Next Article in Journal
Effects of Sublethal Doses of Methyl Benzoate on the Life History Traits and Acetylcholinesterase (AChE) Activity of Aphis gossypii
Previous Article in Journal
Defining Optimal Strength of the Nutrient Solution for Soilless Cultivation of Saffron in the Mediterranean
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 10
Issue 9
10.3390/agronomy10091312
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Bacillus velezensis PEA1 Inhibits Fusarium oxysporum Growth and Induces Systemic Resistance to Cucumber Mosaic Virus

by
Ahmed Abdelkhalek
1,*,
Said I. Behiry
2 and
Abdulaziz A. Al-Askar
3,*
1
Plant Protection and Biomolecular Diagnosis Department, ALCRI, City of Scientific Research and Technological Applications, New Borg El Arab City, Alexandria 21934, Egypt
2
Agricultural Botany Department, Faculty of Agriculture (Saba Basha), Alexandria University, Alexandria 21531, Egypt
3
Botany and Microbiology Department, Faculty of Science, King Saud University, Riyadh 11451, Saudi Arabia
*
Authors to whom correspondence should be addressed.
Agronomy 2020, 10(9), 1312; https://doi.org/10.3390/agronomy10091312
Submission received: 3 August 2020 / Revised: 21 August 2020 / Accepted: 31 August 2020 / Published: 2 September 2020
(This article belongs to the Section Pest and Disease Management)
Browse Figures
Versions Notes

Abstract

:
Bacillus velezensis manifests robust biocontrol activity against fungal plant pathogens; however, its antiviral activity has rarely been investigated. Bacillus velezensis strain PEA1 was isolated, characterized, and evaluated for antifungal and antiviral activities against Fusarium oxysporum MT270445 and cucumber mosaic virus (CMV) MN594112. Our findings proved that strain PEA1 had intense antagonist activity against F. oxysporum. Under greenhouse conditions, the antiviral activities (protective, curative, and inactivation) of PEA1-culture filtrate (CF) on Datura stramonium plants were assayed, using a half-leaf method. The inactivation treatment exhibited the highest inhibition rate (97.56%) and the most considerable reduction of CMV-CP accumulation levels (2.1-fold) in PEA1-CF-treated plants when compared with untreated plants (26.9-fold). Furthermore, PEA1-CF induced systemic resistance with significantly elevated transcriptional levels of PAL, CHS, HQT, PR-1, and POD genes in D. stramonium leaves after all treatments. Gas chromatography‒mass spectrometry analysis showed that pyrrolo[1,2-a]pyrazine-1,4-dione is the main compound in the PEA1-CF ethyl acetate extract, which may act as an elicitor molecule that induces plant systemic resistance and inhibits both fungal growth and viral replication. Consequently, B. velezensis can be considered as a potential source for the production of bioactive compounds for the management of plant diseases. To our knowledge, this is the first report of the antiviral activity of B. velezensis against plant viral infection.

1. Introduction

Plant diseases are responsible for severe crop production losses worldwide that resulted in critical food security problems [1]. Among plant pathogens, plant viruses are the most important pathogens, responsible for huge crop production problems once they occur in the field [2,3]. Soil-borne pea diseases, including root rots and wilts, are of major economic importance and can cause a significant reduction in yield [4]. However, several other Fusarium species and pathogens have been associated with root rots in field pea, including Fusarium oxysporum f. sp. pisi, F. solani f. sp. pisi, Pythium spp., and Rhizoctonia solani. Among these, Fusarium root rots are thought to cause the most serious disease [5]. The disease appears late in the crop growth, thus chemicals are entirely ineffective.
Moreover, the use of chemicals endangers the environment and public health, and creates an imbalance in microbial biodiversity [1], so alternative methods of controlling the disease have been studied, with an emphasis on the biological control of Fusarium wilt [6]. Cucumber mosaic virus (CMV, genus Cucumovirus, family Bromoviridae) is one of the most destructive and economically important plant viruses, causing severe damage to crop quality and yield worldwide [7]. CMV has a wide range of hosts, including both monocots and dicots, and is able to infect more than 1200 species in over 100 plant families all over the world [8].
The application of plant growth-promoting rhizobacteria (PGPR) as biocontrol agents is being considered as a promising, safe approach to crop protection from different pathogens [9,10,11,12]. Among the PGPR, Bacillus sp. represents the dominant group of biocontrol agents that produce an array of antimicrobial compounds and are commonly used in plant disease management [1,13]. Bacillus species provide a wide range of secondary metabolites that potentially stimulate plant-induced systemic resistance (ISR) and inhibit the growth of plant pathogens [13,14,15]. It has been reported that ISR defense and hypersensitive response reactions were linked with the enhancement of secondary metabolites accumulation and the expression of different defense genes such as phenylalanine ammonia-lyase, lipoxygenase, peroxidase, and defensins [16,17,18]. ISR using Bacillus showed promising results against different plant viruses such as the tomato mottle virus, tobacco mosaic virus (TMV), CMV, and potato virus Y (PVY) [9,19,20,21,22,23].
B. velezensis, a novel species of Gram-positive Bacillus, has been widely investigated as to its direct or indirect growth improvement effect on many plants [24]. It was first isolated from environmental samples in Spain [25]. Phenotypic characteristics and molecular analyses showed that it was related to B. subtilis and B. amyloliquefaciens. Many studies focused on its properties and applications to improve plant growth and inhibit the growth of many pathogenic fungi such as R. solani, Helicobasidium purpureum, Cryphonectria parasitica, Cylindrocladium quinqueseptatum, F. oxysporum, R. solanacearum, and Aspergillus flavus [26,27,28,29]. However, no study has reported on the effect against viral diseases. The present study evaluated the antifungal activity of B. velezensis strain PEA1 against F. oxysporum. Moreover, the efficacy of PEA1 to inactivate CMV replication and induce systemic resistance against CMV infection was assayed for the first time. Furthermore, the bioactive constituents of PEA1 crude filtrate were identified and analyzed using gas chromatograph–mass spectroscopy (GC–MS) analysis.

2. Materials and Methods

2.1. Viral Isolation and Molecular Characterization

Cucumber (Cucumis sativus L.) samples with severe leaf mosaic symptoms and chlorosis as characteristic CMV-like symptoms were collected from open fields at Alexandria governorate in Egypt. Using a double antibody-sandwich enzyme-linked immunosorbent assay (DAS-ELISA, BIOREBA AG, Reinach, Switzerland), the collected samples were tested for viral infection as described previously [30]. In an insect-proof greenhouse, a single local lesion developed on Datura stramonium leaves was used as a pure virus isolate source for purification and inoculation. The viral RNA from the purified virus was extracted using the RNeasy Mini Kit according to the manufacturer’s instructions (QIAGEN, Hilden, Germany). The first-strand cDNA was synthesized and subjected to PCR amplification using CMV-movement protein (MP) gene primers (Table 1), as previously described [31]. PCR reaction was initial denaturation at 95 °C for 2 min, followed by 35 cycles at 95 °C for 1 min, 52 °C for 1 min, and 72 °C for 1 min. The final extension was at 72 °C for 10 min.

2.2. Fungal Isolation and Identification

Infected pea (Pisum sativum L.) root tissues with dark brown lesions were collected from an open field from Alexandria governorate, Egypt. Initial identification of the pure culture to genus was carried out based on colony characteristics, including colony morphology, colony color on potato dextrose agar (PDA), and spore morphology. Pure cultures of Fusarium species were obtained through single-spore transfers. Fusarium isolate was identified to species level using morphological keys, as described in Booth [32] and Leslie and Summerell [33]. Morphological identification of the representative strain was confirmed by PCR assay and sequencing using 18S rRNA primers (Table 1), followed by a comparison of the sequences with 18S rRNA sequences of Fusarium available in GenBank and the Fusarium ID database [34].

2.3. Bacillus Isolation, Biochemical Characterization, and 16 rRNA Amplification

Soil-adhered pea roots were collected from a pea field in Alexandria governorate, Egypt. The homogenate of roots was cultivated on nutrient agar media and incubated at 30 °C. Different colonies were picked and we assayed their antifungal and antiviral activities. The bacterial isolate showing a maximum antiviral and antifungal activity was selected and identified based on morphological and biochemical characteristics [25]. Bacterial genomic DNA was extracted using Wizard Genomic DNA Purification Kit (Promega, Madison, WI, USA) according to the manufacturer’s instructions. Using 16 rRNA specific primers (Table 1), the PCR reaction was performed as previously reported [35].

2.4. Sequencing Analysis and Phylogenetic Construction

PCR-amplified products were checked in 1.5% agarose gel, electrophoresed in 0.5 × TBE buffer, and visualized using a gel documentation system (Syngene). The amplified PCR products (CMV-MP, 18S rRNA, and 16S rRNA) were sequenced directly after excision and purified from the gel with a PCR clean-up column kit (QIAGEN, Hilden, Germany). Sequencing was performed using a BigDye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems, Foster City, CA, USA) and a model 3130xl Genetic Analyzer (Applied Biosystems, Foster City, CA, USA). The obtained DNA nucleotide sequences were analyzed using NCBI-BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The phylogenetic trees were analyzed by using a bootstrap method with 2000 replications and generated based on MEGA 6 software.

2.5. Analysis of Antagonistic Activities of Bacillus Isolate

Square 5 mm diameter blocks of pathogenic Fusarium hyphae were taken by a scalpel and placed on the edge of a potato dextrose agar (PDA) plate. The plate was incubated for two days at 28 °C, then bacterial isolate was streaked at a distance of 5 cm from the edge of the pathogenic fungal hyphae and cultured at 28 °C for another two days. The inhibition zones were measured to judge the antagonistic activities [24].

2.6. Assays of Antiviral Activity

The selected bacterial isolate was grown in a nutrient broth medium for 48 h at 30 °C with shaking. The bacterial culture filtrate (CF) was obtained after centrifugation at 10,000 rpm for 10 min and filtration through a 0.22 μm pore size syringe filter. The antiviral activity of the CF was assayed on D. stramonium as a hypersensitive local lesion host for CMV using the half-leaf method [36,37]. The purified CMV inoculum concentration was diluted to 20 µg/mL with 0.1 M phosphate buffer, pH 7.2, before use. Under greenhouse conditions, D. stramonium plants at the 5‒6 leaf stage were subjected to three assays. Each assay comprised three pot replicates, and each pot contained three D. stramonium plants. Protective treatment (first assay) involved the upper right halves of leaves being treated with 100 µL of bacterial CF using a paintbrush. After 24 h, both halves of the leaves were dusted with carborundum and mechanically inoculated with CMV as previously described [38,39]. Curative treatment (second assay) involved both halves of the leaves being dusted with carborundum and mechanically inoculated with CMV. After 24 h, the upper right halves of leaves were treated with 100 µL of bacterial CF using a paintbrush. Inactivation treatment (third assay) involved an equal volume of purified CMV being mixed with the same amount of bacterial CF and incubated for 1 h at 4 °C. The mixture was inoculated on the upper right halves of leaves, whereas the right side of the leaves was inoculated with CMV. Mock leaves treated with a mix of equal volumes from sterile distilled H2O and phosphate buffer with carborundum was used as a control. All plants were kept under greenhouse conditions, 28 °C/16 °C (day/night) and 70% relative humidity. The local lesion numbers were recorded at 4‒5 dpi. The antiviral activities were tested according to the inhibition percentage towards the number of local lesions. The inhibitory effect was calculated according to the following formula: I = (1 − T/C) × 100, where T is the number of local lesions on the treated half of the leaves and C is the number of local lesions on the control half of the leaves.

2.7. Plant Total RNA Extraction and cDNA Synthesis

Total RNA was extracted from D. stramonium half leaves (100 mg, fresh weight) collected at 5 dpi using the RNeasy plant Mini Kit according to the manufacturer’s instructions (QIAGEN, Hilden, Germany). After checking the purity and concentration of extracted RNA, 1 μg of DNase-treated RNA was used to synthesize cDNA in a reverse transcription reaction (superscript reverse transcriptase enzyme, Invitrogen, Waltham, MA, USA), according to the manufacturer’s instructions and as described in our previous study [38,40]. In a thermal cycler (Eppendorf, Hamburg, Germany), the reverse transcriptase reaction performed at 42 °C for 1 h and deactivated at 80 °C for 10 min. The reaction mixture was stored at −20 °C until use.

2.8. qRT-PCR Assay and Data Analysis

The effects of bacterial CF on the accumulation level of CMV and D. stramonium defense-related genes were evaluated using qPCR. A different set of primers (Table 1) specific to phenylalanine ammonia-lyase (PAL), pathogenesis-related protein 1 (PR-1), peroxidase (POD), chalcone synthase (CHS), hydroxycinnamoyl Co A quinate hydroxycinnamoyl transferase (HQT), and CMV-CP genes was used in this study. The housekeeping gene β-actin (Table 1) was used as a reference gene to normalize the transcript expression levels. The pool of three plants per replicate (three leaves per plant) was prepared for qPCR analysis. Reactions of each sample were run in triplicate using Rotor-Gene 6000 (QIAGEN, ABI System, Hilden, Germany) with the SYBR Green PCR Master Mix (Fermentas, Waltham, MA, USA) and performed according to [41]. The amplification program and relative expression level of the target gene were accurately quantified and calculated, as described previously [42,43].

2.9. GC–MS Fractionation of Bacterial Ethyl Acetate Extract

To identify active components of bacterial CF, a 48 h bacterial culture broth was precipitated and the supernatant was collected and mixed with ethyl acetate, as a solvent, at a ratio of 1:1 (v/v). The mixture was shaken vigorously for 20 min and, using a separating funnel, the ethyl acetate phase was separated from the aqueous phase. Ethyl acetate extract was concentrated by evaporation at 50 °C in a rotary evaporator. The residue that contained the secondary metabolites and chemical compounds was analyzed using gas chromatograph–mass spectroscopy (GC–MS) [44]. The analyses were run on a GC–MS system (TRACE 1300 Series, Thermo, Waltham, MA, USA) and the test carried out at the Marine Pollution Lab of National Institute of Oceanography and Fisheries, Alexandria, Egypt. The mass detector was used in split mode and helium gas with a flow rate of 1 mL/min was used as a carrier. The injector was operated at 250 °C and the oven temperature for initial setup was at 60 °C for 2 min, scan time 0.2 s; mass range 50–650 amu and ramp 4/min to 250 °C for 20 min. Mass spectra were taken at 70 eV, during the running time of 53 min. The constituents were identified after comparing them with the available data in the GC–MS library in the literature.

2.10. Statistical Analysis

The results of fungal growth inhibition, as affected by the bacterial isolate and the relative expression levels, were analyzed by one-way analysis of variance (ANOVA) using CoStat software, while the significant differences were determined according to the least significant differences (LSD) p ≤ 0.05 level of probability, and standard deviation (±SD) is shown as a column bar. Compared with the control, relative expression levels higher than 1 demonstrated an increase in gene expression (upregulation), while values lower than 1 meant a decrease in expression levels (downregulation).

3. Results and Discussion

The application of plant growth-promoting rhizobacteria (PGPR) as biological control agents may overcome the shortage of chemical agents and ensure the healthy growth of corn plants, and is considered a sustainable and environmentally friendly alternative [1,45]. Among PGPR, Bacillus comprises enormous biocontrol agents that produce a wide range of biologically active secondary metabolites that can increase plant systemic resistance and inhibit the growth of plant pathogens [46,47,48,49].

3.1. Identification of Bacterial Strain PEA1, Fungal Strain Kh1, and Viral Strain Kh1

On the basis of the morphological characteristics, biochemical, and physiological reactions (Table 2), the bacterial isolate was identified as B. velezensis. The bacterial colonies were subspherical, milk-white, creamy, and surface-folded. On the basis of NCBI-BLAST alignment of a nucleotide sequence of a 16S rRNA gene (1311 bp) that exhibited 100% homology with B. velezensis (Acc #MK445134, India), our isolate PEA1 was identified as B. velezensis, and the annotated sequence was submitted to the GenBank database under the accession number MT270519. Phylogenetic tree analysis revealed that PEA1 was closely related to the other B. velezensis and belonged to the same evolutionary lineage as B. velezensis (data not shown).
For the fungal isolate, the initial identification confirmed the genus of Fusarium based on the colony characteristics. Additionally, NCBI-BLAST alignment of the nucleotide sequence of the 18S rRNA gene (510 bp) exhibited 99.8% homology with F. oxysporum (Acc #CP052041, China). The annotated nucleotide sequence was deposited in GenBank under number (MT270445) of F. oxysporum strain Kh1. Moreover, the phylogenetic tree analysis revealed that strain Kh1 was closely related to the other F. oxysporum and belonged to the same evolutionary lineage as F. oxysporum (data not shown).
The characteristic symptoms of collected cucumber samples, naturally infected with CMV and confirmed by DAS-ELISA, were recorded as chlorosis and mosaic symptoms on cucumber leaves. The single local lesion developed on D. stramonium leaves at 4–5 dpi was used as a pure virus source for propagation, molecular identification, and antiviral evaluation experiments. RT-PCR, using a specific primer of CMV-MP gene, successfully amplified 375 bp within the open reading frame of the CMV-MP gene. After PCR purification and sequencing, the annotated sequence was deposited in the GenBank database under the accession number MN594112. The NCBI-BLAST alignment and phylogenetic tree analysis showed that CMV strain Kh1 was firmly related to other CMV isolates, especially Malaysian (Acc #JN054635) and Egyptian (Acc #KX014666) isolates, with a similarity of 98.67% and 98.13%, respectively (data not shown).

3.2. Inhibitory Effects of PEA1 against F. oxysporum Kh1

Recently, B. velezensis was reported as a biocontrol agent against a wide range of plant pathogens, including fungi, bacteria, and nematodes [50,51]. F. oxysporum is ubiquitous and is considered to be associated primarily with wilts of various crops [52]. However, reports from Europe and Canada have established F. oxysporum as a causal agent of pea root rot, along with other Fusarium spp. [53,54,55,56]. In this study, the in vitro antagonism between F. oxysporum Kh1 and B. velezensis PEA1 revealed that PEA1 inhibited hyphal growth with 15 mm in diameter compared with the control (Figure 1). This result considers the ability of PEA1, as a bioagent, to stop the progress of the fungus. Thus, the obtained result suggests that PEA1 may secrete secondary metabolites that can inhibit fungal growth. Previous studies revealed that B. velezensis produces a variety of secondary metabolites, including antimicrobial proteins, lipopeptide antibiotics, polyketides, and siderophores [14,57,58,59,60]. Bacillus strains FKM10 and FZB42 are both antagonistic bacteria, which can produce a variety of antagonistic substances and inhibit the proliferation of fungi, reducing the richness and diversity of fungi in the soil [24,26,61,62]. Many mechanisms involved in the interaction between B. velezensis and Fusarium spp. B. velezensis FKM10 and LM2303 were previously reported to damage and destroy the cell wall and cell membrane permeability of F. graminearumon and F. verticillioides by cyclic lipopeptides (fengycin, iturin, and surfactin) [24,63].

3.3. Inhibitory Effects of PEA1-CF against CMV

Under greenhouse conditions, the antiviral activities or inhibitory effects, including protective, curative, and inactivating activities of PEA1-culture filtrate (CF) against CMV, were evaluated on D. stramonium. Using the half-leaf assay method, PEA1-CF activity was calculated by counting the local lesions that developed on inoculated leaves at five days post-inoculation (dpi). The results indicated that PEA1-CF had protective, curative, and inactivation activities against CMV infection. The local lesion symptoms were significantly reduced on PEA1-CF-treated tissues when compared with untreated tissues (Figure 2). No symptoms developed on mock-treated plants. The inactivation activity of PEA1-CF showed promising results, with the highest inhibitory effect (97.56%). Moreover, the curative and protective activities exhibited inhibition rates of 72.88% and 55.88%, respectively. Consequently, the obtained results indicated that PEA1-CF possessed different inhibitory activities against CMV infection. The protection application of B. amyloliquefaciens on Nicotiana benthamiana decreased CMV severity and reduced viral accumulation levels in the treated leaves [64].
Compared with the control at 5 dpi, the change in transcriptional levels of CMV-CP of PEA1-CF-treated tissues ranged from 2.1- to 8.7-fold, while the change in untreated tissues ranged from 26.9- to 28.3-fold (Figure 3). The inactivation treatment of PEA1-CF-treated tissues exhibited the most considerable reduction of CMV-CP accumulation levels (2.1-fold), while untreated plants exhibited a 26.9-fold higher change than the control (Figure 3). Additionally, PEA1-CF-treated leaves of curative and protective assays showed CMV-CP accumulation levels of 8.7- and 12.7-fold, respectively, while untreated leaves showed a 28.3- and 27.9-fold change, respectively, higher than the control (Figure 3). Thus, the reduction in accumulation levels of CMV-CP induced by PEA1-CF treatments proved the efficiency of PEA1 against CMV. These results indicated that PEA1-CF had inhibitory activity against CMV infection. Besides the direct inactivation and inhibition of CMV replication, the protective and curative treatment results suggested that PEA1-CF activates the ISR of D. stramonium plants against CMV infection. ISR and systemic acquired resistance (SAR) are the two major resistance pathways in plants [65]. PAL and POD could be an indicator for the ISR pathway, while pathogenesis-related protein genes belong to the SAR pathway [66,67], and PR-1 is a regulator for both the ISR and SAR pathways. Both pathways contribute to plant viral resistance [68,69].

3.4. Effect of PEA1-CF on the Transcriptional Levels of Defense-Related Genes

Besides the impact of PEA1-CF on the accumulation levels of CMV-CP, the relative expression levels of five defense-related genes at 5 dpi were evaluated. In the current study, the PEA1-CF-treated leaves were associated with the upregulation of the PAL, PR-1, POD, CHS, and HQT genes at 5 dpi of CMV. Among secondary metabolites, polyphenolic compounds play essential roles in plant growth development and increasing plant resistance against various abiotic and biotic stresses [70,71]. Recently, their antiviral activities against plant viral diseases were reported [42,72]. Generally, polyphenolic compounds were generated from three pathways: (i) the phenylpropanoid pathway, (ii) the flavonoid pathway, and (iii) the chlorogenic acid pathway [73]. Besides being a key regulator enzyme of the phenylpropanoid pathway that participates in polyphenolic compounds’ production [74], PAL is involved in the regulation of salicylic acid (SA) biosynthesis during SAR in plants [75]. Compared with mock-inoculated plants in the current study, the transcription levels of PAL were significantly upregulated in PEA1-CF-treated leaves with the relative expression levels increased by 2.3-, 5.0-, and 8.2-fold compared with the control for inactivation, protection, and curative treatment, respectively (Figure 4). On the other hand, although untreated tissues showed a decrease in PAL transcripts, with relative expression levels 0.9-, 0.8-, and 0.9-fold lower than the control in protection, curative, and inactivation treatments, respectively, no significant difference was reported with the control (Figure 4). Many studies observed that viral infection was linked with the downregulation of PAL activity [42,76]. Consequently, the treatment of D. stramonium plants with PEA1-CF in protection, curative, and inactivation treatments triggered the expression of PAL, which might increase SA accumulation. These results suggested that PEA1-CF can lead to ISR and may play a significant role in SAR activation against CMV infection. Lee and Ryu [64] demonstrated that the foliar application of Bacillus spp. mediated ISR against CMV in peppers.
The overexpression of HQT, a key enzyme of chlorogenic acid (CGA) biosynthesis, increases CGA accumulation levels inside plant tissues [77]. Moreover, it catalyzes caffeoyl-CoA and quinic acid to form CGA [42,77]. Like the PAL expression profile, CMV challenge decreased HQT transcripts of untreated tissues, with relative expression levels of 0.6-, 0.5-, and 0.6-fold lower than the control in protective, curative, and inactivation assays, respectively, no significant difference was reported with the control (Figure 4). Notably, PEA1-CF-treated leaves showed the highest expression levels of HQT among tested genes when compared with the control. The protective treatment exhibited the highest relative expression level (34.5-fold), followed by inactivation treatment with an expression level 22.6-fold higher than the control (Figure 4). Additionally, the upregulation of HQT with a relative transcriptional level of 18.8-fold change was reported for curative treatment (Figure 4). Consequently, PEA1-CF could induce SAR, which may be associated with increasing CGA content; otherwise, CMV infection may suppress CGA biosynthesis inside infected tissues. CGA is one of the most critical polyphenolic compounds and plays a vital role in increasing plant protection against different pathogens, including viruses [76,78,79].
CHS, the first enzyme of the flavonoid pathway, catalyzes the conversion of p-coumaroyl CoA to naringenin chalcones, primary precursors strictly required for flavonoid production in various plant tissues [73,80,81]. Regarding CHS transcripts, both PEA1-CF and CMV challenge triggered the induction of CHS transcription (Figure 2). The untreated leaves challenged with CMV showed significantly different relative expression levels 2.0-, 2.1-, and 2.3-fold higher than the control in protective, curative, and inactivation treatments, respectively (Figure 2). However, the highest upregulation levels of CHS (15.7- and 15.7-fold) were seen in PEA1-CF-treated leaves of protective and inactivation assays, respectively (Figure 2). Moreover, PEA1-CF-treated leaves of the curative assay were also upregulated, with the relative expression levels increased by 14.6-fold in comparison with the control (Figure 2). Consequently, PEA1-CF treatments may have increased the accumulations of many flavonoid compounds.
PR-1, an SA marker gene, is a principal regulator of SAR and could be an indicator of the early defense response in plants [72,82]. Meanwhile, the increasing resistance of many plants was linked to the induction of PR-1 and the accumulation of SA content [42,83,84,85,86]. In the present study, although the untreated D. stramonium tissues challenged with CMV showed a slight increase in PR-1 transcripts with relative expression levels 1.2-, 1.1-, and 1.172-fold higher than the control in protective, curative, and inactivation treatments, respectively, no significant difference was reported when compared with the control (Figure 4). Interestingly, PEA1-CF-treated leaves were associated with significant increases and overexpression of PR-1 (Figure 4). The highest expression level was observed in inactivation treatment, with a relative expression level 5.2-fold greater than the control (Figure 2). Additionally, treated leaves of protective and curative treatments showed significant changed in transcriptional levels of 3.0- and 2.0-fold higher than the control, respectively (Figure 2). Consequently, we suggest that PEA1-CF may contain an elicitor molecule that induces the immune defense system and results in SAR activation. In this context, tomato plants treated with B. amyloliquefaciens exhibiting induction of PR-1 resulted in the development of SAR against tomato yellow leaf curl virus (TYLCV) [49].
POD activity has been associated with the improvement of plant defense against pathogens and could be an alternative producer of reactive oxygen species (ROS) [87,88]. Besides antioxidant and PR genes’ activation as responses to pathogen infection, ROS elevates programmed cell death at cell infection sites [87,89,90,91]. Concerning the POD expression profile, POD was significantly differentially induced in D. stramonium leaves challenged with CMV only or with PEA1-CF and CMV together in different assays (Figure 4). The obtained results indicated that CMV triggered a POD transcript with relative expression levels 2.4-, 2.54-, and 2.54-fold higher than the control in protective, curative, and inactivation treatments, respectively (Figure 4). On the other hand, PEA-CF treatments were more enhanced and showed overexpression of POD when compared with the control treatment. The highest relative expression level (10.7-fold) was noticed for curative treatment, followed by 7.7-fold for inactivation treatment and 3.1-fold for protective treatment (Figure 4). The overexpression of POD increased the chlorophyll content inside tissues and enhanced plant resistance against the mungbean yellow mosaic virus and TMV [92,93]. Thus, the application of PEA1-CF can enhance SAR by releasing ROS, resulting in the stimulation of PR-1 expression. Recently, Guo et al. [49] reported that B. amyloliquefaciens Ba13 improved tomato systemic resistance against TYLCV and higher increased expression levels of POD, PPO, PAL, and PR-1. Overall, the results obtained in the current study suggest that PEA1-CF contains secondary metabolites that can play a significant role in SAR.

3.5. Identification of Bioactive Metabolites of PEA1-CF

Generally, microbial biocontrol activities are mediated by their secondary metabolites [46,48]. Besides producing a wide range of secondary metabolites with diverse biological activity [14,15], Bacillus species represent a rich source of secondary metabolites that need to be discovered. Through different activities of its secondary metabolites, many strains of B. velezensis can trigger ISR in plants and suppress microbial pathogen growth [50]. GC–MS, as a robust analytical technique, produces reliable results to assist with the chemical analysis by combining the separation power of GC and the detection power of MS [94,95,96]. In the current study, the bioactive constituents of ethyl acetate extract of PEA1-CF were identified using a mass spectrum of GC–MS. The active detected compounds with their retention time (RT), concentration (peak area %), probability, chemical formula, and molecular weight are given in Table 3. Moreover, the GC–MS histogram and chemical structures of detected compounds are shown in Figure 5. The GC–MS analysis revealed that PEA1-CF contained three bioactive compounds. The first compound, pyrrolo[1, 2-a]pyrazine-1,4-dione, showed the highest concentration at RT of 35.79, while the second compound was 2,5-Piperazinedione,3,6-bis(2-methyl propyl), which appeared at an RT of 41.31 (Figure 5). The last detected compound was pyrrolo[1,2-a]pyrazine-1,4-dione, hexahydro-3 (phenylmethyl), having an RT of 49.64 (Figure 5). Pyrrole, a pyrrolizidines compounds, showed a wide range of bioactivities including antibiotics, antitumor, antifungal, anti-angiogenesis, anti-inflammatory, and cholesterol-reducing [97]. The ethyl acetate extract of culture filtrate of actinomycetes AIA6, which contains pyrrolo[1,2-a] pyrazine-1,4-dione, showed antibacterial and antifungal activities against a wide range of pathogens [98]. Moreover, Bacillus spp. WG4 produced pyrrolo [1,2-a] pyrazine-1,4-dione,hexahydro-3-(phenylmethyl), which provided effective protection to ginger rhizome from Pythium myriotylum and enhanced growth parameters [99]. Additionally, pyrrolo[1,2-a]pyrazine-1,4-dione of Streptomyces spp. exhibited antioxidant [100] and anticandidal [101] activity, while that isolated from Shewanella sp. showed algicidal and anticyanobacterial activity [102]. Furthermore, these compounds had the ability to inhibit HIV-1 viruses, DNA polymerases, and protein kinase activity [103,104] and showed potent protease inhibitor activity with excellent antiretroviral activity [105]. Consequently, our results were in agreement with previous results regarding the antifungal activity of pyrrolo[1,2-a]pyrazine-1,4-dione and pyrrolo [1,2-a] pyrazine-1,4-dione,hexahydro-3-(phenylmethyl), and proved its antiviral activity against plant viral infection. Thus, PEA1 could be useful as a biocontrol agent against F. oxysporum and CMV infections. However, further examinations are needed to confirm potential field applications.

4. Conclusions

We first noticed B. velezensis PEA1 as a novel antiviral agent against plant viruses. Our results suggest that B. velezensis PEA1 contains compounds that penetrate plant cells, play significant roles in SAR by activating gene expression and enzyme activity related to systemic resistance, inhibit infection, and directly inactivate CMV. B. velezensis PEA1 had a strong antifungal effect against F. oxysporum. Overall, B. velezensis PEA1 may be considered a promising source of plant growth promotion, antifungal and antiviral substances for plant protection, and the development of plant-derived compounds for the effective management of plant diseases.

Author Contributions

Conceptualization, A.A., S.I.B., and A.A.A.-A.; methodology, A.A.; software, A.A.; formal analysis, A.A.; investigation, A.A. and S.I.B.; writing—original draft preparation, A.A.; writing—review and editing, A.A.A.-A.; funding acquisition, A.A.A.-A. All authors have read and agreed to the published version of the manuscript.

Funding

The authors extend their appreciation to the Deanship of Scientific Research at King Saud University for funding the work through the research group project (RGP-1440-094).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Abdelkhalek, A.; Hafez, E. Plant Viral Diseases in Egypt and Their Control. In Cottage Industry of Biocontrol Agents and Their Applications; Springer: Berlin, Germany, 2020; pp. 403–421. [Google Scholar]
  2. Nicaise, V. Crop immunity against viruses: Outcomes and future challenges. Front. Plant Sci. 2014, 5, 660. [Google Scholar] [CrossRef]
  3. Hančinský, R.; Mihálik, D.; Mrkvová, M.; Candresse, T.; Glasa, M. Plant Viruses Infecting Solanaceae Family Members in the Cultivated and Wild Environments: A Review. Plants 2020, 9, 667. [Google Scholar]
  4. Lamichhane, J.R.; Dürr, C.; Schwanck, A.A.; Robin, M.-H.; Sarthou, J.-P.; Cellier, V.; Messéan, A.; Aubertot, J.-N. Integrated management of damping-off diseases. A review. Agron. Sustain. Dev. 2017, 37, 10. [Google Scholar] [CrossRef]
  5. Saremi, H.; Okhovvat, S.M.; Ashrafi, S.J. Fusarium diseases as the main soil borne fungal pathogen on plants and their control management with soil solarization in Iran. Afr. J. Biotechnol. 2011, 10, 18391–18398. [Google Scholar] [CrossRef]
  6. Da Silva, J.C.; Bettiol, W. Potential of non-pathogenic Fusarium oxysporum isolates for control of Fusarium wilt of tomato. Fitopatol. Bras. 2005, 30, 409–412. [Google Scholar] [CrossRef] [Green Version]
  7. Scholthof, K.G.; Adkins, S.; Czosnek, H.; Palukaitis, P.; Jacquot, E.; Hohn, T.; Hohn, B.; Saunders, K.; Candresse, T.; Ahlquist, P. Top 10 plant viruses in molecular plant pathology. Mol. Plant Pathol. 2011, 12, 938–954. [Google Scholar] [CrossRef] [PubMed]
  8. Mochizuki, T.; Ohki, S.T. Cucumber mosaic virus: Viral genes as virulence determinants. Mol. Plant Pathol. 2012, 13, 217–225. [Google Scholar] [CrossRef] [PubMed]
  9. Murphy, J.F.; Reddy, M.S.; Ryu, C.-M.; Kloepper, J.W.; Li, R. Rhizobacteria-mediated growth promotion of tomato leads to protection against Cucumber mosaic virus. Phytopathology 2003, 93, 1301–1307. [Google Scholar] [CrossRef] [Green Version]
  10. Gray, E.J.; Smith, D.L. Intracellular and extracellular PGPR: Commonalities and distinctions in the plant–bacterium signaling processes. Soil Biol. Biochem. 2005, 37, 395–412. [Google Scholar] [CrossRef]
  11. Kandan, A.; Ramiah, M.; Vasanthi, V.J.; Radjacommare, R.; Nandakumar, R.; Ramanathan, A.; Samiyappan, R. Use of Pseudomonas fluorescens-based formulations for management of tomato spotted wilt virus (TSWV) and enhanced yield in tomato. Biocontrol Sci. Technol. 2005, 15, 553–569. [Google Scholar] [CrossRef]
  12. Ahmad, A.-G.M.; Attia, A.-Z.G.; Mohamed, M.S.; Elsayed, H.E. Fermentation, formulation and evaluation of PGPR Bacillus subtilis isolate as a bioagent for reducing occurrence of peanut soil-borne diseases. J. Integr. Agric. 2019, 18, 2080–2092. [Google Scholar] [CrossRef]
  13. Fira, D.; Dimkić, I.; Berić, T.; Lozo, J.; Stanković, S. Biological control of plant pathogens by Bacillus species. J. Biotechnol. 2018, 285, 44–55. [Google Scholar] [CrossRef] [PubMed]
  14. Stein, T. Bacillus subtilis antibiotics: Structures, syntheses and specific functions. Mol. Microbiol. 2005, 56, 845–857. [Google Scholar] [CrossRef] [PubMed]
  15. Sansinenea, E.; Ortiz, A. Secondary metabolites of soil Bacillus spp. Biotechnol. Lett. 2011, 33, 1523–1538. [Google Scholar] [CrossRef] [PubMed]
  16. Shoman, S.A.; Abd-Allah, N.A.; El-Baz, A.F. Induction of resistance to Tobacco necrosis virus in bean plants by certain microbial isolates. Egypt. J. Biol. 2003, 5, 10–18. [Google Scholar]
  17. Zhong, Y.; Peng, J.; Chen, Z.; Xie, H.; Luo, D.; Dai, J.; Yan, F.; Wang, J.; Dong, H.; Chen, S. Dry mycelium of Penicillium chrysogenum activates defense responses and restricts the spread of Tobacco Mosaic Virus in tobacco. Physiol. Mol. Plant Pathol. 2015, 92, 28–37. [Google Scholar] [CrossRef]
  18. Rahman, A.; Uddin, W.; Wenner, N.G. Induced systemic resistance responses in perennial ryegrass against Magnaporthe oryzae elicited by semi-purified surfactin lipopeptides and live cells of Bacillus amyloliquefaciens. Mol. Plant Pathol. 2015, 16, 546–558. [Google Scholar] [CrossRef]
  19. Murphy, J.F.; Zehnder, G.W.; Schuster, D.J.; Sikora, E.J.; Polston, J.E.; Kloepper, J.W. Plant growth-promoting rhizobacterial mediated protection in tomato against Tomato mottle virus. Plant Dis. 2000, 84, 779–784. [Google Scholar] [CrossRef] [Green Version]
  20. El-Borollosy, A.M.; Oraby, M.M. Induced systemic resistance against Cucumber mosaic cucumovirus and promotion of cucumber growth by some plant growth-promoting rhizobacteria. Ann. Agric. Sci. 2012, 57, 91–97. [Google Scholar] [CrossRef] [Green Version]
  21. Park, K.; Paul, D.; Ryu, K.R.; Kim, E.Y.; Kim, Y.K. Bacillus vallismortis strain EXTN-1 mediated systemic resistance against potato virus Y and X in the field. Plant Pathol. J. 2006, 22, 360. [Google Scholar] [CrossRef] [Green Version]
  22. Zehnder, G.W.; Yao, C.; Murphy, J.F.; Sikora, E.R.; Kloepper, J.W. Induction of resistance in tomato against cucumber mosaic cucumovirus by plant growth-promoting rhizobacteria. Biocontrol 2000, 45, 127–137. [Google Scholar] [CrossRef]
  23. Wang, S.; Wu, H.; Qiao, J.; Ma, L.; Liu, J.; Xia, Y.; Gao, X. Molecular mechanism of plant growth promotion and induced systemic resistance to tobacco mosaic virus by Bacillus spp. J. Microbiol. Biotechnol. 2009, 19, 1250–1258. [Google Scholar] [CrossRef] [PubMed]
  24. Wang, C.; Zhao, D.; Qi, G.; Mao, Z.; Hu, X.; Du, B.; Liu, K.; Ding, Y. Effects of Bacillus velezensis FKM10 for Promoting the Growth of Malus hupehensis Rehd. and Inhibiting Fusarium verticillioides. Front. Microbiol. 2020, 10, 2889. [Google Scholar] [CrossRef] [PubMed]
  25. Ruiz-Garcia, C.; Bejar, V.; Martinez-Checa, F.; Llamas, I.; Quesada, E. Bacillus velezensis sp. nov., a surfactant-producing bacterium isolated from the river Velez in Malaga, southern Spain. Int. J. Syst. Evol. Microbiol. 2005, 55, 191–195. [Google Scholar] [CrossRef] [Green Version]
  26. Chowdhury, S.P.; Dietel, K.; Rändler, M.; Schmid, M.; Junge, H.; Borriss, R.; Hartmann, A.; Grosch, R. Effects of Bacillus amyloliquefaciens FZB42 on lettuce growth and health under pathogen pressure and its impact on the rhizosphere bacterial community. PLoS ONE 2013, 8, e68818. [Google Scholar] [CrossRef] [Green Version]
  27. Xu, T.; Zhu, T.; Li, S. β-1, 3-1, 4-glucanase gene from Bacillus velezensis ZJ20 exerts antifungal effect on plant pathogenic fungi. World J. Microbiol. Biotechnol. 2016, 32, 26. [Google Scholar] [CrossRef]
  28. Cao, Y.; Pi, H.; Chandrangsu, P.; Li, Y.; Wang, Y.; Zhou, H.; Xiong, H.; Helmann, J.D.; Cai, Y. Antagonism of two plant-growth promoting Bacillus velezensis isolates against Ralstonia solanacearum and Fusarium oxysporum. Sci. Rep. 2018, 8, 1–14. [Google Scholar] [CrossRef]
  29. Chen, L.; Shi, H.; Heng, J.; Wang, D.; Bian, K. Antimicrobial, plant growth-promoting and genomic properties of the peanut endophyte Bacillus velezensis LDO2. Microbiol. Res. 2019, 218, 41–48. [Google Scholar] [CrossRef]
  30. Clark, M.F.; Adams, A.N. Characteristics of the microplate method of enzyme linked immunosorbent assay for the detection of plant viruses. J. Gen. Virol. 1977, 34, 475–483. [Google Scholar] [CrossRef]
  31. Hafez, E.E.; El-Morsi, A.A.; El-Shahaby, O.A.; Abdelkhalek, A.A. Occurrence of iris yellow spot virus from onion crops in Egypt. VirusDisease 2014, 25, 455–459. [Google Scholar] [CrossRef] [Green Version]
  32. Booth, C. The Genus Fusarium; International Mycological Institute: Kew Surrey, UK, 1971; p. 237. [Google Scholar]
  33. Leslie, J.F.; Summerell, B.A. The Fusarium Laboratory Manual; John Wiley & Sons: Hoboken, NJ, USA, 2008; ISBN 0470276460. [Google Scholar]
  34. Geiser, D.M.; del Mar Jiménez-Gasco, M.; Kang, S.; Makalowska, I.; Veeraraghavan, N.; Ward, T.J.; Zhang, N.; Kuldau, G.A.; O’donnell, K. FUSARIUM-ID v. 1.0: A DNA sequence database for identifying Fusarium. Eur. J. Plant Pathol. 2004, 110, 473–479. [Google Scholar] [CrossRef]
  35. Kadyan, S.; Panghal, M.; Singh, K.; Yadav, J.P. Development of a PCR based marker system for easy identification and classification of aerobic endospore forming bacilli. Springerplus 2013, 2, 596. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Kubo, S.; Ikeda, T.; Imaizumi, S.; Takanami, Y.; Mikami, Y. A potent plant virus inhibitor found in Mirabilis jalapa L. Jpn. J. Phytopathol. 1990, 56, 481–487. [Google Scholar] [CrossRef]
  37. Abdelkhalek, A.; Al-Askar, A.A. Green Synthesized ZnO Nanoparticles Mediated by Mentha Spicata Extract Induce Plant Systemic Resistance against Tobacco Mosaic Virus. Appl. Sci. 2020, 10, 5054. [Google Scholar] [CrossRef]
  38. Abdelkhalek, A.; Ismail, I.A.; Dessoky, E.S.; El-Hallous, E.I.; Hafez, E. A tomato kinesin-like protein is associated with Tobacco mosaic virus infection. Biotechnol. Biotechnol. Equip. 2019, 33, 1424–1433. [Google Scholar] [CrossRef] [Green Version]
  39. Abdelkhalek, A. Expression of tomato pathogenesis related genes in response to Tobacco mosaic virus. JAPS J. Anim. Plant Sci. 2019, 29, 1596–1602. [Google Scholar]
  40. Abdelkhalek, A.; Qari, S.H.; Hafez, E. Iris yellow spot virus–induced chloroplast malformation results in male sterility. J. Biosci. 2019, 44, 142. [Google Scholar] [CrossRef]
  41. Behiry, S.I.; Ashmawy, N.A.; Abdelkhalek, A.A.; Younes, H.A.; Khaled, A.E.; Hafez, E.E. Compatible- and incompatible-type interactions related to defense genes in potato elucidation by Pectobacterium carotovorum. J. Plant Dis. Prot. 2018, 125, 197–204. [Google Scholar] [CrossRef]
  42. Abdelkhalek, A.; Al-Askar, A.A.; Hafez, E. Differential induction and suppression of the potato innate immune system in response to Alfalfa mosaic virus infection. Physiol. Mol. Plant Pathol. 2020, 110, 101485. [Google Scholar] [CrossRef]
  43. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  44. Ahmed, A.A. Production of antimicrobial agent by Streptomyces violachromogenes. Saudi J. Biol. Sci. 2007, 14, 7–16. [Google Scholar]
  45. Jaffuel, G.; Imperiali, N.; Shelby, K.; Campos-Herrera, R.; Geisert, R.; Maurhofer, M.; Loper, J.; Keel, C.; Turlings, T.C.J.; Hibbard, B.E. Protecting maize from rootworm damage with the combined application of arbuscular mycorrhizal fungi, Pseudomonas bacteria and Entomopathogenic nematodes. Sci. Rep. 2019, 9, 1–12. [Google Scholar] [CrossRef] [PubMed]
  46. Pal, K.K.; Tilak, K.; Saxena, A.K.; Dey, R.; Singh, C.S. Antifungal characteristics of a fluorescent Pseudomonas strain involved in the biological control of Rhizoctonia solani. Microbiol. Res. 2000, 155, 233–242. [Google Scholar] [CrossRef]
  47. Ongena, M.; Jacques, P. Bacillus lipopeptides: Versatile weapons for plant disease biocontrol. Trends Microbiol. 2008, 16, 115–125. [Google Scholar] [CrossRef] [PubMed]
  48. Nguyen, P.-A.; Strub, C.; Fontana, A.; Schorr-Galindo, S. Crop molds and mycotoxins: Alternative management using biocontrol. Biol. Control 2017, 104, 10–27. [Google Scholar] [CrossRef]
  49. Guo, Q.; Li, Y.; Lou, Y.; Shi, M.; Jiang, Y.; Zhou, J.; Sun, Y.; Xue, Q.; Lai, H. Bacillus amyloliquefaciens Ba13 induces plant systemic resistance and improves rhizosphere microecology against tomato yellow leaf curl virus disease. Appl. Soil Ecol. 2019, 137, 154–166. [Google Scholar] [CrossRef]
  50. Rabbee, M.F.; Ali, M.; Choi, J.; Hwang, B.S.; Jeong, S.C.; Baek, K. Bacillus velezensis: A valuable member of bioactive molecules within plant microbiomes. Molecules 2019, 24, 1046. [Google Scholar] [CrossRef] [Green Version]
  51. Jiang, C.-H.; Liao, M.-J.; Wang, H.-K.; Zheng, M.-Z.; Xu, J.-J.; Guo, J.-H. Bacillus velezensis, a potential and efficient biocontrol agent in control of pepper gray mold caused by Botrytis cinerea. Biol. Control 2018, 126, 147–157. [Google Scholar] [CrossRef]
  52. Gordon, T.R.; Martyn, R.D. The evolutionary biology of Fusarium oxysporum. Annu. Rev. Phytopathol. 1997, 35, 111–128. [Google Scholar] [CrossRef] [Green Version]
  53. Chittem, K.; Mathew, F.M.; Gregoire, M.; Lamppa, R.S.; Chang, Y.W.; Markell, S.G.; Bradley, C.A.; Barasubiye, T.; Goswami, R.S. Identification and characterization of Fusarium spp. associated with root rots of field pea in North Dakota. Eur. J. Plant Pathol. 2015, 143, 641–649. [Google Scholar] [CrossRef]
  54. Hwang, S.F.; Chang, K.F. Incidence and severity of root rot disease complex of field pea in northeastern Alberta in 1988. Can. Plant Dis. Surv. 1989, 69, 139–141. [Google Scholar]
  55. Persson, L.; Bødker, L.; Larsson-Wikström, M. Prevalence and pathogenicity of foot and root rot pathogens of pea in Southern Scandinavia. Plant Dis. 1997, 81, 171–174. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  56. Skovgaard, K.; Bødker, L.; Rosendahl, S. Population structure and pathogenicity of members of the Fusarium oxysporum complex isolated from soil and root necrosis of pea (Pisum sativum L.). FEMS Microbiol. Ecol. 2002, 42, 367–374. [Google Scholar] [CrossRef] [PubMed]
  57. Chen, X.H.; Koumoutsi, A.; Scholz, R.; Eisenreich, A.; Schneider, K.; Heinemeyer, I.; Morgenstern, B.; Voss, B.; Hess, W.R.; Reva, O. Comparative analysis of the complete genome sequence of the plant growth–promoting bacterium Bacillus amyloliquefaciens FZB42. Nat. Biotechnol. 2007, 25, 1007–1014. [Google Scholar] [CrossRef] [Green Version]
  58. Meng, Q.; Jiang, H.; Hao, J.J. Effects of Bacillus velezensis strain BAC03 in promoting plant growth. Biol. Control 2016, 98, 18–26. [Google Scholar] [CrossRef]
  59. Kim, S.Y.; Song, H.; Sang, M.K.; Weon, H.-Y.; Song, J. The complete genome sequence of Bacillus velezensis strain GH1-13 reveals agriculturally beneficial properties and a unique plasmid. J. Biotechnol. 2017, 259, 221–227. [Google Scholar] [CrossRef]
  60. Adeniji, A.A.; Loots, D.T.; Babalola, O.O. Bacillus velezensis: Phylogeny, useful applications, and avenues for exploitation. Appl. Microbiol. Biotechnol. 2019, 103, 3669–3682. [Google Scholar] [CrossRef]
  61. Chowdhury, S.P.; Hartmann, A.; Gao, X.; Borriss, R. Biocontrol mechanism by root-associated Bacillus amyloliquefaciens FZB42–a review. Front. Microbiol. 2015, 6, 780. [Google Scholar] [CrossRef] [Green Version]
  62. Kröber, M.; Wibberg, D.; Grosch, R.; Eikmeyer, F.; Verwaaijen, B.; Chowdhury, S.P.; Hartmann, A.; Pühler, A.; Schlüter, A. Effect of the strain Bacillus amyloliquefaciens FZB42 on the microbial community in the rhizosphere of lettuce under field conditions analyzed by whole metagenome sequencing. Front. Microbiol. 2014, 5, 252. [Google Scholar]
  63. Chen, L.; Heng, J.; Qin, S.; Bian, K. A comprehensive understanding of the biocontrol potential of Bacillus velezensis LM2303 against Fusarium head blight. PLoS ONE 2018, 13, e0198560. [Google Scholar] [CrossRef] [Green Version]
  64. Lee, G.H.; Ryu, C.-M. Spraying of leaf-colonizing Bacillus amyloliquefaciens protects pepper from Cucumber mosaic virus. Plant Dis. 2016, 100, 2099–2105. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  65. Pieterse, C.M.J.; Zamioudis, C.; Berendsen, R.L.; Weller, D.M.; Van Wees, S.C.M.; Bakker, P.A.H.M. Induced systemic resistance by beneficial microbes. Annu. Rev. Phytopathol. 2014, 52, 347–375. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  66. Van Loon, L.C.; Rep, M.; Pieterse, C.M.J. Significance of inducible defense-related proteins in infected plants. Annu. Rev. Phytopathol. 2006, 44, 135–162. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  67. Shoresh, M.; Yedidia, I.; Chet, I. Involvement of jasmonic acid/ethylene signaling pathway in the systemic resistance induced in cucumber by Trichoderma asperellum T203. Phytopathology 2005, 95, 76–84. [Google Scholar] [CrossRef] [Green Version]
  68. Alazem, M.; Lin, N. Roles of plant hormones in the regulation of host–virus interactions. Mol. Plant Pathol. 2015, 16, 529–540. [Google Scholar] [CrossRef]
  69. Shang, J.; Xi, D.-H.; Xu, F.; Wang, S.-D.; Cao, S.; Xu, M.-Y.; Zhao, P.-P.; Wang, J.-H.; Jia, S.-D.; Zhang, Z.-W. A broad-spectrum, efficient and nontransgenic approach to control plant viruses by application of salicylic acid and jasmonic acid. Planta 2011, 233, 299–308. [Google Scholar] [CrossRef]
  70. Mierziak, J.; Kostyn, K.; Kulma, A. Flavonoids as important molecules of plant interactions with the environment. Molecules 2014, 19, 16240–16265. [Google Scholar] [CrossRef]
  71. Akyol, H.; Riciputi, Y.; Capanoglu, E.; Caboni, M.; Verardo, V. Phenolic compounds in the potato and its byproducts: An overview. Int. J. Mol. Sci. 2016, 17, 835. [Google Scholar] [CrossRef]
  72. Abdelkhalek, A.; Salem, M.Z.M.; Ali, H.M.; Kordy, A.M.; Salem, A.Z.M.; Behiry, S.I. Antiviral, antifungal, and insecticidal activities of Eucalyptus bark extract: HPLC analysis of polyphenolic compounds. Microb. Pathog. 2020, 147, 104383. [Google Scholar] [CrossRef]
  73. André, C.M.; Schafleitner, R.; Legay, S.; Lefèvre, I.; Aliaga, C.A.A.; Nomberto, G.; Hoffmann, L.; Hausman, J.-F.; Larondelle, Y.; Evers, D. Gene expression changes related to the production of phenolic compounds in potato tubers grown under drought stress. Phytochemistry 2009, 70, 1107–1116. [Google Scholar] [CrossRef]
  74. Huang, J.; Gu, M.; Lai, Z.; Fan, B.; Shi, K.; Zhou, Y.-H.; Yu, J.-Q.; Chen, Z. Functional analysis of the Arabidopsis PAL gene family in plant growth, development, and response to environmental stress. Plant Physiol. 2010, 153, 1526–1538. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  75. Su, H.; Song, S.; Yan, X.; Fang, L.; Zeng, B.; Zhu, Y. Endogenous salicylic acid shows different correlation with baicalin and baicalein in the medicinal plant Scutellaria baicalensis Georgi subjected to stress and exogenous salicylic acid. PLoS ONE 2018, 13, e0192114. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  76. Abdelkhalek, A.; Dessoky, E.S.; Hafez, E. Polyphenolic genes expression pattern and their role in viral resistance in tomato plant infected with Tobacco mosaic virus. Biosci. Res. 2018, 15, 3349–3356. [Google Scholar]
  77. Niggeweg, R.; Michael, A.J.; Martin, C. Engineering plants with increased levels of the antioxidant chlorogenic acid. Nat. Biotechnol. 2004, 22, 746. [Google Scholar] [CrossRef] [PubMed]
  78. Tsao, R.; Marvin, C.H.; Broadbent, A.B.; Friesen, M.; Allen, W.R.; Mcgarvey, B.D. Evidence for an isobutylamide associated with host-plant resistance to western flower thrips, Frankliniella occidentalis, in chrysanthemum. J. Chem. Ecol. 2005, 31, 103–110. [Google Scholar] [CrossRef] [PubMed]
  79. Leiss, K.A.; Maltese, F.; Choi, Y.H.; Verpoorte, R.; Klinkhamer, P.G.L. Identification of chlorogenic acid as a resistance factor for thrips in chrysanthemum. Plant Physiol. 2009, 150, 1567–1575. [Google Scholar] [CrossRef] [Green Version]
  80. Marais, J.P.J.; Deavours, B.; Dixon, R.A.; Ferreira, D. The stereochemistry of flavonoids. In The Science of Flavonoids; Springer: Berlin, Germany, 2006; pp. 1–46. [Google Scholar]
  81. Kang, J.-H.; McRoberts, J.; Shi, F.; Moreno, J.E.; Jones, A.D.; Howe, G.A. The flavonoid biosynthetic enzyme chalcone isomerase modulates terpenoid production in glandular trichomes of tomato. Plant Physiol. 2014, 164, 1161–1174. [Google Scholar] [CrossRef] [Green Version]
  82. Hoegen, E.; Strömberg, A.; Pihlgren, U.; Kombrink, E. Primary structure and tissue-specific expression of the pathogenesis-related protein PR-1b in potato. Mol. Plant Pathol. 2002, 3, 329–345. [Google Scholar] [CrossRef]
  83. Pellegrini, L.; Rohfritsch, O.; Fritig, B.; Legrand, M. Phenylalanine ammonia-lyase in tobacco (molecular cloning and gene expression during the hypersensitive reaction to tobacco mosaic virus and the response to a fungal elicitor). Plant Physiol. 1994, 106, 877–886. [Google Scholar] [CrossRef] [Green Version]
  84. Mauch-Mani, B.; Slusarenko, A.J. Production of salicylic acid precursors is a major function of phenylalanine ammonia-lyase in the resistance of Arabidopsis to Peronospora parasitica. Plant Cell 1996, 8, 203–212. [Google Scholar] [CrossRef]
  85. Dempsey, D.A.; Shah, J.; Klessig, D.F. Salicylic acid and disease resistance in plants. CRC Crit. Rev. Plant Sci. 1999, 18, 547–575. [Google Scholar] [CrossRef]
  86. Nawrath, C.; Métraux, J.-P. Salicylic acid induction–deficient mutants of Arabidopsis express PR-2 and PR-5 and accumulate high levels of camalexin after pathogen inoculation. Plant Cell 1999, 11, 1393–1404. [Google Scholar] [PubMed] [Green Version]
  87. Apel, K.; Hirt, H. Reactive oxygen species: Metabolism, oxidative stress, and signal transduction. Annu. Rev. Plant Biol. 2004, 55, 373–399. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  88. Bindschedler, L.V.; Dewdney, J.; Blee, K.A.; Stone, J.M.; Asai, T.; Plotnikov, J.; Denoux, C.; Hayes, T.; Gerrish, C.; Davies, D.R. Peroxidase-dependent apoplastic oxidative burst in Arabidopsis required for pathogen resistance. Plant J. 2006, 47, 851–863. [Google Scholar] [CrossRef] [Green Version]
  89. Chamnongpol, S.; Willekens, H.; Moeder, W.; Langebartels, C.; Sandermann, H.; Van Montagu, M.; Inzé, D.; Van Camp, W. Defense activation and enhanced pathogen tolerance induced by H2O2 in transgenic tobacco. Proc. Natl. Acad. Sci. USA 1998, 95, 5818–5823. [Google Scholar] [CrossRef] [Green Version]
  90. Wu, G.; Shortt, B.J.; Lawrence, E.B.; Leon, J.; Fitzsimmons, K.C.; Levine, E.B.; Raskin, I.; Shah, D.M. Activation of host defense mechanisms by elevated production of H2O2 in transgenic plants. Plant Physiol. 1997, 115, 427–435. [Google Scholar] [CrossRef] [Green Version]
  91. Han, Y.; Luo, Y.; Qin, S.; Xi, L.; Wan, B.; Du, L. Induction of systemic resistance against tobacco mosaic virus by Ningnanmycin in tobacco. Pestic. Biochem. Physiol. 2014, 111, 14–18. [Google Scholar] [CrossRef]
  92. Venkatesan, S.; Radjacommare, R.; Nakkeeran, S.; Chandrasekaran, A. Effect of biocontrol agent, plant extracts and safe chemicals in suppression of mungbean yellow mosaic virus (MYMV) in black gram (Vigna mungo). Arch. Phytopathol. Plant Prot. 2010, 43, 59–72. [Google Scholar] [CrossRef]
  93. Li, Z.; Shi, J.; Hu, D.; Song, B. A polysaccharide found in Dendrobium nobile Lindl stimulates calcium signaling pathway and enhances tobacco defense against TMV. Int. J. Biol. Macromol. 2019, 137, 1286–1297. [Google Scholar] [CrossRef]
  94. Pollak, F.C.; Berger, R.G. Geosmin and Related Volatiles in Bioreactor-Cultured Streptomyces citreus CBS 109.60. Appl. Environ. Microbiol. 1996, 62, 1295–1299. [Google Scholar] [CrossRef] [Green Version]
  95. Sudha, S.; Masilamani, S.M. Characterization of cytotoxic compound from marine sediment derived actinomycete Streptomyces avidinii strain SU4. Asian Pac. J. Trop. Biomed. 2012, 2, 770–773. [Google Scholar] [CrossRef] [Green Version]
  96. Jog, R.; Pandya, M.; Nareshkumar, G.; Rajkumar, S. Mechanism of phosphate solubilization and antifungal activity of Streptomyces spp. isolated from wheat roots and rhizosphere and their application in improving plant growth. Microbiology 2014, 160, 778–788. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  97. Bhardwaj, V.; Gumber, D.; Abbot, V.; Dhiman, S.; Sharma, P. Pyrrole: A resourceful small molecule in key medicinal hetero-aromatics. RSC Adv. 2015, 5, 15233–15266. [Google Scholar] [CrossRef]
  98. Kumari, N.; Menghani, E.; Mithal, R. GCMS analysis of compounds extracted from actinomycetes AIA6 isolates and study of its antimicrobial efficacy. Indian J. Chem. Technol. 2019, 26, 362–370. [Google Scholar]
  99. Jimtha, J.C.; Jishma, P.; Arathy, G.B.; Anisha, C.; Radhakrishnan, E.K. Identification of plant growth promoting Rhizosphere Bacillus sp. WG4 antagonistic to Pythium myriotylum and its enhanced antifungal effect in association with Trichoderma. J. Soil Sci. Plant Nutr. 2016, 16, 578–590. [Google Scholar] [CrossRef]
  100. Ser, H.-L.; Palanisamy, U.D.; Yin, W.-F.; Abd Malek, S.N.; Chan, K.-G.; Goh, B.-H.; Lee, L.-H. Presence of antioxidative agent, Pyrrolo [1, 2-a] pyrazine-1, 4-dione, hexahydro-in newly isolated Streptomyces mangrovisoli sp. nov. Front. Microbiol. 2015, 6, 854. [Google Scholar] [CrossRef] [Green Version]
  101. Sanjenbam, P.; Gopal, J.V.; Kannabiran, K. Isolation and identification of anticandidal compound from Streptomyces sp. VITPK9. Appl. Biochem. Microbiol. 2014, 50, 492–499. [Google Scholar] [CrossRef]
  102. Li, Z.; Geng, M.; Yang, H. Algicidal activity of Bacillus sp. Lzh-5 and its algicidal compounds against Microcystis aeruginosa. Appl. Microbiol. Biotechnol. 2015, 99, 981–990. [Google Scholar] [CrossRef]
  103. Wurz, R.P.; Charette, A.B. Doubly activated cyclopropanes as synthetic precursors for the preparation of 4-nitro-and 4-cyano-dihydropyrroles and pyrroles. Org. Lett. 2005, 7, 2313–2316. [Google Scholar] [CrossRef]
  104. Piliego, C.; Holcombe, T.W.; Douglas, J.D.; Woo, C.H.; Beaujuge, P.M.; Fréchet, J.M.J. Synthetic control of structural order in N-alkylthieno [3, 4-c] pyrrole-4, 6-dione-based polymers for efficient solar cells. J. Am. Chem. Soc. 2010, 132, 7595–7597. [Google Scholar] [CrossRef]
  105. Pooja, S.; Aditi, T.; Naine, S.J.; Devi, C.S. Bioactive compounds from marine Streptomyces sp. VITPSA as therapeutics. Front. Biol. 2017, 12, 280–289. [Google Scholar] [CrossRef]
Agronomy 10 01312 g001 550
Figure 1. (A) Symptomatic field pea roots; (B) Fusarium oxysporum control; (C) Bacillus velezensis PEA1 against F. oxysporum.
Figure 1. (A) Symptomatic field pea roots; (B) Fusarium oxysporum control; (C) Bacillus velezensis PEA1 against F. oxysporum.
Agronomy 10 01312 g001
Agronomy 10 01312 g002 550
Figure 2. Comparison of (A) protective, (B) curative, and (C) inactivating activities of PEA1-culture filtrate (CF) against cucumber mosaic virus (CMV) in D. stramonium leaves. All the left sides of the leaves were inoculated with CMV without any treatments and the right sides treated with the PEA1-CF.
Figure 2. Comparison of (A) protective, (B) curative, and (C) inactivating activities of PEA1-culture filtrate (CF) against cucumber mosaic virus (CMV) in D. stramonium leaves. All the left sides of the leaves were inoculated with CMV without any treatments and the right sides treated with the PEA1-CF.
Agronomy 10 01312 g002
Agronomy 10 01312 g003 550
Figure 3. The relative expression level of CMV-coat protein (CP) at 5 dpi of the protective, curative, and inactivation activities of PEA1-CF treatments compared with untreated D. stramonium leaves. Columns represent mean value from three biological replicates and bars indicate standard deviation (±SD). Significant differences between samples were determined by one-way analysis of variance (ANOVA) using CoStat software. Means were separated by least significant difference (LSD) test at p ≤ 0.05 levels and indicated by small letters. Columns with the same letter do not differ significantly.
Figure 3. The relative expression level of CMV-coat protein (CP) at 5 dpi of the protective, curative, and inactivation activities of PEA1-CF treatments compared with untreated D. stramonium leaves. Columns represent mean value from three biological replicates and bars indicate standard deviation (±SD). Significant differences between samples were determined by one-way analysis of variance (ANOVA) using CoStat software. Means were separated by least significant difference (LSD) test at p ≤ 0.05 levels and indicated by small letters. Columns with the same letter do not differ significantly.
Agronomy 10 01312 g003
Agronomy 10 01312 g004 550
Figure 4. The relative expression levels of PAL, HQT, CHS, PR-1, and POD at 5 dpi of the protective, curative, and inactivation activities of PEA1-CF treatments compared with untreated D. stramonium leaves. Columns represent mean value from three biological replicates and bars indicate standard deviation (±SD). Significant differences between samples were determined by one-way ANOVA using CoStat software. Means were separated by least significant difference (LSD) test at p ≤ 0.05 levels and indicated by small letters. Columns with the same letter do not differ significantly.
Figure 4. The relative expression levels of PAL, HQT, CHS, PR-1, and POD at 5 dpi of the protective, curative, and inactivation activities of PEA1-CF treatments compared with untreated D. stramonium leaves. Columns represent mean value from three biological replicates and bars indicate standard deviation (±SD). Significant differences between samples were determined by one-way ANOVA using CoStat software. Means were separated by least significant difference (LSD) test at p ≤ 0.05 levels and indicated by small letters. Columns with the same letter do not differ significantly.
Agronomy 10 01312 g004
Agronomy 10 01312 g005 550
Figure 5. Gas chromatography–mass spectrometry (GC–MS) fractionation of ethyl acetate extract of B. velezensis PEA1 culture filtrate.
Figure 5. Gas chromatography–mass spectrometry (GC–MS) fractionation of ethyl acetate extract of B. velezensis PEA1 culture filtrate.
Agronomy 10 01312 g005
Table
Table 1. Nucleotide sequences of gene-specific primers used in this study.
Table 1. Nucleotide sequences of gene-specific primers used in this study.
Primer NameAbbreviationDirectionSequence (5′‒3′)
Phenylalanine ammonia-lyasePALForwardGTTATGCTCTTAGAACGTCGCCC
ReverseCCGTGTAATGCCTTGTTTCTTGA
Chalcone synthaseCHSForwardCACCGTGGAGGAGTATCGTAAGGC
ReverseTGATCAACACAGTTGGAAGGCG
Hydroxycinnamoyl Co A quinate hydroxycinnamoyl transferaseHQTForwardCCCAATGGCTGGAAGATTAGCTA
ReverseCATGAATCACTTTCAGCCTCAACAA
Pathogenesis-related protein 1PR-1ForwardGTCCATACTAATTGAAACGACC
ReverseCCACTTCAGAGGATTACATATA
PeroxidasePODForwardTGGAGGTCCAACATGGCAAGTTCT
ReverseTGCCACATCTTGCCCTTCCAAATG
Beta-actinβ-actinForwardGGGTTTGCTGGAGATGATGCT
ReverseGCTTCGTCACCAACATATGCAT
Cucumber mosaic virus-movement proteinCMV-MPForwardATGGCTTTCCAAGGTACCATG
ReverseTCTGTTGAAAGGCAGTACTAG
Cucumber mosaic virus-coat proteinCMV-CPForwardGTAGACATCTGTGACGCGATGCCG
ReverseTCGCGGAGAAGCATCCATGAGAAAG
18S ribosomal RNA18S rRNAForwardGTAGTCATATGCTTGTCTC
ReverseCTTCCGTCAATTCCTTTAAG
16S ribosomal RNA16S rRNAForwardAGAGTTTGATCCTGGCTCAG
ReverseGGTTACCTTGTTACGACTT
Table
Table 2. Morphological, physiological, and biochemical characteristics of Bacillus velezensis PEA1.
Table 2. Morphological, physiological, and biochemical characteristics of Bacillus velezensis PEA1.
Characteristics
Bacterial IsolateShape (rods)Gram StainingMotilityAnaerobic GrowthSpore FormationGrowth at 30–55 °COxidaseHydrolysis of Tween 20Hydrolysis of Tween 80Catalase ProductionUrease ProductionGrowth in 7% NaClGrowth on SkimMed MilkIndole ProductionGelatin DecompositionMelibioseDulcitolArginine DihydrolaseL-alanineD-galacturonic AcidGlycogenLactoseMethyl α-D-GlycosideD-RaffinoseFructoseRaffinoseManitolGalactose
Bacillus velezensis+++++++−−++++−+−−−−−aaaaaaaa
+, ≥81% positive reactions; −, ≤19% positive reactions; a, acid production.
Table
Table 3. The chemical properties of the three compounds of ethyl acetate extract of Bacillus velezensis PEA1 culture filtrate using gas chromatography–mass spectrometry (GC–MS) analysis.
Table 3. The chemical properties of the three compounds of ethyl acetate extract of Bacillus velezensis PEA1 culture filtrate using gas chromatography–mass spectrometry (GC–MS) analysis.
PeakRetention Time (min)Area %Detected CompoundsProbabilityChemical FormulaMolecular Weight (g/mol)
135.799.50Pyrrolo[1,2-a]pyrazine-1,4-dione91.05C11H18N2O2210
241.311.792,5-Piperazinedione,3,6-bis(2-methylpropyl)71.80C12H22N2O2226
349.641.60Pyrrolo[1,2-a]pyrazine-1,4-dione,hexahydro-3 (phenylmethyl)-69.18C14H16N2O2244

Share and Cite

MDPI and ACS Style

Abdelkhalek, A.; Behiry, S.I.; Al-Askar, A.A. Bacillus velezensis PEA1 Inhibits Fusarium oxysporum Growth and Induces Systemic Resistance to Cucumber Mosaic Virus. Agronomy 2020, 10, 1312. https://doi.org/10.3390/agronomy10091312

AMA Style

Abdelkhalek A, Behiry SI, Al-Askar AA. Bacillus velezensis PEA1 Inhibits Fusarium oxysporum Growth and Induces Systemic Resistance to Cucumber Mosaic Virus. Agronomy. 2020; 10(9):1312. https://doi.org/10.3390/agronomy10091312

Chicago/Turabian Style

Abdelkhalek, Ahmed, Said I. Behiry, and Abdulaziz A. Al-Askar. 2020. "Bacillus velezensis PEA1 Inhibits Fusarium oxysporum Growth and Induces Systemic Resistance to Cucumber Mosaic Virus" Agronomy 10, no. 9: 1312. https://doi.org/10.3390/agronomy10091312

APA Style

Abdelkhalek, A., Behiry, S. I., & Al-Askar, A. A. (2020). Bacillus velezensis PEA1 Inhibits Fusarium oxysporum Growth and Induces Systemic Resistance to Cucumber Mosaic Virus. Agronomy, 10(9), 1312. https://doi.org/10.3390/agronomy10091312

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop