Lipidomic and Antioxidant Response to Grape Seed, Corn and Coconut Oils in Healthy Wistar Rats
Abstract
:1. Introduction
2. Materials and Methods
2.1. Edible Oils and Chemicals
2.2. Fatty Acid and Phytosterol Profile of Edible Oils
2.3. Total Phenolic Compounds and Antioxidant Capacity
2.4. Bioassay Protocol
2.5. Biological Samples
2.6. Serum and Hepatic Lipids
2.7. Gene Expression Analysis
2.8. Statistical Analysis
3. Results
3.1. Lipid and Antioxidant Profile of Edible Oils
3.2. Bioassay Parameters
3.3. Serum and Hepatic Lipidomic and Antioxidant Response
3.4. Expression of HDL-Metabolism Related Genes
4. Discussion
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
Appendix A
Variable | GSO | CO | CNO | p |
---|---|---|---|---|
Hepatic FA (mg/g) | ||||
C8:0 | 0.25 ± 0.04 | 0.18 ± 0.10 | 0.16 ± 0.05 | 0.11 |
C10:0 | 0.08 ± 0.04 | 0.06 ± 0.03 | 0.09 ± 0.01 | 0.36 |
C15:0 | 0.22 ± 0.03 | 0.20 ± 0.02 | 0.20 ± 0.03 | 0.49 |
C18:0 | 14.96 ± 2.37 | 13.25 ± 1.48 | 14.14 ± 0.58 | 0.29 |
C20:0 | 0.07 ± 0.02 | 0.11 ± 0.02 | 0.07 ± 0.07 | 0.16 |
C15:1 | 0.13 ± 0.03 | 0.11 ± 0.02 | 0.13 ± 0.03 | 0.57 |
C17:1 | 0.45 ± 0.16 | 0.50 ± 0.09 | 0.44 ± 0.05 | 0.68 |
C20:1 | 0.24 ± 0.02 | 0.27 ± 0.03 | 0.24 ± 0.12 | 0.75 |
C18:2n3 | 0.43 ± 0.12 | 0.49 ± 0.15 | 0.34 ± 0.12 | 0.19 |
C22:5n3 | 0.39 ± 0.10 | 0.41 ± 0.10 | 0.50 ± 0.17 | 0.32 |
Serum TAC | ||||
FRAP (mM TE) | 0.47 ± 0.01 | 0.48 ± 0.02 | 0.46 ± 0.01 | 0.08 |
References
- Zyriax, B.-C.; Windler, E. Dietary fat in the prevention of cardiovascular disease—A review. Eur. J. Lipid Sci. Technol. 2000, 102, 355–365. [Google Scholar] [CrossRef]
- Laslett, L.J.; Alagona, P.; Clark, B.A.; Drozda, J.P.; Saldivar, F.; Wilson, S.R.; Poe, C.; Har, M. The worldwide environmental of cardiovascular disease: Prevalence, diagnosis, therapy, and policy issues: A report from the American College of Cardiology. J. Am. Coll. Cardiol. 2012, 60 (Suppl. 25), S1–S49. [Google Scholar] [CrossRef] [PubMed]
- Astrup, A.; Dyerberg, J.; Elwood, P.; Hermansen, K.; Hu, F.B.; Jakobsen, M.U.; Kok, F.J.; Krauss, R.M.; Lecerf, J.M.; LeGrand, P.; et al. The role of reducing intakes of saturated fat in the prevention of cardiovascular disease: Where does the evidence stand in 2010? Am. J. Clin. Nutr. 2011, 93, 684–688. [Google Scholar] [CrossRef] [PubMed]
- Torres, N.; Guevara-Cruz, M.; Granados, J.; Vargas-Alarcón, G.; González-Palacios, B.; Ramos-Barragan, V.E.; Quiroz-Olguín, G.; Flores-Islas, I.M.; Tovar, A.R. Reduction of serum lipids by soy protein and soluble fiber is not associated with the ABCG5/G8, apolipoprotein E, and apolipoprotein A1 polymorphisms in a group of hyperlipidemic Mexican subjects. Nutr. Res. 2009, 29, 728–735. [Google Scholar] [CrossRef] [PubMed]
- Pearson, T.A.; Palaniappan, L.P.; Artinian, N.T.; Carnethon, M.R.; Criqui, M.H.; Daniels, S.R.; Goldstein, L.B.; Hong, Y.; Mensah, G.A.; Sallis, J.F.; et al. American Heart Association guide for improving cardiovascular health at the community level, 2013 update a scientific statement for public health practitioners, healthcare providers, and health policy makers. Circulation 2013, 127, 1730–1753. [Google Scholar] [CrossRef] [PubMed]
- Yamagishi, K.; Iso, H.; Yatsuya, H.; Tanabe, N.; Date, C.; Kikuchi, S.; Yamamoto, A.; Inaba, Y.; Tamakoshi, A. JACC Study Group Dietary intake of saturated fatty acids and mortality from cardiovascular disease in Japanese: The Japan collaborative cohort study for evaluation of cancer risk (JACC) study. Am. J. Clin. Nutr. 2012, 92, 759–765. [Google Scholar] [CrossRef] [PubMed]
- Manson, P.; Porter, S.C.; Berry, S.E.; Stillman, P.; Steele, C.; Kirby, A.; Griffin, B.A.; Minihane, A.M. Saturated fatty acid consumption: Outlining the scale of the problem and assessing the solutions. Nutr. Bull. 2009, 34, 74–84. [Google Scholar] [CrossRef]
- Sheela, D.L.; Nazeem, P.A.; Narayanankutty, A.; Manalil, J.J.; Raghavamenon, A.C. In silico and wet lab studies reveal the cholesterol lowering efficacy of lauric acid, a medium chain fat of coconut oil. Plant Foods Hum. Nutr. 2016. [Google Scholar] [CrossRef]
- Grundy, S.M.; Denke, M.A. Dietary influences on serum lipids and lipoproteins. J. Lipid Res. 1990, 31, 1149–1172. [Google Scholar] [PubMed]
- Estruch, R.; Ros, E.; Salas-Salvado, J.; Covas, M.I.; Corella, D.; Aros, F.; Gómez-Gracia, E.; Ruiz-Gutiérrez, V.; Fiol, M.; Lapetra, J.; et al. Primary prevention of cardiovascular disease with a Mediterranean diet. N. Engl. J. Med. 2013, 368, 1279–1290. [Google Scholar] [CrossRef] [PubMed]
- Oh, K.; Hu, F.B.; Manson, J.E.; Stampfer, M.J.; Willet, W.C. Expand+Dietary fat intake and risk of coronary heart disease in women: 20 Years of follow-up of the nurses’ health study. Am. J. Epidemiol. 2005, 161, 672–679. [Google Scholar] [CrossRef] [PubMed]
- Larsson, S.C.; Orsini, N.; Wolk, A. Long-chain omega-3 polyunsaturated fatty acids and risk of stroke: A meta-analysis. Eur. J. Epidemiol. 2012, 27, 895–901. [Google Scholar] [CrossRef] [PubMed]
- Kotwal, S.; Jun, M.; Sullivan, D.; Perkovic, V.; Neal, B. Omega 3 fatty acids and cardiovascular outcomes: Systematic review and meta-analysis. Circ. Cardiovasc. Qual. Outcomes 2012, 5, 808–818. [Google Scholar] [CrossRef] [PubMed]
- Pan, A.; Chen, M.; Chowdhury, R.; Wu, J.H.; Sun, Q.; Campos, H.; Mozaffarian, D.; Hu, F.B. α-linolenic acid and risk of cardiovascular disease: A systematic review and meta-analysis. Am. J. Clin. Nutr. 2012, 96, 1262–1273. [Google Scholar] [CrossRef] [PubMed]
- Garavaglia, J.; Markoski, M.M.; Oliveira, A.; Marcadenti, A. Grape seed oil compounds: Biological and chemical actions for health. Nutr. Metab. Insights 2016, 9, 59–64. [Google Scholar] [PubMed]
- Hassanien, M.F.R. Tocol and phytosterol composition of edible oils in the Egyptian market. J. Food Process. Preserv. 2012, 36, 531–538. [Google Scholar] [CrossRef]
- Domínguez-Ávila, J.A.; Álvarez-Parrilla, E.; López-Díaz, J.A.; Maldonado-Mendoza, I.E.; Gómez-García, M.C.; de la Rosa, L.A. The pecan nut (Carya illinoinensis) and its oil and polyphenolic fractions differentially modulate lipid metabolism and the antioxidant enzyme activities in rats fed high-fat diets. Food Chem. 2015, 168, 529–537. [Google Scholar] [CrossRef] [PubMed]
- Rocha, V.A.; Ras, R.T.; Gagliardi, A.C.; Mangili, L.C.; Trautwein, E.A.; Santos, R.D. Effects of phytosterols on markers of inflammation: A systematic review and meta-analysis. Atheroesclerosis 2016, 248, 76–83. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Chun, O.K.; Song, W.O. Plasma and dietary antioxidant status as cardiovascular disease risk factors: A review of human studies. Nutrients 2013, 5, 2969–3004. [Google Scholar] [CrossRef] [PubMed]
- Deng, Q.; Yu, X.; Xu, J.; Kou, X.; Zheng, M.; Huang, F.; Huang, Q.; Wang, L. Single frequency intake of α-linolenic acid rich phytosterol esters attenuates atherosclerosis risk factors in hamsters fed a high fat diet. Lipids Health. Dis. 2016, 15, 23. [Google Scholar] [CrossRef] [PubMed]
- De Catalfo, G.E.H.; de Alaniz, M.J.; Marra, C.A. Dietary lipid-induced changes in enzymes of hepatic lipid metabolism. Nutrition 2013, 28, 462–469. [Google Scholar] [CrossRef] [PubMed]
- Park, P.W.; Goins, R.E. In situ preparation of fatty acid methyl esters for analysis of fatty acid composition of foods. J. Food Sci. 1994, 59, 1262–1266. [Google Scholar] [CrossRef]
- Villa-Rodríguez, J.A.; Molina-Corral, F.J.; Ayala-Zavala, J.F.; Olivas, G.I.; González-Aguilar, G.A. Effect of maturity stage on the content of fatty acids and antioxidant activity of ‘Hass’ avocado. Food Res. Int. 2011, 44, 1231–1237. [Google Scholar] [CrossRef]
- Fletouris, D.J.; Botsoglou, N.A.; Psomas, I.E.; Mantis, A.I. Rapid determination of cholesterol in milk and milk products by direct saponification and capillary gas chromatography. J. Dairy Sci. 1998, 81, 2833–2840. [Google Scholar] [CrossRef]
- Berker, K.I.; Ozdemir, O.F.A.; Ozyurt, D.; Demirata, B.; Apak, R. Modified Folic-Ciocalteu antioxidant capacity assay for measuring lipophilic antioxidants. J. Agric. Food Chem. 2013, 61, 4783–4791. [Google Scholar] [CrossRef] [PubMed]
- Brand-Williams, W.; Cuvelier, M.E.; Berset, C.L.W.T. Use of a free radical method to evaluate antioxidant activity. LWT Food Sci. Technol. 1995, 28, 25–30. [Google Scholar] [CrossRef]
- Re, R.; Pellegrini, N.; Proteggente, A.; Pannala, A.; Yang, M.; Rice-Evans, C. Antioxidant activity applying an improved ABTS radical cation decolorization assay. Free Rad. Biol. Med. 1999, 26, 1231–1237. [Google Scholar] [CrossRef]
- Álvarez-Parrilla, E.; de la Rosa, L.A.; Legarreta, P.; Sáenz, L.; Rodrigo-García, J.; González-Aguilar, G.A. Daily consumption of apple, pear and orange juice differently affects plasma lipids and antioxidant capacity of smoking and non-smoking adults. Int. J. Food Sci. Nutr. 2010, 61, 369–380. [Google Scholar] [CrossRef] [PubMed]
- National Research Council (NRC). Nutrient requirements of the laboratory rat. In Nutrient Requirements of Laboratory Animals, 4th ed.National Academy Press: Washington, DC, USA, 1995; pp. 11–16. Available online: https://www.nap.edu/catalog/4758/nutrient-requirements-of-laboratory-animals-fourth-revised-edition-1995 (accessed on 5 November 2016). [Google Scholar]
- NOM-062-ZOO-1999. Especificaciones Técnicas para la Producción, Cuidado y uso de Los Animales de Laboratorio. Available online: http://www.fmvz.unam.mx/fmvz/principal/archivos/062ZOO.PDF (accessed on 5 November 2016).
- Folch, J.; Lees, M.; Sloane Stanley, G.H. A simple method for the isolation and purification of total lipids from animal tissues. J. Biol. Chem. 1957, 226, 497–509. [Google Scholar] [PubMed]
- Reis, A.; Rudnitskaya, A.; Blackburn, G.J.; Fauzi, N.M.; Pitt, A.R.; Spickett, C.M. A comparison of five lipid extraction solvent systems for lipidomic studies of human LDL. J. Lipid Res. 2013, 54, 1812–1824. [Google Scholar] [CrossRef] [PubMed]
- Agouridis, A.P.; Banach, M.; Mikhailidis, D.P. Dysfunctional high-density lipoprotein: Not only quantity but first of all quality. Arch. Med. Sci. 2015, 11, 230–231. [Google Scholar] [CrossRef] [PubMed]
- Santos-Gallego, C.G.; Badimon, J.J.; Rosenson, S.S. Beginning to understand high-density lipoproteins. Endocrinol. Metab. Clin. N. Am. 2014, 43, 913–947. [Google Scholar] [CrossRef] [PubMed]
- Sabir, A.; Unver, A.; Kara, Z. The fatty acid and tocopherol constituents of the seed oil extracted from 21 grape varieties (Vitis spp.). J. Sci. Food Agric. 2012, 92, 1982–1987. [Google Scholar] [CrossRef] [PubMed]
- Madawala, S.R.P.; Kochhar, S.P.; Dutta, P.C. Lipid components and oxidative status of selected specialty oils. Grasas y Aceites 2012, 63, 143–151. [Google Scholar] [CrossRef]
- De Marchi, F.; Seraglia, R.; Molin, L.; Traldi, P.; De Rosso, M.; Panighel, A.; Dalla Vedova, A.; Gardiman, M.; Giust, M.; Flamini, R. Seed oil triglyceride profiling of thirty-two hybrid grape varieties. J. Mass Spectrom. 2012, 47, 1113–1119. [Google Scholar] [CrossRef] [PubMed]
- Fernandes, L.; Casal, S.; Cruz, R.; Pereira, J.A.; Ramalhosa, E. Seed oils of ten traditional Portuguese grape varieties with interesting chemical and antioxidant properties. Food Res. Int. 2013, 50, 161–166. [Google Scholar] [CrossRef]
- Alsaif, M.A.; Duwaihy, M.M.S. Influence of dietary fat quantity and composition on glucose tolerance and insulin sensitivity in rats. Nutr. Res. 2004, 24, 417–425. [Google Scholar] [CrossRef]
- Gunstone, F. Vegetable Oils in Food Technology: Composition, Properties and Uses, 2nd ed.; John Wiley & Sons: Oxford, UK, 2011; pp. 169–174, 273–286. Available online: http://197.14.51.10:81/pmb/AGROALIMENTAIRE/Vegetable%20Oils%20in%20Food%20Technology%20Composition%20Properties%20and%20Uses.pdf (accessed on 5 November 2016).
- Wagner, K.H.; Wotruba, F.; Elmadfa, I. Antioxidative potential of tocotrienols and tocopherols in coconut fat at different oxidation temperatures. Eur. J. Lipid Sci. Technol. 2001, 103, 746–751. [Google Scholar] [CrossRef]
- Gylling, E.; Simonen, P. Phytosterols, phytostanols, and lipoprotein metabolism. Nutrients 2015, 7, 7965–7977. [Google Scholar] [CrossRef] [PubMed]
- Tekin, L.; Aday, M.S.; Yilmaz, E. Physicochemical changes in hazelnut, olive pomace, grapeseed and sunflower oils heated at frying temperatures. Food Sci. Technol. Res. 2009, 15, 519–524. [Google Scholar] [CrossRef]
- Fakhoury-Sayegh, N.; Trak-Smayra, V.; Khazzaka, A.; Esseily, F.; Obeid, O.; Lahoud-Zouein, M.; Younes, H. Characteristics of nonalcoholic fatty liver disease induced in wistar rats following four different diets. Nutr. Res. Pract. 2015, 9, 350–357. [Google Scholar] [CrossRef] [PubMed]
- Legrand, P.; Rioux, V. Specific roles of saturated fatty acids: Beyond epidemiological data. Eur. J. Lipid Sci. Technol. 2015, 127, 1489–1499. [Google Scholar] [CrossRef]
- Bautista, R.; Carreón-Torres, E.; Luna-Luna, M.; Komera-Arenas, Y.; Franco, M.; Fragoso, J.M.; López-Olmos, V.; Cruz-Robles, D.; Vargas-Barrón, J.; Vargas-Alarcón, G.; et al. Early endothelial nitrosylation and increased abdominal adiposity in Wistar rats after long-term consumption of food fried in canola oil. Nutrition 2014, 30, 1055–1060. [Google Scholar] [CrossRef] [PubMed]
- Mensink, R.P.; Zock, P.L.; Kester, A.D.; Katan, M.B. Effects of dietary fatty acids and carbohydrates on the ratio of serum total to HDL cholesterol and on serum lipids and apolipoproteins: A meta-analysis of 60 controlled trials. Am. J. Clin. Nutr. 2003, 77, 1146–1155. [Google Scholar] [PubMed]
- The, S.S.; Voon, P.T.; Ng, Y.T.; Ong, S.H.; Ong, A.S.H.; Choo, Y.M. Effects of fatty acids at different positions in the triglycerides on cholesterol levels. J. Oil Palm. Res. 2016, 28, 211–221. [Google Scholar]
- Dauqan, E.; Sani, H.; Abdullah, A.; Kasim, Z. Effect of different vegetable oils (red palm olein, palm olein, corn oil and coconut oil) on lipid profile in rat. Food Nutr. Sci. 2011, 2, 253–258. [Google Scholar] [CrossRef]
- Eyres, L.; Eyres, M.F.; Chisholm, A.; Brown, R.C. Coconut oil consumption and cardiovascular risk factors in humans. Nutr. Rev. 2016, 74, 267–280. [Google Scholar] [CrossRef] [PubMed]
- Chang, N.-W.; Wu, C.-T.; Chen, F.-N.; Huang, P.-C. Effect of dietary ratios of fatty acids on cholesterol metabolism in rats and on low density lipoprotein uptake in hepatocytes. Nutr. Res. 2005, 25, 781–790. [Google Scholar] [CrossRef]
- Asadi, F.; Shahriari, A.; Chahardah-Cheric, M. Effect of long-term optional ingestion of canola oil, grape seed oil, corn oil and yogurt butter on plasma, muscle and liver cholesterol status in rats. Food Chem. Toxicol. 2010, 48, 2454–2457. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.-J.; Jeon, G.; Sung, J.; Oh, S.-K.; Hong, H.-C.; Lee, J. Effect of grape seed oil supplementation on serum lipid profiles in rats. Food Sci. Biotechnol. 2010, 19, 249–252. [Google Scholar] [CrossRef]
- De la Torre-Carbot, K.; Chávez-Servín, J.L.; Reyes, P.; Ferriz, R.A.; Gutiérrez, E.; Escobar, K.; Aguilera, A.; Anaya, M.A.; García, T.; García, O.P.; et al. Changes in lipid profile of Wistar rats after sustained consumption of different types of commercial vegetable oil: A preliminary study. Universal J. Food Nutr. Sci. 2015, 3, 10–18. [Google Scholar] [CrossRef]
- Al-Attar, A.M. Effect of grapeseed oil on diazinon-induced physiological and histopathological alterations in rats. Saudi J. Biol. Sci. 2015, 22, 284–292. [Google Scholar] [CrossRef] [PubMed]
- Shinagawa, F.B.; Santana, F.C.D.; Mancini-Filho, J. Effect of cold pressed grape seed oil on rats’ biochemical markers and inflammatory profile. Rev. Nutr. 2015, 28, 65–76. [Google Scholar] [CrossRef]
- Rohatgi, A.; Khera, A.; Berry, J.D.; Givens, E.G.; Ayers, C.R.; Wedin, K.E.; Neeland, I.J.; Yuhanna, I.S.; Rader, D.R.; de Lemos, J.A.; et al. HDL cholesterol efflux capacity and incident cardiovascular events. N. Engl. J. Med. 2014, 371, 2383–2393. [Google Scholar] [CrossRef] [PubMed]
- Khera, A.V.; Cuchel, M.; de la Llera-Moya, M.; Rodrigues, A.; Burke, M.F.; Jafri, K.; French, B.C.; Phillips, J.A.; Mucksavage, M.L.; Wilensky, R.L.; et al. Cholesterol efflux capacity, high-density lipoprotein function, and atherosclerosis. N. Engl. J. Med. 2011, 364, 127–135. [Google Scholar] [CrossRef] [PubMed]
- Ma, D.; Liu, W.; Wang, Y. ApoA-I or ABCA1 expression suppresses fatty acid synthesis by reducing 27-hydroxycholesterol levels. Biochimie 2014, 103, 101–108. [Google Scholar] [CrossRef] [PubMed]
- Santos-Gallego, C.G.; Giannarelli, C.; Badimón, J.J. Experimental models for the investigation of high density lipoprotein-mediated cholesterol efflux. Curr. Atheroescler. Rep. 2011, 13, 266–276. [Google Scholar] [CrossRef] [PubMed]
Ingredient | GSO | CO | CNO | Ingredient | GSO | CO | CNO |
---|---|---|---|---|---|---|---|
GSO 1 | 10.0 | DL-methionine 2,4 | 0.2 | 0.2 | 0.2 | ||
CO 1 | 10.0 | Cellulose 2 | 5.0 | 5.0 | 5.0 | ||
CNO 1 | 10.0 | AIN-93G-Mineral mix 2 | 3.5 | 3.5 | 3.5 | ||
SFA | 1.1 | 1.4 | 9.2 | AIN-93-Vitamin mix 2 | 1.0 | 1.0 | 1.0 |
MUFA | 3.2 | 3.2 | 0.7 | Choline chloride 5 | 0.02 | 0.02 | 0.02 |
PUFA | 5.7 | 5.4 | 0.1 | Sucrose + maltodextrins 1 | 17.6 | 17.7 | 17.7 |
Casein 2,3 | 21.0 | 21.0 | 21.0 | Corn starch 1 | 38.7 | 38.8 | 38.8 |
Gene | NCBI-RS | Protein | Primer Pair (5′-3′) | Tm °C |
---|---|---|---|---|
Rn45s | NR_046239.1 | Fw: GTTCCGCTCACACCTCAGAT Rv: CAAGTGCGTTCGAAGTGTCG | 58 | |
Lcat | NM_017024.2 | LCAT | Fw: ACACAGGCCAAGACTTCGAG Rv: GGTTGGGGACTTAGGAGTGC | 56 |
ApoA1 | NM_012738.1 | ApoA-1 | Fw: CCTGGACAACTGGGACACTC Rv: GCCCAGAACTCCTGAGTCAC | 57 |
Lipc | NM_012597.2 | HL | Fw: GCACTATGCTATTGCCGTGC Rv: TTGATGCCCACACTCAGACC | 60 |
Srb1 | NM_031541.1 | SR-B1 | Fw: CCCCATGAACTGTTCCGTGA Rv: GATCTTCCCTGTTTGCCCGA | 57 |
Fatty Acid | GSO | CO | CNO |
---|---|---|---|
SFA | 10.24 ± 0.32 a | 14.38 ± 0.65 c | 92.13 ± 2.02 b |
C6:0 | ≤0.001 a | ≤0.001 a | 0.56 ± 0.04 b |
C8:0 | ≤0.001 a | ≤0.001 a | 6.23 ± 0.10 b |
C10:0 | ≤0.001 a | ≤0.001 a | 5.82 ± 0.02 b |
C12:0 | ≤0.001 a | ≤0.001 a | 42.67 ± 1.42 b |
C14:0 | 0.07 ± 0.03 a | 0.04 ± 0.02 a | 21.12 ± 0.97 b |
C16:0 | 6.63 ± 0.11 a | 12.47 ± 0.50 c | 11.69 ± 0.09 b |
C17:0 * | 0.03 ± 0.02 ab | 0.05 ± 0.02 a | ≤0.001 b |
C18:0 | 3.49 ± 0.22 a | 1.79 ± 0.12 c | 4.03 ± 0.06 b |
MUFA | 32.09 ± 0.99 a | 31.60 ± 0.52 a | 6.63 ± 0.10 b |
C14:1 | 0.03 ± 0.02 a | 0.02 ± 0.01 a | 0.13 ± 0.06 b |
C16:1 ** | 0.09 ± 0.02 a | 0.10 ± 0.05 a | ≤0.001 b |
C18:1 | 32.00 ± 1.00 a | 31.50 ± 0.53 a | 6.63 ± 0.10 b |
PUFA | 57.21 ± 1.06 a | 53.65 ± 0.32 c | 0.76 ± 0.06 b |
C18:2 | 57.20 ± 1.06 a | 53.33 ± 0.32 c | 0.75 ± 0.05 b |
C18:3 | ≤0.001 a | 0.32 ± 0.02 c | ≤0.001 a |
Variable | GSO | CO | CNO |
---|---|---|---|
Phytosterols (mg/g) | |||
Campesterol | ≤0.001 a | 0.14 ± 0.00 b | ≤0.001 a |
Ergosterol | ≤0.001 a | 0.97 ± 0.01 b | ≤0.001 a |
Stigmasterol | 1.20 ± 0.02 a | 0.52 ± 0.01 b | ≤0.001 c |
β-Sitosterol | 1.52 ± 0.01 a | 8.37 ± 0.04 b | ≤0.001 c |
Total | 1.72 ± 0.01 a | 10.0 ± 0.02 b | ≤0.001 c |
Antioxidant capacity | |||
TP (mgGAE/100 g) | 2.36 ± 0.12 a | 2.96 ± 0.12 b | 2.58 ± 0.14 c |
ABTS (mM TE) | 0.38 ± 0.01 a | 4.58 ± 0.48 b | 0.02 ± 0.01 c |
DPPH (mM TE) | 0.55 ± 0.01 a | 24.68 ± 0.94 b | 1.95 ± 0.39 c |
Variable | GSO | CO | CNO |
---|---|---|---|
Initial body weight | 303.8 ± 26.8 | 298.2 ± 30.0 | 309.7 ± 24.7 |
Final body weight | 365.8 ± 20.1 | 358.5 ± 29.1 | 356.3 ± 27.8 |
Weight gain | 62.0 ± 21.0 | 60.0 ± 7.2 | 46.0 ± 11.0 |
Total food intake | 287.2 ± 52.5 | 254.4 ± 34.3 | 229.8 ± 37.4 |
Total fat intake | 28.7 ± 5.3 | 25.4 ± 3.4 | 23.0 ± 3.7 |
SFA intake *** | 3.2 ± 0.6 a | 3.6 ± 0.5 a | 21.1 ± 3.4 b |
MUFA intake *** | 9.2 ± 1.7 a | 8.1 ± 1.1 a | 1.6 ± 0.3 b |
PUFA intake *** | 16.4 ± 3.0 a | 13.7 ± 1.9 a | 0.2 ± 0.0 b |
FER | 0.22 ± 0.08 | 0.24 ± 0.03 | 0.20 ± 0.05 |
Liver weight | 11.7 ± 1.0 | 11.4 ± 0.8 | 10.2 ± 2.1 |
HSI (%) | 3.9 ± 0.4 | 3.8 ± 0.2 | 3.3 ± 0.7 |
Liver water (%) | 66.7 ± 1.8 | 67.9 ± 1.2 | 67.4 ± 0.3 |
Liver fat (%) ** | 4.9 ± 1.0 a | 5.0 ± 0.7 a | 6.9 ± 1.0 b |
Fatty Acid | GSO | CO | CNO |
---|---|---|---|
SFA | 31.28 ± 3.67 a | 33.25 ± 2.08 b | 42.29 ± 1.87 c |
C12:0 | 0.11 ± 0.03 a | 0.08 ± 0.04 a | 1.20 ± 0.42 b |
C14:0 | 0.38 ± 0.05 a | 0.46 ± 0.10 a | 2.81 ± 0.33 b |
C16:0 | 16.36 ± 0.80 a | 18.35 ± 0.57 a | 23.19 ± 1.08 b |
C17:0 | 0.34 ± 0.06 a | 0.38 ± 0.04 b | 0.21 ± 0.05 c |
C22:0 | 0.17 ± 0.05 a,c | 0.16 ± 0.03 a | 0.26 ± 0.02 b |
MUFA | 13.91 ± 2.73 a | 15.55 ± 1.93 a | 23.31 ± 2.65 b |
C16:1 | 0.88 ± 0.41 a | 0.88 ± 0.18 a | 4.03 ± 1.30 b |
C18:1cis | 11.82 ± 2.29 a | 13.63 ± 1.81 a | 18.12 ± 1.48 b |
PUFA | 53.16 ± 1.37 a | 51.27 ± 0.75 a | 34.41 ± 2.52 b |
C18:2cis | 25.08 ± 1.11 a | 23.35 ± 2.16 a | 10.38 ± 1.37 b |
C18:3n6 ** | 0.30 ± 0.11 a | 0.34 ± 0.11 a | 0.16 ± 0.03 a |
C20:2 ** | 0.85 ± 0.12 a | 0.78 ± 0.05 ab | 0.57 ± 0.23 b |
C20:3n6 | 0.56 ± 0.09 a | 0.83 ± 0.25 a | 1.39 ± 0.16 b |
C20:4n6 | 22.13 ± 2.09 a | 21.29 ± 1.91 a | 15.20 ± 1.33 b |
C22:4n6 | 0.61 ± 0.14 a | 0.69 ± 0.09 a | 0.27 ± 0.06 b |
C22:6n3 | 2.77 ± 0.39 a | 2.94 ± 0.47 a | 5.54 ± 0.28 b |
Phytosterol | GSO | CO | CNO |
---|---|---|---|
Campesterol | 0.03 ± 0.02 a | 0.34 ± 0.05 b | 0.13 ± 0.04 c |
Ergosterol | 0.32 ± 0.18 a | 0.75 ± 0.28 b | 0.07 ± 0.02 a |
Stigmasterol ** | 0.09 ± 0.05 ab | 0.13 ± 0.03 a | 0.05 ± 0.03 b |
β-Sitosterol | 0.52 ± 0.23 a | 1.95 ± 0.56 b | 0.26 ± 0.09 a |
Total | 0.96 ± 0.45 a | 3.16 ± 0.62 b | 0.50 ± 0.18 a |
© 2017 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wall-Medrano, A.; De la Rosa, L.A.; Vázquez-Flores, A.A.; Mercado-Mercado, G.; González-Arellanes, R.; López-Díaz, J.A.; González-Córdova, A.F.; González-Aguilar, G.A.; Vallejo-Cordoba, B.; Molina-Corral, F.J. Lipidomic and Antioxidant Response to Grape Seed, Corn and Coconut Oils in Healthy Wistar Rats. Nutrients 2017, 9, 82. https://doi.org/10.3390/nu9010082
Wall-Medrano A, De la Rosa LA, Vázquez-Flores AA, Mercado-Mercado G, González-Arellanes R, López-Díaz JA, González-Córdova AF, González-Aguilar GA, Vallejo-Cordoba B, Molina-Corral FJ. Lipidomic and Antioxidant Response to Grape Seed, Corn and Coconut Oils in Healthy Wistar Rats. Nutrients. 2017; 9(1):82. https://doi.org/10.3390/nu9010082
Chicago/Turabian StyleWall-Medrano, Abraham, Laura A. De la Rosa, Alma A. Vázquez-Flores, Gilberto Mercado-Mercado, Rogelio González-Arellanes, José A. López-Díaz, Aarón F. González-Córdova, Gustavo A. González-Aguilar, Belinda Vallejo-Cordoba, and Francisco J. Molina-Corral. 2017. "Lipidomic and Antioxidant Response to Grape Seed, Corn and Coconut Oils in Healthy Wistar Rats" Nutrients 9, no. 1: 82. https://doi.org/10.3390/nu9010082
APA StyleWall-Medrano, A., De la Rosa, L. A., Vázquez-Flores, A. A., Mercado-Mercado, G., González-Arellanes, R., López-Díaz, J. A., González-Córdova, A. F., González-Aguilar, G. A., Vallejo-Cordoba, B., & Molina-Corral, F. J. (2017). Lipidomic and Antioxidant Response to Grape Seed, Corn and Coconut Oils in Healthy Wistar Rats. Nutrients, 9(1), 82. https://doi.org/10.3390/nu9010082