a significant difference. To determine the significant differences between wild type and mutant treatments, we used ANOVA followed by Fisher’s test. (B) Cross-section of WS, scr1, and shs1 hypocotyls. Seedlings were grown in dark for three days after germination. WS has endodermis followed by two ground tissue layers (two cortex), and epidermis. The endodermal layer is missing in both scr1 and shs1. Scale bar, 50 µm. (C) Cross-section of WS, scr1, and srs1 roots. WS has endodermis followed by one ground tissue layer (cortex), and epidermis. The abnormal radial pattern displayed by scr1 and srs1 roots is shown. en, endodermis; co, cortex; ep, epidermis. Scale bar, 50 µm.
Figure 5. Phenotypic characterization of A. thaliana suppressors (A) Hypocotyl lengths. Seedlings of hypocotyl gravitropic suppressors shs1 to shs10, along with wildtype (WS) and scr1 were grown in dark for seven days after germination. Length of hypocotyls was measured in mm. The X-axis represents the type of seedling (genotype), and Y-axis represents the length in mm. Error bars represent the means ± standard deviation (SD). The lack of shared letters on the bars indicates a significant difference. To determine the significant differences between wild type and mutant treatments, we used ANOVA followed by Fisher’s test. (B) Cross-section of WS, scr1, and shs1 hypocotyls. Seedlings were grown in dark for three days after germination. WS has endodermis followed by two ground tissue layers (two cortex), and epidermis. The endodermal layer is missing in both scr1 and shs1. Scale bar, 50 µm. (C) Cross-section of WS, scr1, and srs1 roots. WS has endodermis followed by one ground tissue layer (cortex), and epidermis. The abnormal radial pattern displayed by scr1 and srs1 roots is shown. en, endodermis; co, cortex; ep, epidermis. Scale bar, 50 µm.
Ijpb 13 00041 g005
Ijpb 13 00041 g006 550
Figure 6. Analysis of Amyloplast sedimentation in hypocotyl of A. thalian suppressors. Whole- mount staining of starch in amyloplasts of hypocotyl of WS, scr1 and shs1 was performed. The red arrow indicates the sedimented amyloplasts in response to gravity. en, endodermis; co, cortex; ep, epidermis. Scale bar, 50 µm.
Figure 6. Analysis of Amyloplast sedimentation in hypocotyl of A. thalian suppressors. Whole- mount staining of starch in amyloplasts of hypocotyl of WS, scr1 and shs1 was performed. The red arrow indicates the sedimented amyloplasts in response to gravity. en, endodermis; co, cortex; ep, epidermis. Scale bar, 50 µm.
Ijpb 13 00041 g006
Table
Table 1. Backcross of A. thaliana scr hypocotyl gravitropic suppressors with scr1. F2 generation progenies of scr1 X shs suppressors were analyzed to test the hypocotyl agravitropic/gravitropic ratio. χ2 < 3.84 is nonsignificant at 0.05 probability level.
Table 1. Backcross of A. thaliana scr hypocotyl gravitropic suppressors with scr1. F2 generation progenies of scr1 X shs suppressors were analyzed to test the hypocotyl agravitropic/gravitropic ratio. χ2 < 3.84 is nonsignificant at 0.05 probability level.
F2 Generation of CrossSample SizeHypocotyl GravitropicHypocotyl AgravitropicSegregation Ratio
(Agravi./Gravi.)		χ2 < χ2 0.95 = 3.841p > 0.05
scr1 male X shs1 female167126413.05:0.95χ2 = 0.017p > 0.05
scr1 male X shs2 female15092582.5:1.5χ2 = 2.4p > 0.05
scr1 male X shs3 female144113313.13:0.86χ2 = 0.925p > 0.05
scr1 male X shs4 female156120363.07:0.92χ2 = 0.307p > 0.05
scr1 male X shs5 female138108303.13:0.87χ2 = 0.782p > 0.05
scr1 male X shs6 female323249743.08:0.92χ2 = 0.752p > 0.05
scr1 male X shs7 female281218633.1:0.9χ2 = 0.997p > 0.05
scr1 male X shs8 female173123502.84:1.16χ2 = 1.404p > 0.05
scr1 male X shs9 female192149433.1:0.9χ2 = 0.694p > 0.05
scr1 male X shs10 female313237763.03:0.97χ2 = 0.0862p > 0.05
Table
Table 2. Backcross of A. thaliana scr root length suppressors with scr1. F2 generation progeny of scr1 X srs suppressors were analyzed to test short root/long root ratio. χ2 < 3.84 is nonsignificant at 0.05 probability level.
Table 2. Backcross of A. thaliana scr root length suppressors with scr1. F2 generation progeny of scr1 X srs suppressors were analyzed to test short root/long root ratio. χ2 < 3.84 is nonsignificant at 0.05 probability level.
F2 Generation of CrossSample SizeShort Root
(~1.5 cm)		Long Root
(~2.7–5 cm)		Segregation Ratioχ2 < χ2 0.95 = 3.841p > 0.05
scr1 male X srs1 female9675213.125:0.875χ2 = 0.5p > 0.05
scr1 male X srs2 female156124323.179:0.820χ2 = 1.66p > 0.05
scr1 male X srs3 female132104283.151:0.848χ2 = 1.009p > 0.05
Table
Table 3. Complementation test analysis of A. thaliana hypocotyl gravitropic suppressors. F2 generation progenies of crossed suppressors were analyzed to test the hypocotyl agravitropic/gravitropic ratio. χ2 < 3.84 is nonsignificant at 0.05 probability level.
Table 3. Complementation test analysis of A. thaliana hypocotyl gravitropic suppressors. F2 generation progenies of crossed suppressors were analyzed to test the hypocotyl agravitropic/gravitropic ratio. χ2 < 3.84 is nonsignificant at 0.05 probability level.
F2 Generation of CrossSample SizeHypocotyl GravitropicHypocotyl AgravitropicSegregation Ratio
(Agravi./Gravi.)		χ2 < χ2 0.95 = 3.841p > 0.05
shs1 male X shs3 female86572910.6:5.4χ2 = 3.5p > 0.05
shs1 male X shs4 female13383509.98:6.02χ2 = 2.04p > 0.05
shs1 male X shs8 female181100818.8:7.2χ2 = 0.073p > 0.05
shs1 male X shs9 female11066449.2:6.8χ2 = 0.624p > 0.05
shs1 male X shs10 female2501421089.01:6.99χ2 = 0.022p > 0.05
shs3 male X shs4 female208121869.3:6.7χ2 = 0.312p > 0.05
shs3 male X shs8 female3482031459.33:6.67χ2 = 0.613p > 0.05
shs3 male X shs9 female4102391719.32:6.68χ2 = 0.699p > 0.05
shs3 male X shs10 female12976539.43:6.57χ2 = 0.108p > 0.05
shs4 female X shs8 male5102872239:7χ2 = 0.001p > 0.05
shs4 female X shs9 male3011781239.46:6.54χ2 = 1.018p > 0.05
shs4 female X shs10 male165100659.7:6.3χ2 = 1.272p > 0.05
shs8 male X shs9 female2581689010.4:5.6χ2 = 2.4p > 0.05
shs8 male X shs10 female3401991419.36:6.67χ2 = 0.717p > 0.05
shs9 male X shs10 female2441341108.78:7.22χ2 = 0.175p > 0.05
Table
Table 4. Complementation test analysis of A. thaliana root length suppressors. F2 generation progeny of crossed suppressors was analyzed to test the short root/long root ratio. χ2 < 3.84 is nonsignificant at 0.05 probability level.
Table 4. Complementation test analysis of A. thaliana root length suppressors. F2 generation progeny of crossed suppressors was analyzed to test the short root/long root ratio. χ2 < 3.84 is nonsignificant at 0.05 probability level.
F2 Generation of CrossSample SizeShort Root
(0.5–2 cm)		Long Root
(2.5–6.0 cm)		Segregation Ratioχ2 < χ2 0.95 = 3.841p > 0.05
srs1 female X srs2 male5002852159.12:6.88χ2 = 0.114p > 0.05
srs1 male X srs3 female4102461649.6:6.4χ2 = 2.34p > 0.05
srs2 female X srs3 male3462051419.48:6.52χ2 = 1.264p > 0.05
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Sharma, A.; Pervaiz, Z.H.; Wysocka-Diller, J. SCR Suppressor Mutants: Role in Hypocotyl Gravitropism and Root Growth in Arabidopsis thaliana. Int. J. Plant Biol. 2022, 13, 506-522. https://doi.org/10.3390/ijpb13040041

AMA Style

Sharma A, Pervaiz ZH, Wysocka-Diller J. SCR Suppressor Mutants: Role in Hypocotyl Gravitropism and Root Growth in Arabidopsis thaliana. International Journal of Plant Biology. 2022; 13(4):506-522. https://doi.org/10.3390/ijpb13040041

Chicago/Turabian Style

Sharma, Archana, Zahida Hassan Pervaiz, and Joanna Wysocka-Diller. 2022. "SCR Suppressor Mutants: Role in Hypocotyl Gravitropism and Root Growth in Arabidopsis thaliana" International Journal of Plant Biology 13, no. 4: 506-522. https://doi.org/10.3390/ijpb13040041

APA Style

Sharma, A., Pervaiz, Z. H., & Wysocka-Diller, J. (2022). SCR Suppressor Mutants: Role in Hypocotyl Gravitropism and Root Growth in Arabidopsis thaliana. International Journal of Plant Biology, 13(4), 506-522. https://doi.org/10.3390/ijpb13040041

Article Metrics

Back to TopTop