Erratum: Roche, J. et al. Global Decrease of Histone H3K27 Acetylation in ZEB1-Induced Epithelial to Mesenchymal Transition in Lung Cancer Cells. Cancers, 2013, 5, 334–356

Roche, Joëlle; Nasarre, Patrick; Gemmill, Robert; Baldys, Aleksander; Pontis, Julien; Korch, Christopher; Guilhot, Joëlle; Ait-Si-Ali, Slimane; Drabkin, Harry

doi:10.3390/cancers8120114

Open AccessErratum

Erratum: Roche, J. et al. Global Decrease of Histone H3K27 Acetylation in ZEB1-Induced Epithelial to Mesenchymal Transition in Lung Cancer Cells. Cancers, 2013, 5, 334–356

by

Joëlle Roche

^1,2,*,

Patrick Nasarre

¹,

Robert Gemmill

¹,

Aleksander Baldys

³,

Julien Pontis

⁴,

Christopher Korch

⁵,

Joëlle Guilhot

⁶,

Slimane Ait-Si-Ali

⁴

and

Harry Drabkin

¹

Department of Medicine, Hematology Oncology Division, MUSC, 96 Jonathan Lucas St., Charleston, SC 29425, USA

²

CNRS FRE 3511, University of Poitiers, 1 rue Georges Bonnet, F-86022 Poitiers Cédex, France

³

Department of Medicine, Nephrology Division, MUSC, Ralph H. Johnson Veterans Affairs Medical Center, Charleston, SC 29425, USA

⁴

Epigénétique & Destin Cellulaire, CNRS UMR 7216, University of Paris Diderot, Sorbonne Paris Cité, F-75013 Paris, France

⁵

CU DNA Sequencing and Analysis Core, University of Colorado, School of Medicine, Anschutz Medical Campus, 12801 E. 17th Ave., Aurora, CO 80045, USA

⁶

INSERM, CIC 0802, CHU de Poitiers, F-86021 France

^*

Author to whom correspondence should be addressed.

Cancers 2016, 8(12), 114; https://doi.org/10.3390/cancers8120114

Submission received: 7 December 2016 / Revised: 8 December 2016 / Accepted: 9 December 2016 / Published: 15 December 2016

Download Versions Notes

The authors wish to make the following correction to their paper [1]. The sequences of actin primers used in qRT-PCR presented in Table 1 are wrong. The corrected sequences are:

Actin forward primer: 5′ ACCGCGAGAAGATGACCCAG 3′
Actin reverse primer: 5′ AGGTCCAGACGCAGGATGG 3′

The authors would like to apologize for any inconvenience caused. The change does not affect the scientific results. The manuscript will be updated and the original will remain online on the article webpage.

Conflicts of Interest

The authors declare no conflict of interest.

Reference

Roche, J.; Nasarre, P.; Gemmill, R.; Baldys, A.; Pontis, J.; Korch, C.; Guilhot, J.; Ait-Si-Ali, S.; Drabkin, H. Global decrease of histone H3K27 acetylation in ZEB1-induced epithelial to mesenchymal transition in lung cancer cells. Cancers 2013, 5, 334–356. [Google Scholar] [CrossRef] [PubMed]

© 2016 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC-BY) license (http://creativecommons.org/licenses/by/4.0/).

Share and Cite

MDPI and ACS Style

Roche, J.; Nasarre, P.; Gemmill, R.; Baldys, A.; Pontis, J.; Korch, C.; Guilhot, J.; Ait-Si-Ali, S.; Drabkin, H. Erratum: Roche, J. et al. Global Decrease of Histone H3K27 Acetylation in ZEB1-Induced Epithelial to Mesenchymal Transition in Lung Cancer Cells. Cancers, 2013, 5, 334–356. Cancers 2016, 8, 114. https://doi.org/10.3390/cancers8120114

AMA Style

Roche J, Nasarre P, Gemmill R, Baldys A, Pontis J, Korch C, Guilhot J, Ait-Si-Ali S, Drabkin H. Erratum: Roche, J. et al. Global Decrease of Histone H3K27 Acetylation in ZEB1-Induced Epithelial to Mesenchymal Transition in Lung Cancer Cells. Cancers, 2013, 5, 334–356. Cancers. 2016; 8(12):114. https://doi.org/10.3390/cancers8120114

Chicago/Turabian Style

Roche, Joëlle, Patrick Nasarre, Robert Gemmill, Aleksander Baldys, Julien Pontis, Christopher Korch, Joëlle Guilhot, Slimane Ait-Si-Ali, and Harry Drabkin. 2016. "Erratum: Roche, J. et al. Global Decrease of Histone H3K27 Acetylation in ZEB1-Induced Epithelial to Mesenchymal Transition in Lung Cancer Cells. Cancers, 2013, 5, 334–356" Cancers 8, no. 12: 114. https://doi.org/10.3390/cancers8120114

APA Style

Roche, J., Nasarre, P., Gemmill, R., Baldys, A., Pontis, J., Korch, C., Guilhot, J., Ait-Si-Ali, S., & Drabkin, H. (2016). Erratum: Roche, J. et al. Global Decrease of Histone H3K27 Acetylation in ZEB1-Induced Epithelial to Mesenchymal Transition in Lung Cancer Cells. Cancers, 2013, 5, 334–356. Cancers, 8(12), 114. https://doi.org/10.3390/cancers8120114

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Menu

Erratum: Roche, J. et al. Global Decrease of Histone H3K27 Acetylation in ZEB1-Induced Epithelial to Mesenchymal Transition in Lung Cancer Cells. Cancers, 2013, 5, 334–356

Conflicts of Interest

Reference

Share and Cite

Article Metrics

Article Access Statistics

Further Information

Guidelines

MDPI Initiatives

Follow MDPI