Next Article in Journal
A Robust Two-Step Process for the Efficient Conversion of Acidic Soybean Oil for Biodiesel Production
Next Article in Special Issue
Infrared Characterization of the Bidirectional Oxygen-Sensitive [NiFe]-Hydrogenase from E. coli
Previous Article in Journal
Prediction of In-Situ Gasification Chemical Looping Combustion Effects of Operating Conditions
Previous Article in Special Issue
Immobilization of Eversa Lipase on Octyl Agarose Beads and Preliminary Characterization of Stability and Activity Features
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Catalysts
Volume 8
Issue 11
10.3390/catal8110525
catalysts-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Efficient Conversion of Acetate to 3-Hydroxypropionic Acid by Engineered Escherichia coli

by
Ji Hoon Lee
1,†,
Sanghak Cha
2,†,
Chae Won Kang
2,
Geon Min Lee
2,
Hyun Gyu Lim
2,* and
Gyoo Yeol Jung
1,2,*
1
School of Interdisciplinary Bioscience and Bioengineering, Pohang University of Science and Technology, 77 Cheongam-Ro, Nam-Gu, Pohang, Gyeongbuk 37673, Korea
2
Department of Chemical Engineering and, Pohang University of Science and Technology, 77 Cheongam-Ro, Nam-Gu, Pohang, Gyeongbuk 37673, Korea
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Catalysts 2018, 8(11), 525; https://doi.org/10.3390/catal8110525
Submission received: 17 October 2018 / Revised: 1 November 2018 / Accepted: 3 November 2018 / Published: 7 November 2018
(This article belongs to the Special Issue Recent Advances in Biocatalysis and Metabolic Engineering for Biomanufacturing)
Browse Figures
Versions Notes

Abstract

:
Acetate, which is an abundant carbon source, is a potential feedstock for microbial processes that produce diverse value-added chemicals. In this study, we produced 3-hydroxypropionic acid (3-HP) from acetate with engineered Escherichia coli. For the efficient conversion of acetate to 3-HP, we initially introduced heterologous mcr (encoding malonyl-CoA reductase) from Chloroflexus aurantiacus. Then, the acetate assimilating pathway and glyoxylate shunt pathway were activated by overexpressing acs (encoding acetyl-CoA synthetase) and deleting iclR (encoding the glyoxylate shunt pathway repressor). Because a key precursor malonyl-CoA is also consumed for fatty acid synthesis, we decreased carbon flux to fatty acid synthesis by adding cerulenin. Subsequently, we found that inhibiting fatty acid synthesis dramatically improved 3-HP production (3.00 g/L of 3-HP from 8.98 g/L of acetate). The results indicated that acetate can be used as a promising carbon source for microbial processes and that 3-HP can be produced from acetate with a high yield (44.6% of the theoretical maximum yield).

Graphical Abstract

1. Introduction

Microbial conversion is a highly promising process for the production of diverse value-added chemicals and as an alternative to petroleum-based processes [1,2]. Specifically, it can utilize a variety of sugars such as glucose, galactose, xylose and glycerol, which are plentiful in nature and readily available as industrial waste, as a feedstock [3,4,5]. In addition to these sugars, acetate can be used as a carbon source. Acetate is cheap and greatly abundant, as it can be obtained from biomass hydrolysate or from the conversion of various single-carbon gases [6,7,8]. Therefore, the use of acetate may reduce the cost of feedstock and thereby facilitate the development of more economic processes. In this regard, several recent studies attempted to engineer microorganisms and demonstrated the successful conversion of acetate into value-added chemicals such as itaconic acid, succinic acid and fatty acid [9,10,11].
3-Hydroxypropionic acid (3-HP) is one of the important platform chemicals that can be produced by microbial fermentation [12,13]. As 3-HP consists of two functional groups (a hydroxyl and carboxylic group), it can be easily converted to other chemicals (e.g., acrylic acid, acrylamide, and propiolactone) for which there are huge markets [12]. Due to its production from sugars, several metabolic pathways have been suggested to date [12,13]. While the representative route is the coenzyme-B12-dependent dehydration of glycerol [14,15], it is only applicable when the feedstock is glycerol. Alternatively, 3-HP can be produced via the reduction of malonyl-CoA using malonyl-CoA reductase (Figure 1) [16,17,18]. This pathway is suitable for most carbon sources, including acetate, because malonyl-CoA is a universal intermediate in cells [16,17]. Additionally, this pathway does not require an expensive cofactor, coenzyme B12, which is a potential hurdle for the economic production of 3-HP [18,19].
To achieve the efficient conversion of acetate to 3-HP, acetate should be rapidly utilized. However, microorganisms slowly utilize acetate as a carbon source and exhibit reduced cell growth [20,21]. Therefore, acetate assimilation and biomass formation should be accelerated via genetic engineering [11,22,23,24]. Furthermore, once acetate is assimilated, malonyl-CoA has to be sufficiently converted to 3-HP. However, the primary use of malonyl-CoA in microorganisms is to synthesize fatty acids, which significantly reduces 3-HP production [25,26,27]. Thus, acetate consumption for fatty acid synthesis should be reduced to improve 3-HP production.
In this study, we demonstrated the efficient conversion of acetate to 3-HP by engineering a representative microorganism, Escherichia coli. Initially, we constructed a synthetic 3-HP production pathway with maximal expression of heterologous mcr (encoding malonyl-CoA reductase) from Chloroflexus aurantiacus. To accelerate acetate consumption, we activated both the acetate assimilating pathway and glyoxylate shunt pathway by amplifying acs, which encodes acetyl-CoA synthetase, and deleting iclR, which encodes the transcriptional repressor of the glyoxylate shunt pathway operon. Additionally, to enhance the conversion of malonyl-CoA to 3-HP, carbon flux into a competing pathway (i.e., fatty acid biosynthesis) was inhibited by adding cerulenin at different concentrations. Consequently, we demonstrated that 3-HP could be efficiently produced from acetate using the engineered microbial process.

2. Results

2.1. Heterologous Expression of mcr for 3-HP Production from Acetate

For 3-HP production, we introduced mcr from C. aurantiacus into the E. coli strain BL21(DE3) (Figure 1). To increase carbon flux toward 3-HP biosynthesis, we expressed mcr at a maximum level. Specifically, we developed a synthetic cassette with a strong inducible promoter (Ptac) and a synthetic 5′ UTR (Table 1) designed using UTR Designer [28] to ensure high transcription and translation levels. Furthermore, we used the pETDuet plasmid, which has a high copy number (~40 copies per cell), to ensure its overexpression. Additionally, we introduced 3 point mutations (N940V, K1106W, S1114R) known to enhance the activity of malonyl-CoA reductase [16].
Following this, we cultivated the HJ1 strain (Table 2), which is BL21(DE3) with the constructed plasmid (pET-mcr*), in modified minimal medium. After 48 h of fermentation, the HJ1 strain consumed 8.55 g/L of acetate and produced 95.7 mg/L of 3-HP (Figure 2). Although we successfully produced 3-HP from acetate with this engineered E. coli strain, the achieved titer was too low (1.49% of the theoretical maximum yield). Thus, the strain required further engineering to improve 3-HP production with efficient acetate utilization.

2.2. Engineering the Acetate Assimilation and Glyoxylate Shunt Pathways

Compared to that of other sugars, the assimilation rate of acetate in microorganisms is relatively low [8]. Therefore, we investigated the effect of activating the acetate assimilation pathway on 3-HP production. To improve acetate uptake during the entire fermentation period, we expressed acs (encoding acetyl-CoA synthetase) with a synthetic expression cassette consisting of the strong constitutive promoter (PJ23100) and a synthetic 5′ UTR (Table 1). The synthetic expression cassette was inserted into the pACYCDuet plasmid, which has a moderate copy number (10–12 copies/cell), and the pACYC-Acs plasmid was introduced into the HJ1 strain, resulting in the HJ2 strain. Compared to the HJ1 strain, the HJ2 strain showed increased acetate consumption (a 1.11-fold increase) and cell biomass (a 1.90-fold increase), indicating that acetate assimilation was successfully expedited by acs overexpression (Figure 3A,B). Furthermore, the improved acetate assimilation in the HJ2 strain led to a 1.75-fold increase in 3-HP production (0.17 g/L, Figure 3C).
We then evaluated the effect of activating the glyoxylate shunt pathway. Because the glyoxylate shunt pathway is responsible for a key anaplerotic reaction during acetate utilization, we expected that its activation would facilitate biomass formation and improve acetate consumption. To investigate this effect, we deleted chromosomal iclR, which is known to repress the expression of aceBAK in the glyoxylate shunt pathway [11,29,30], in the HJ1 strain. Similar to the results for the overexpression of acs, the acetate consumption and cell biomass of the resultant HJ3 strain were enhanced 1.09-fold and 1.31-fold, respectively (Figure 3A,B). These results indicated that iclR deletion successfully enhanced cell biomass synthesis from acetate, which resulted in increased overall acetate consumption.
When the overexpression of acs and deletion of iclR were combined, the acetate uptake rate (1.16-fold increase) and cell biomass (2.61-fold increase) were further enhanced (HJ4 strain, Figure 3A,B). Moreover, its 3-HP production was synergistically improved 2.54-fold (0.25 g/L) compared to that of the HJ1 strain (Figure 3C). Consequently, the combination of acs overexpression and iclR deletion resulted in the most significant improvement in acetate assimilation and 3-HP production. However, despite the improvement, only a small amount of acetate was converted to 3-HP (3.35% of the theoretical maximum yield), indicating that further flux control is required for the efficient conversion of acetate to 3-HP.

2.3. Improved 3-HP Production from Acetate by Inhibiting Fatty Acid Synthesis

Despite the elevated acetate consumption level, the 3-HP titer was still low, indicating the inefficient conversion of malonyl-CoA due to leakage toward fatty acid synthesis. Therefore, we decided to inhibit fatty acid synthesis to increase the intracellular malonyl-CoA pool for 3-HP production (Figure 1). Bacterial fatty acid synthesis can be inhibited by the addition of cerulenin, which binds to FabB and FabF and irreversibly inactivates them [31,32,33]. Thus, we cultivated the HJ4 strain with the addition of different levels of cerulenin (10, 25, 50 and 100 μM) to gradually reduce carbon flux from malonyl-CoA to fatty acids. As expected, the addition of cerulenin was unfavorable for cell growth (Figure 4A–C). On the other hand, notably, it was highly beneficial for 3-HP production, as the titers and yields were dramatically increased. Specifically, when 50 μM of cerulenin was added, the HJ4 strain produced 3.00 g/L of 3-HP while consuming 8.98 g/L of acetate (0.30 g/g, 44.6% of the maximum theoretical yield, Figure 4D). This titer was 12.0-fold higher compared to the 3-HP titer produced by the same strain without cerulenin addition. These results indicated that 3-HP production from acetate was successfully improved by inhibiting fatty acid biosynthesis and that flux control around malonyl-CoA was critical for the efficient conversion of acetate to 3-HP.

3. Discussion

In this study, we developed a microbial process for the conversion of acetate to 3-HP. Initially, we introduced mcr at a maximum expression level to enable 3-HP production by an E. coli strain. In addition, acetate consumption was expedited by engineering the acetate assimilating pathway and glyoxylate shunt pathway. Furthermore, we increased carbon flux to the 3-HP production pathway by inhibiting fatty acid synthesis with the addition of cerulenin. These efforts allowed us to efficiently convert 8.98 g/L of acetate to 3.00 g/L of 3-HP. This is the first report on producing 3-HP from acetate, and the achieved yield (0.30 g/g, 44.6% of the maximum theoretical yield) was superior to the previously reported value (0.19 g/g) with glucose utilization [16].
To further improve the 3-HP production in E. coli, it could be more engineered. For example, the activity of heterologous malonyl-CoA reductase from C. aurantiacus could be improved by codon optimization of the mcr coding sequence. A number of previous studies have shown that codon optimization can elevate the activities of heterologous enzymes [34,35,36]. Thus, codon optimization of mcr would further enhance 3-HP production by expediting the conversion of malonyl-CoA to 3-HP. Furthermore, because production of 3-HP from acetate requires energy and reducing cofactor, their stable supplementation should be achieved by balancing between the TCA cycle and 3-HP synthesis. Therefore, the fine-tuning of flux toward the TCA cycle should be critical for 3-HP production. Moreover, based on the results obtained in this study, reduction of the flux to fatty acid synthesis may enhance the production of diverse malonyl-CoA-derived biochemicals in E. coli.

4. Materials and Methods

4.1. Reagents

Oligonucleotides, which are listed in Table 1, were synthesized by Cosmogenetech (Seoul, Korea). Plasmid DNA and genomic DNA were purified using ExpinTM Plasmid SV and ExpinTM Cell SV kits (GeneAll Biotechnology, Seoul, Korea). PCR products were purified using ExpinTM Gel SV kits (GeneAll). Restriction enzymes were purchased from New England Biolabs (Ipswich, MA, USA). Cerulenin was purchased from Cayman Chemical (Ann Arbor, MI, USA). 3-HP was obtained from Tokyo Chemical Industry (Tokyo, Japan). Other chemical reagents were purchased from Sigma-Aldrich (St. Louis, MO, USA).

4.2. Plasmid Cloning and Bacterial Strain Construction

All bacterial strains and plasmids used in this study are summarized in Table 2. Synthetic 5′ untranslated regions (5′ UTRs) were generated by UTR Designer [28] and are listed in Table 3. E. coli Mach1-T1R (Invitrogen, Carlsbad, CA, USA) was used as a cloning host. To construct the pET-mcr* plasmid, mcr was initially amplified from the PLB0110 plasmid [17] using the O-mcr-F1, O-mcr-F2, and O-mcr-B primers to attach a strong inducible promoter (Ptac) and a synthetic 5′ UTR. Then, the amplified fragment was digested with BamHI and XhoI endonucleases and inserted into the pETDuet plasmid. It should be noted that the coding sequence of mcr was modified from its original sequence via conventional site-directed mutagenesis using the O-N940V-F and O-N940V-B, O-K1106W-F and O-K1106W-B, and O-S1114R-F and O-S1114R-B primer pairs for the introduction of N940V(AAT to GTG), K1106W (AAG to TGG), and S1114R (AGT to CGT) mutations, respectively [16].
To construct the pACYC-acs plasmid, acs was amplified from the genomic DNA of E. coli BL21(DE3) and attached to the BBa_J23100 promoter obtained from the Registry of Standard Biological Parts (http://parts.igem.org) and a synthetic 5′ UTR using the O-Acs-F and O-Acs-B primers. The amplified fragment was digested using EcoRI and SacI restriction enzymes and introduced into the pACYCDuet plasmid.
Genome manipulation was conducted using the Lambda-Red recombination method with the pKD46 plasmid [37]. Chromosomal iclR was deleted by inserting a FRT-kanR-FRT fragment that was amplified using the R-iclR-F and R-iclR-B primer pair. The integrated kanamycin resistance gene was removed by expression of the flippase from the pCP20 plasmid.

4.3. Cultivation Methods

Cells were cultivated in a modified minimal medium consisting of 100 mM phosphate buffer (pH 7.0), 1.0 g/L NaCl, 1.0 g/L NH4Cl, 0.5 g/L MgSO4·7H2O, and 1.0 g/L yeast extract. Pre-neutralized 10 g/L acetate with NaOH was used as a carbon source. To initiate a culture, a single colony was inoculated into 3 mL of the medium in a test-tube. After an overnight incubation, the turbid culture was refreshed by re-inoculating into fresh medium. When the OD600 reached ~1.0, the refreshed seed was transferred to a 25 mL medium in a 300 mL flask until an OD600 of 0.05 was obtained. Genes under the Ptac promoter were expressed by the addition of 0.1 mM IPTG when the OD600 reached 1. At this time, different amounts of cerulenin were also added to inhibit fatty acid synthesis. The pH was adjusted by adding 5 M of HCl with a 12 h interval during 48 h of culture. The plasmids were maintained by adding 50 μg/mL ampicillin, 34 μg/mL chloramphenicol, and 50 μg/mL streptomycin. All cell cultures were conducted with three biological replicates.

4.4. Analytical Methods

To monitor the cell growth, OD600 was measured using a UV-1700 spectrophotometer (Shimadzu, Kyoto, Japan). Acetate and 3-HP were quantified using an Ultimate 3000 high-performance liquid chromatography (HPLC) system (Dionex, Sunnyvale, CA, USA). To separate the metabolites, Aminex HPX-87H (Bio-Rad Laboratories, Richmond, CA, USA) was used with 5 mM H2SO4 solution as a mobile phase (0.6 mL/min). The temperature of the column oven was set to 14 °C. Refractive index signals were measured using a Shodex RI-101 detector (Shodex, Klokkerfaldet, Denmark).

4.5. Calculation of the Theoretical Maximum Yield

Initially, 1 mol acetate could be converted into 1 mol acetyl-CoA with the generation of 1 mol AMP from 1 mol ATP via the Acs pathway. The generation of 1 mol AMP was equivalent to the consumption of 2 mol ATP (Equation (1)). Next, 1 mol malonyl-CoA was produced from 1 mol acetyl-CoA with the consumption of an additional 1 mol ATP. Finally, 1 mol malonyl-CoA was converted into 1 mol 3-HP with the consumption of 2 mol NADPH (Equation (3)). Therefore, 3 mol ATP and 2 mol NADPH were required to produce 3-HP from acetate (Equation (4)). They could be obtained from the TCA cycle with the oxidation of 1 mol acetate (1 mol NADH is equivalent to 2.5 mol ATP; 1 mol FADH is equivalent to 1.5 mol ATP; 1 mol GTP is equivalent to 1 mol ATP; 1 mol NADH is equivalent to 1 mol NADPH) (Equations (1), (5) and (6)). Consequently, the production of 1 mol 3-HP required 2 mol acetate (Equation (7), 50% mol/mol and 0.75 g/g).
Acetate + 2 ATP + CoA → Acetyl-CoA + 2 ADP + 2 Pi
Acetyl-CoA + ATP + CO2 → Malonyl-CoA + ADP + Pi
Malonyl-CoA + 2 NADPH → 3-HP + 2 NADP+ + CoA
Acetate + CO2 + 3 ATP + 2 NADH → 3-HP + 3 ADP + 3 Pi + 2 NAD+
Acetyl-CoA + 3 NAD+ + FAD+ + GDP + Pi → 2 CO2 + 3 NADH + FADH + GTP + CoA
Acetate + 2 NADP+ → 2 CO2 + 2 NADPH + 3 ATP
2 Acetate → 3-HP + CO2

Author Contributions

Conceptualization, J.H.L., S.C., H.G.L., and G.Y.J.; methodology, J.H.L., S.C., H.G.L., and G.Y.J.; software, J.H.L.; validation, J.H.L. and S.C.; formal analysis, J.H.L. and S.C.; investigation, J.H.L., S.C., C.W.K., and G.M.L.; resources, J.H.L., S.C., C.W.K., and G.M.L.; data curation, J.H.L., S.C., C.W.K., and G.M.L.; writing—original draft preparation, J.H.L., S.C., C.W.K., and G.M.L.; writing—review and editing, H.G.L. and G.Y.J.; visualization, J.H.L., S.C., H.G.L., and G.Y.J.; supervision, H.G.L. and G.Y.J.; project administration, G.Y.J.; funding acquisition, G.Y.J.

Funding

This research was supported by the C1 Gas Refinery Program (NRF-2018M3D3A1A01055754) and the Global Research Laboratory Program (NRF-2016K1A1A2912829) funded by the Ministry of Science and ICT. This research was also supported by the Korea Institute of Energy Technology Evaluation and Planning (KETEP) and the Ministry of Trade, Industry & Energy (MOTIE) of the Republic of Korea (no. 20174030201600).

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Kidanu, W.G.; Trang, P.T.; Yoon, H.H. Hydrogen and volatile fatty acids production from marine macroalgae by anaerobic fermentation. Biotechnol. Bioprocess Eng. 2017, 22, 612–619. [Google Scholar] [CrossRef]
  2. Shrestha, B.; Dhakal, D.; Darsandhari, S.; Pandey, R.P.; Pokhrel, A.R.; Jnawali, H.N.; Sohng, J.K. Heterologous production of clavulanic acid intermediates in Streptomyces venezuelae. Biotechnol. Bioprocess Eng. 2017, 22, 359–365. [Google Scholar] [CrossRef]
  3. Luo, X.; Ge, X.; Cui, S.; Li, Y. Value-added processing of crude glycerol into chemicals and polymers. Bioresour. Technol. 2016, 215, 144–154. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Wei, N.; Quarterman, J.; Jin, Y.-S. Marine macroalgae: An untapped resource for producing fuels and chemicals. Trends Biotechnol. 2013, 31, 70–77. [Google Scholar] [CrossRef] [PubMed]
  5. Ha, S.-J.; Galazka, J.M.; Kim, S.R.; Choi, J.-H.; Yang, X.; Seo, J.-H.; Glass, N.L.; Cate, J.H.D.; Jin, Y.-S. Engineered Saccharomyces cerevisiae capable of simultaneous cellobiose and xylose fermentation. Proc. Natl. Acad. Sci. USA 2011, 108, 504–509. [Google Scholar] [CrossRef] [PubMed]
  6. Huang, B.; Yang, H.; Fang, G.; Zhang, X.; Wu, H.; Li, Z.; Ye, Q. Central pathway engineering for enhanced succinate biosynthesis from acetate in Escherichia coli. Biotechnol. Bioeng. 2018, 115, 943–954. [Google Scholar] [CrossRef] [PubMed]
  7. Novak, K.; Pflügl, S. Towards biobased industry: Acetate as a promising feedstock to enhance the potential of microbial cell factories. FEMS Microbiol. Lett. 2018, 365, fny226. [Google Scholar] [CrossRef] [PubMed]
  8. Lim, H.G.; Lee, J.H.; Noh, M.H.; Jung, G.Y. Rediscovering Acetate Metabolism: Its Potential Sources and Utilization for Biobased Transformation into Value-Added Chemicals. J. Agric. Food Chem. 2018, 66, 3998–4006. [Google Scholar] [CrossRef] [PubMed]
  9. Leone, S.; Sannino, F.; Tutino, M.L.; Parrilli, E.; Picone, D. Acetate: Friend or foe? Efficient production of a sweet protein in Escherichia coli BL21 using acetate as a carbon source. Microb. Cell Fact. 2015, 14, 106. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  10. Yang, J.; Nie, Q. Engineering Escherichia coli to convert acetic acid to β-caryophyllene. Microb. Cell Fact. 2016, 15, 74. [Google Scholar] [CrossRef] [PubMed]
  11. Noh, M.H.; Lim, H.G.; Woo, S.H.; Song, J.; Jung, G.Y. Production of itaconic acid from acetate by engineering acid-tolerant Escherichia coli W. Biotechnol. Bioeng. 2018, 115, 729–738. [Google Scholar] [CrossRef] [PubMed]
  12. de Fouchécour, F.; Sánchez-Castañeda, A.-K.; Saulou-Bérion, C.; Spinnler, H.É. Process engineering for microbial production of 3-hydroxypropionic acid. Biotechnol. Adv. 2018, 36, 1207–1222. [Google Scholar] [CrossRef] [PubMed]
  13. Kumar, V.; Ashok, S.; Park, S. Recent advances in biological production of 3-hydroxypropionic acid. Biotechnol. Adv. 2013, 31, 945–961. [Google Scholar] [CrossRef] [PubMed]
  14. Seok, J.Y.; Yang, J.; Choi, S.J.; Lim, H.G.; Choi, U.J.; Kim, K.-J.; Park, S.; Yoo, T.H.; Jung, G.Y. Directed evolution of the 3-hydroxypropionic acid production pathway by engineering aldehyde dehydrogenase using a synthetic selection device. Metab. Eng. 2018, 47, 113–120. [Google Scholar] [CrossRef] [PubMed]
  15. Lim, H.G.; Noh, M.H.; Jeong, J.H.; Park, S.; Jung, G.Y. Optimum Rebalancing of the 3-Hydroxypropionic Acid Production Pathway from Glycerol in Escherichia coli. ACS Synth. Biol. 2016, 5, 1247–1255. [Google Scholar] [CrossRef] [PubMed]
  16. Liu, C.; Ding, Y.; Zhang, R.; Liu, H.; Xian, M.; Zhao, G. Functional balance between enzymes in malonyl-CoA pathway for 3-hydroxypropionate biosynthesis. Metab. Eng. 2016, 34, 104–111. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  17. Rathnasingh, C.; Raj, S.M.; Lee, Y.; Catherine, C.; Ashok, S.; Park, S. Production of 3-hydroxypropionic acid via malonyl-CoA pathway using recombinant Escherichia coli strains. J. Biotechnol. 2012, 157, 633–640. [Google Scholar] [CrossRef] [PubMed]
  18. Cheng, Z.; Jiang, J.; Wu, H.; Li, Z.; Ye, Q. Enhanced production of 3-hydroxypropionic acid from glucose via malonyl-CoA pathway by engineered Escherichia coli. Bioresour. Technol. 2016, 200, 897–904. [Google Scholar] [CrossRef] [PubMed]
  19. Liu, C.; Ding, Y.; Xian, M.; Liu, M.; Liu, H.; Ma, Q.; Zhao, G. Malonyl-CoA pathway: A promising route for 3-hydroxypropionate biosynthesis. Crit. Rev. Biotechnol. 2017, 37, 933–941. [Google Scholar] [CrossRef] [PubMed]
  20. Enjalbert, B.; Millard, P.; Dinclaux, M.; Portais, J.-C.; Létisse, F. Acetate fluxes in Escherichia coli are determined by the thermodynamic control of the Pta-AckA pathway. Sci. Rep. 2017, 7, 42135. [Google Scholar] [CrossRef] [PubMed]
  21. Rajaraman, E.; Agarwal, A.; Crigler, J.; Seipelt-Thiemann, R.; Altman, E.; Eiteman, M.A. Transcriptional analysis and adaptive evolution of Escherichia coli strains growing on acetate. Appl. Microbiol. Biotechnol. 2016, 100, 7777–7785. [Google Scholar] [CrossRef] [PubMed]
  22. Chong, H.; Yeow, J.; Wang, I.; Song, H.; Jiang, R. Improving acetate tolerance of Escherichia coli by rewiring its global regulator cAMP receptor protein (CRP). PLoS ONE 2013, 8, e77422. [Google Scholar] [CrossRef] [PubMed]
  23. Fernández-Sandoval, M.T.; Huerta-Beristain, G.; Trujillo-Martinez, B.; Bustos, P.; González, V.; Bolivar, F.; Gosset, G.; Martinez, A. Laboratory metabolic evolution improves acetate tolerance and growth on acetate of ethanologenic Escherichia coli under non-aerated conditions in glucose-mineral medium. Appl. Microbiol. Biotechnol. 2012, 96, 1291–1300. [Google Scholar] [CrossRef] [PubMed]
  24. Kirkpatrick, C.; Maurer, L.M.; Oyelakin, N.E.; Yoncheva, Y.N.; Maurer, R.; Slonczewski, J.L. Acetate and formate stress: Opposite responses in the proteome of Escherichia coli. J. Bacteriol. 2001, 183, 6466–6477. [Google Scholar] [CrossRef] [PubMed]
  25. Liu, T.; Vora, H.; Khosla, C. Quantitative analysis and engineering of fatty acid biosynthesis in E. coli. Metab. Eng. 2010, 12, 378–386. [Google Scholar] [CrossRef] [PubMed]
  26. Yang, Y.; Lin, Y.; Li, L.; Linhardt, R.J.; Yan, Y. Regulating malonyl-CoA metabolism via synthetic antisense RNAs for enhanced biosynthesis of natural products. Metab. Eng. 2015, 29, 217–226. [Google Scholar] [CrossRef] [PubMed]
  27. Zha, W.; Rubin-Pitel, S.B.; Shao, Z.; Zhao, H. Improving cellular malonyl-CoA level in Escherichia coli via metabolic engineering. Metab. Eng. 2009, 11, 192–198. [Google Scholar] [CrossRef] [PubMed]
  28. Seo, S.W.; Yang, J.-S.; Kim, I.; Yang, J.; Min, B.E.; Kim, S.; Jung, G.Y. Predictive design of mRNA translation initiation region to control prokaryotic translation efficiency. Metab. Eng. 2013, 15, 67–74. [Google Scholar] [CrossRef] [PubMed]
  29. Noh, M.H.; Lim, H.G.; Park, S.; Seo, S.W.; Jung, G.Y. Precise flux redistribution to glyoxylate cycle for 5-aminolevulinic acid production in Escherichia coli. Metab. Eng. 2017, 43, 1–8. [Google Scholar] [CrossRef] [PubMed]
  30. Holms, W.H.; Bennett, P.M. Regulation of isocitrate dehydrogenase activity in Escherichia coli on adaptation to acetate. J. Gen. Microbiol. 1971, 65, 57–68. [Google Scholar] [CrossRef] [PubMed]
  31. Moche, M.; Schneider, G.; Edwards, P.; Dehesh, K.; Lindqvist, Y. Structure of the complex between the antibiotic cerulenin and its target, beta-ketoacyl-acyl carrier protein synthase. J. Biol. Chem. 1999, 274, 6031–6034. [Google Scholar] [CrossRef] [PubMed]
  32. Price, A.C.; Choi, K.H.; Heath, R.J.; Li, Z.; White, S.W.; Rock, C.O. Inhibition of beta-ketoacyl-acyl carrier protein synthases by thiolactomycin and cerulenin. Structure and mechanism. J. Biol. Chem. 2001, 276, 6551–6559. [Google Scholar] [CrossRef] [PubMed]
  33. Rogers, J.K.; Church, G.M. Genetically encoded sensors enable real-time observation of metabolite production. Proc. Natl. Acad. Sci. USA 2016, 113, 2388–2393. [Google Scholar] [CrossRef] [PubMed]
  34. Menzella, H.G. Comparison of two codon optimization strategies to enhance recombinant protein production in Escherichia coli. Microb. Cell Fact. 2011, 10, 15. [Google Scholar] [CrossRef] [PubMed]
  35. Anthony, L.C.; Nowroozi, F.; Kwon, G.; Newman, J.D.; Keasling, J.D. Optimization of the mevalonate-based isoprenoid biosynthetic pathway in Escherichia coli for production of the anti-malarial drug precursor amorpha-4,11-diene. Metab. Eng. 2009, 11, 13–19. [Google Scholar] [CrossRef] [PubMed]
  36. Yim, H.; Haselbeck, R.; Niu, W.; Pujol-Baxley, C.; Burgard, A.; Boldt, J.; Khandurina, J.; Trawick, J.D.; Osterhout, R.E.; Stephen, R.; et al. Metabolic engineering of Escherichia coli for direct production of 1,4-butanediol. Nat. Chem. Biol. 2011, 7, 445–452. [Google Scholar] [CrossRef] [PubMed]
  37. Datsenko, K.A.; Wanner, B.L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 2000, 97, 6640–6645. [Google Scholar] [CrossRef] [PubMed]
Catalysts 08 00525 g001 550
Figure 1. Schematic diagram of a metabolic pathway for the 3-HP production from acetate. 3-HP was synthesized by heterologous overexpression of mcr (encoding malonyl-CoA reductase from C. aurantiacus). For accelerated acetate assimilation, acs (encoding acetyl-CoA synthetase) was overexpressed and iclR (encoding glyoxylate shunt pathway repressor) was deleted. Deletion of iclR upregulates the expression of aceA (encoding isocitrate lyase), aceB (encoding malate synthase), and aceK (encoding isocitrate dehydrogenase kinase/phosphatase). Phosphorylation of isocitrate dehydrogenase (encoded by icd) results in its reduced activity. Different amounts of cerulenin were added to inhibit fatty acids biosynthesis.
Figure 1. Schematic diagram of a metabolic pathway for the 3-HP production from acetate. 3-HP was synthesized by heterologous overexpression of mcr (encoding malonyl-CoA reductase from C. aurantiacus). For accelerated acetate assimilation, acs (encoding acetyl-CoA synthetase) was overexpressed and iclR (encoding glyoxylate shunt pathway repressor) was deleted. Deletion of iclR upregulates the expression of aceA (encoding isocitrate lyase), aceB (encoding malate synthase), and aceK (encoding isocitrate dehydrogenase kinase/phosphatase). Phosphorylation of isocitrate dehydrogenase (encoded by icd) results in its reduced activity. Different amounts of cerulenin were added to inhibit fatty acids biosynthesis.
Catalysts 08 00525 g001
Catalysts 08 00525 g002 550
Figure 2. Time-course fermentation profile of the HJ1 strain. The left y-axis, right y-axis and right y-offset represent the cell biomass (g DCW/L), acetate (g/L) and 3-HP (g/L), respectively. The x-axis denotes time (h). Symbols: circles, cell biomass; squares, acetate; triangles, 3-HP. The error bars indicate standard deviations for measurements from three independent cultures. One OD600 unit corresponds to 0.31 g dry cell weight (g DCW/L).
Figure 2. Time-course fermentation profile of the HJ1 strain. The left y-axis, right y-axis and right y-offset represent the cell biomass (g DCW/L), acetate (g/L) and 3-HP (g/L), respectively. The x-axis denotes time (h). Symbols: circles, cell biomass; squares, acetate; triangles, 3-HP. The error bars indicate standard deviations for measurements from three independent cultures. One OD600 unit corresponds to 0.31 g dry cell weight (g DCW/L).
Catalysts 08 00525 g002
Catalysts 08 00525 g003 550
Figure 3. Genetic engineering to improve 3-HP production from acetate. Acetate consumption (g/L), cell biomass (g DCW/L) and 3-HP (g/L) production of the HJ1—4 strains after 48 h of fermentation. (A) Acetate consumption (g/L), (B) cell biomass (g DCW/L), and (C) 3-HP production (g/L) of engineered strains were compared. The error bars indicate standard deviations for measurements from three independent cultures.
Figure 3. Genetic engineering to improve 3-HP production from acetate. Acetate consumption (g/L), cell biomass (g DCW/L) and 3-HP (g/L) production of the HJ1—4 strains after 48 h of fermentation. (A) Acetate consumption (g/L), (B) cell biomass (g DCW/L), and (C) 3-HP production (g/L) of engineered strains were compared. The error bars indicate standard deviations for measurements from three independent cultures.
Catalysts 08 00525 g003
Catalysts 08 00525 g004 550
Figure 4. Improved 3-HP production with the addition of cerulenin. (A) Acetate consumption (g/L), (B) cell biomass (g DCW/L) and (C) 3-HP (g/L) production of the HJ4 strain with different cerulenin concentrations after 48 h fermentation. (D) Time-course fermentation profile (48 h) of the HJ4 strain with 50 μM of cerulenin in a modified acetate minimal medium. The left y-axis, right y-axis and right y-offset represent the cell biomass (g DCW/L), acetate (g/L) and 3-HP (g/L), respectively. The x-axis denotes time (h). Symbols: circles, cell biomass; squares, acetate; triangles, 3-HP. The error bars indicate standard deviations for measurements from three independent cultures.
Figure 4. Improved 3-HP production with the addition of cerulenin. (A) Acetate consumption (g/L), (B) cell biomass (g DCW/L) and (C) 3-HP (g/L) production of the HJ4 strain with different cerulenin concentrations after 48 h fermentation. (D) Time-course fermentation profile (48 h) of the HJ4 strain with 50 μM of cerulenin in a modified acetate minimal medium. The left y-axis, right y-axis and right y-offset represent the cell biomass (g DCW/L), acetate (g/L) and 3-HP (g/L), respectively. The x-axis denotes time (h). Symbols: circles, cell biomass; squares, acetate; triangles, 3-HP. The error bars indicate standard deviations for measurements from three independent cultures.
Catalysts 08 00525 g004
Table
Table 1. Synthetic 5′ UTR for gene expression.
Table 1. Synthetic 5′ UTR for gene expression.
Gene5′ UTR sequence (5′−3′) aPredicted Expression Level (a.u.)
mcrAACAATTACTAGTAAGGAGAGGAGT3,110,669.92
acsAAAATCAGCGCCCAAGGAGTCACCG b1,074,836.02
a 5′ UTR sequences were designed using UTR Designer [26]. b This sequence was originally designed in a previous study [9].
Table
Table 2. Bacterial strains and plasmids used in this study.
Table 2. Bacterial strains and plasmids used in this study.
NameDescriptionSource
Strains
Mach1-T1RE. coli F− φ80(lacZ)ΔM15 ΔlacX74 hsdR(rK−mK+) ΔrecA1398 endA1 tonAInvitrogen
BL21(DE3)E. coli F− ompT gal dcm lon hsdSB (rB− mB−) λ(DE3)Invitrogen
HJ1BL21(DE3)/pET-mcr* This study
HJ2BL21(DE3)/pET-mcr*/pACYC-acsThis study
HJ3BL21(DE3) ΔiclR/pET-mcr*This study
HJ4BL21(DE3) ΔiclR/pET-mcr*/pACYC-acsThis study
Plasmids
PLB0110Source of mcr[15]
pETDuetExpression vector, ColE1 ori, AmpRNovagen
pACYCDuetExpression vector, p15A ori, CmRNovagen
pKD46Red recombinase expression vector, AmpR[32]
pFRT72variantSource of mutant FRT-kanR-FRT[33]
pCP20FLP expression vector, AmpR, CmR[32]
pET-mcr*pETDuet/Ptac-SynUTRmcr-mcr N940V, K1106W, S1114RThis study
pACYC-acspACYCDuet/PBBa_J23100-SynUTRacs-acsThis study
Table
Table 3. Oligonucleotides used in this study.
Table 3. Oligonucleotides used in this study.
NameSequence (5′−3′)
O-mcr-F1GGAATTGTGAGCGGATAACAATTACTAGTAAGGAGAGGAGTATGAGCGGAACAGGACGACT
O-mcr-F2GGATCCTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATT
O-mcr-BCTCGAGTGCGAAAAAACCCCGCCGAAGCGGGGTTTTTTGCGGCATGCTTACACGGTAATCGCCCGT
O-N940V-FTATTACCTTGCCGACCGCAATGTCAGTGGTGAGACATTCC
O-N940V-BGCGGTCGGCAAGGTAATAG
O-K1106W-FATTTCCGGGTAGCGCGCAAGATTGCCCTGAGTGATGGTG
O-K1106W-BGCGCGCTACCCGGAAATG
O-S1114R-FTGAGTGATGGTGCCAGTCTCGCGCTGGTCACTC
O-S1114R-BAGACTGGCACCATCACTCAGGGC
O-acs-FGAATTCTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCAAAATCAGCGCCCAAGGAGTCACCGATGAGCCAAATTCACAAACACA
O-acs-BGAGCTCAAAAAAAACCCCGCCCTGTCAGGGGCGGGGTTTTTTTTTTTACGATGGCATCGCGATAG
R-iclR-FTGCCACTCAGGTATGATGGGCAGAATATTGCCTCTGCCCGCCAGAAAAAGGCATGACCGGCGCGATGC
R-iclR-BTAACAATAAAAATGAAAATGATTTCCACGATACAGAAAAAGGAGACTGTCGCTCAGCGGATCTCATGCGC
C-iclR-FCAACATTAACTCATCGGATCAG
C-iclR-BTCTATTGCCACTCAGGTATGATGGGC

Share and Cite

MDPI and ACS Style

Lee, J.H.; Cha, S.; Kang, C.W.; Lee, G.M.; Lim, H.G.; Jung, G.Y. Efficient Conversion of Acetate to 3-Hydroxypropionic Acid by Engineered Escherichia coli. Catalysts 2018, 8, 525. https://doi.org/10.3390/catal8110525

AMA Style

Lee JH, Cha S, Kang CW, Lee GM, Lim HG, Jung GY. Efficient Conversion of Acetate to 3-Hydroxypropionic Acid by Engineered Escherichia coli. Catalysts. 2018; 8(11):525. https://doi.org/10.3390/catal8110525

Chicago/Turabian Style

Lee, Ji Hoon, Sanghak Cha, Chae Won Kang, Geon Min Lee, Hyun Gyu Lim, and Gyoo Yeol Jung. 2018. "Efficient Conversion of Acetate to 3-Hydroxypropionic Acid by Engineered Escherichia coli" Catalysts 8, no. 11: 525. https://doi.org/10.3390/catal8110525

APA Style

Lee, J. H., Cha, S., Kang, C. W., Lee, G. M., Lim, H. G., & Jung, G. Y. (2018). Efficient Conversion of Acetate to 3-Hydroxypropionic Acid by Engineered Escherichia coli. Catalysts, 8(11), 525. https://doi.org/10.3390/catal8110525

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop