Study on the Regulation Mechanism of 1-MCP Combined with SO₂ Treatment on Postharvest Senescence of Bamboo Shoots (Chimonobambusa quadrangularis) in Karst Mountain Area

Abstract

Fresh bamboo shoots (Chimonobambusa quadrangularis) are subjected to senescence (e.g., lignification and browning) during postharvest storage. This study investigated the effects of 1-MCP and SO₂ treatment on bamboo shoot senescence and its regulation mechanism in order to extend bamboo shoot storage time. 1-MCP and SO₂ treatments significantly inhibited the browning and lignification of fresh bamboo shoots during storage, according to the results. Its lower browning index and lignin content are directly related to its lower lignin content compared to the CK control group. The browning index and lignin content of the 1-MCP + SO₂ treatment during the late storage period were 90.55% and 81.50% of the CK treatment, respectively. The result of the in-depth analysis suggested that 1-MCP and SO₂ treatments reduced nutrient loss and maintained the nutritional value of bamboo shoots by inhibiting respiration and physiological metabolism. The PPO activity was inhibited to inhibit the browning process. Moreover, the scavenging ability of ROS was enhanced, the accumulation of MDA was inhibited, and the senescence of bamboo shoots was delayed after higher contents of total flavonoids and ascorbic acid were maintained and the activities of ascorbic acid peroxidase and superoxide dismutase were stimulated. Furthermore, lignin biosynthesis was hindered, and the lignification of bamboo shoots was delayed after the activities of POD and PAL were inhibited. In brief, 1-MCP + SO₂ treatment is capable of inhibiting the physiological metabolism, browning, and lignification of bamboo shoots, maintaining good quality during storage, and delaying the senescence of bamboo shoots. Clarifying the senescence mechanism of bamboo shoots is of great significance for expanding the bamboo shoot industry and slowing down rocky desertification in karst mountainous areas.

1. Introduction

Nearly 15 percent of the world’s land is covered by karst landforms. To be specific, they are extensively distributed in Southeast Asia, the Mediterranean region of Europe, Central America, southeast North America, and southwest China [1,2]. Guizhou Province is the center of karst landforms in southwest China. The ecological environment of the karst area in Guizhou has progressively degraded under the destruction of human beings over the past few years, thus causing rocky desertification [3,4]. Relevant research has suggested that planting bamboo forests is capable of effectively delaying rocky desertification, taking on critical significance for soil and water conservation, nutrient balance, and so forth, while leading to the production of edible fresh bamboo shoots, such that higher ecological and social benefits can be achieved [5].

Chimonobambusa quadrangularis refers to a vital bamboo shoot species that is primarily produced in the karst mountainous areas of southwest China. The fresh bamboo shoots of Chimonobambusa quadrangularis are the buds of bamboo. They have gained wide popularity for their rich dietary fiber and unique flavor, and they are considered a type of healthy vegetable [6,7]. However, fresh bamboo shoots are extremely intolerant to postharvest storage, and the texture and appearance will deteriorate in a short time after harvest. Harvest damage and severe physiological metabolism have been confirmed as the direct causes of the rapid senescence of bamboo shoots after harvest. Lignification and browning serve as crucial criteria for measuring the senescence of bamboo shoots after harvest [8,9]. The preservation technology of fresh bamboo shoots was studied to prolong the storage period, such that the fresh bamboo shoots after storage still had ideal edible value and brought higher benefits to growers.

A lignification process increases the firmness of postharvest fruits and vegetables, and this process is directly caused by lignin biosynthesis [10]. Phenylpropanoid metabolism takes on great significance in the postharvest lignification of fruits and vegetables. Phenylalanine ammonia lyase (PAL) and peroxidase (POD) are essential enzymes in phenylpropanoid metabolism [11]. PAL refers to the rate-limiting enzyme for lignin formation, providing precursors for lignin formation [12]. POD is an essential enzyme in catalyzing lignin biosynthesis in the cell wall, and it can polymerize lignin monomers into lignin polymers [13]. Browning is a vital feature of postharvest senescence in fruits and vegetables. The main reason is that the scavenging ability of reactive oxygen species (ROS) is reduced, and the accumulation of malondialdehyde (MDA), a product of membrane lipid peroxidation, reduces the integrity of cell membranes, such that the phenolic substances in fruits and vegetables come into contact with polyphenol oxidase (PPO) to produce browning [14]. Existing research has suggested that a wide variety of antioxidant enzymes in postharvest fruits and vegetables (e.g., ascorbate peroxidase (APX) and superoxide dismutase (SOD)) can scavenge ROS in fruits and vegetables and slow down senescence during storage [15]. Accordingly, activating the active oxygen scavenging ability and inhibiting lignin biosynthesis in bamboo shoots can delay the rapid senescence of bamboo shoots during storage.

It has been shown that 1-MCP competes with ethylene for binding sites on ethylene receptors in plant tissues; this inhibits ethylene’s physiological role and slows postharvest senescence of fruits and vegetables. Extensive studies have been conducted on its application to a wide variety of fruits and vegetables [16]. Bamboo shoots are not climacteric fruits and vegetables, but relevant research has suggested that ethylene may induce senescence metabolism in bamboo shoots, and using 1-methylcyclopropene (1-MCP) to treat bamboo shoots can improve their quality after harvest [17]. However, due to the complexity of antioxidants (e.g., phenols), during storage, 1-MCP treatment has rarely been reported to improve the antioxidant capacity of bamboo shoots [18,19]. In recent studies, 1-MCP treatment has been shown to delay total phenol and anthocyanin accumulation in peach fruits [20]. As a result of 1-MCP treatment, phenolic compounds in strawberry and loquat were significantly increased, suggesting that the response of 1-MCP to the antioxidant metabolism of different fruits and vegetables was different [21,22]. Thus, the effect of 1-MCP on improving the antioxidant capacity and activating the active oxygen scavenging ability of fresh bamboo shoots after harvest should be investigated in depth.

Existing research has suggested that harvest damage is a vital factor causing postharvest decay of fruits and vegetables. Pathogenic microorganisms infect fruits and vegetables through traumatic sites, induce stress resistance, aggravate growth and metabolism, and accelerate senescence [23]. Postharvest damage to bamboo shoots is inevitable due to its unique harvesting method. A fungicide, sulfur dioxide (SO₂), can effectively inhibit microorganism growth and maintain fruit quality [24]. Two methods of SO₂ treatment for long-term fruit and vegetable storage are described below: with sulfur dioxide slow-release paper and by repeated application of the gas on the storage room’s fumigation [25,26]. A fumigated storage room can affect fruit and vegetable flavors, damage fruits and vegetables, and leave excessive sulfite residues [27]. Sodium pyrosulfite (Na₂S₂O₅) contained in SO₂ slow-release paper is wrapped in a special paper, and the appropriate dose of SO₂ is released slowly to inhibit the growth of pathogenic bacteria. High doses of SO₂ can cause bleaching, damage, and taste residue in fruits and vegetables. Accordingly, EU countries have proposed a limit on SO₂ dosage (26.2 mg/m³) to maintain the optimal quality [28].

Therefore, 1-MCP or SO₂ treatment alone can maintain fruit and vegetable quality more effectively during storage, though the mechanism might be different. An effective combination of the two may provide a novel solution for storing fruits and vegetables. Furthermore, little research has been conducted on how 1-MCP and SO₂ combined treatments affect bamboo shoot postharvest quality. In this study, a combination of 1-MCP, SO₂, and 1-MCP plus SO₂ was used to treat bamboo shoots after harvest. Fresh bamboo shoots were examined for changes in physiology and enzyme activity during storage, as well as gene expression, to explore the regulatory mechanism of 1-MCP combined with SO₂ treatment in maintaining the postharvest quality and delaying the senescence of bamboo shoots. Expanding the planting area of local bamboo shoots provides a new solution for delaying rocky desertification in mountainous areas of southwest China.

2. Materials and Methods

2.1. Plant Material

The fresh bamboo shoots (Chimonobambusa quadrangularis) were collected from Taibai Town, Suiyang County, Zunyi City, Guizhou Province (28°40′50.40″ N, 107°09′26.00″ E). Moreover, the bamboo shoots with no pests and diseases, moderate size, and strong growth were selected. The amounts of 1-MCP (SmartFreshSM Inc., Wilmington, DE, USA) and UVASYS (Grapete Inc., Cape Town, South Africa) applied and the PE spontaneously modified atmosphere bag were all determined in accordance with the previous experimental results. The specific experimental results are presented in supplementary materials.

The fresh bamboo shoots were randomly assigned to two groups (60 kg in each group), which were placed in a closed space with a 1 m square plastic tent. One group was fumigated with 1.0 μ·L⁻¹ 1-MCP for 2 h, and the other group was not treated. The respective group of bamboo shoots was weighed and loaded into a 0.02 mm PE modified atmosphere bag (24 bags in the respective group), and then pre-cooled in a fresh-keeping warehouse at a temperature of (1.0 ± 0.3) °C and a humidity of (90 ± 5)% for 24 h. After precooling, the 1-MCP group fell into two parts: one part was put into 1/4 UVASYS and then recorded as 1-MCP + UVASYS treatment, and the other part was not treated and then recorded as 1-MCP treatment. Moreover, the non-treatment group was assigned to two parts: some of them were placed into 1/4 UVASYS as UVASYS treatment, and some of them were not treated as CK treatment (Uvasys^®, Cape Town, South Africa, with a 37.55% share of sodium metabisulfite, over 98% pure, and a 356 × 260 mm measurement. The release was divided into two parts, 40% was first released in the fast phase of 24–48 h, and then 60% was released slowly. Leaflet was slowly released to maintain a concentration of 10.48 mg/m³ SO₂ release [29]). Subsequently, the modified atmosphere bag was bagged and then stored in the fresh-keeping warehouse for 60 days, and the physiological and biochemical indexes were measured every 15 days. In addition, the frozen samples were stored at −80 °C until further biochemical analysis could be carried out.

2.2. Respiratory Rate Measurement

The respiratory rate was examined using the static method [30]. Randomly select 2.0 kg of fresh bamboo shoots, weigh them, and place them in a 30 L sealed plastic container. Let them stand for 2 h at 25 °C. Use a residual oxygen meter ((Checkpoint 3 Premium, Mocon Inc., Minneapolis, MN, USA) to measure the CO₂ concentration in the container and measure the respiration rate as the amount of CO₂ increased per kilogram of fresh bamboo shoots per hour.

2.3. Weight Loss Rate Measurement

Weight loss was used to determine the weight loss rate [31], and the sample was weighed on day 0 of the respective treatment and at the end of each storage interval.

2.4. Color Feature

Bamboo shoot color change was measured by total color difference (ΔE) and browning index (BI). In the test, a color difference meter (Konica Minolta Inc., Tokyo, Japan) was used to measure the color difference using the international standard CIE-L* a* b* color system, and the parameter ΔE was adopted. BI refers to a crucial color change parameter that represents the number of enzymatic and non-enzymatic browning reactions after treatment and during storage [32].

$$\mathrm{BI}=\frac{[100\times (\mathrm{X}-0.31\left)\right]}{0.172}\mathrm{X}=\frac{{\mathrm{a}}^{*}+1.75\times {\mathrm{L}}^{*}}{5.645\times {\mathrm{L}}^{*}+{\mathrm{a}}^{*}-3.012\times {\mathrm{b}}^{*}}$$

(1)

$$∆\mathrm{E}=\sqrt{({\mathrm{L}}^{*}-\mathrm{L}{0}^{*}{)}^2+({\mathrm{a}}^{*}-\mathrm{a}{0}^{*}{)}^2+({\mathrm{b}}^{*}-\mathrm{b}{0}^{*}{)}^2}$$

(2)

2.5. Firmness

The firmness test reference LI method was optimized [33]. The analysis was conducted every 15 days using a texture analyzer ((SMS Inc., London, UK). The P-2N probe was selected to test the middle of the shelled bamboo shoots. 15 bamboo shoots were randomly selected for the respective treatment, the test depth was 8 mm, the speed before the test was 5 mm·s⁻¹, the speed during the test was 5 mm·s⁻¹, the speed after the test was 5 mm·s⁻¹, and the result is expressed in grams (g).

2.6. Lignin Content

Using acetyl bromide, the amount of lignin in the sample was determined [34]. The 100.0 mg sample was dried to a constant weight. A total of 1000 μL of acetyl bromide reagent and 40 μL of perchloric acid were added (Macklin Inc., Shanghai, China). In a water bath at 80 °C for 40 min, 500 μL of a 2 mol·L⁻¹ sodium hydroxide solution and 500 μL of glacial acetic acid solution were added to end the reaction(Macklin Inc., Shanghai, China). They were thoroughly mixed and centrifuged for 5 min at 10,000 r/min⁻¹ (DragonLabS Inc., Beijing, China). To measure the absorbance of the solution, glacial acetic acid was used as a blank.

2.7. MDA Content

MDA was determined using the thiobarbituric acid method and improved [35]. In order to obtain the sample extract, a 3.0 g (FW) sample was accurately weighed and ground into a homogenate in 10 mL (Vt) of 10.0% trichloroacetic acid (TCA) (Macklin Inc., Shanghai, China). A reaction solution (Va) was prepared by adding 5 mL of a 0.6% TBA solution to 5 mL of the extraction solution (Vs) (Macklin Inc., Shanghai, China). A water bath at 95 °C for 15 min was used to conduct the reaction after the solution was shaken and mixed. Next, the reaction solution was placed in an ice bath. The solution cooled quickly, and it was centrifuged at 5000× g for 10 min. 5 mL of 10% TCA and 5 mL of 0.6% TBA solution were mixed in a centrifuge tube, cooled, and centrifuged together with the sample as a blank control. Using the supernatant, absorbances at 532 nm, 600 nm, and 450 nm were measured, and the MDA content was calculated using Equation (3):

$$\mathrm{MDA}\mathrm{content}(\mathsf{\mu }\mathrm{mol}·{\mathrm{kg}}^{-1})=\frac{[6.452\times (\mathrm{A}532-\mathrm{A}600)-0.559\times \mathrm{A}450]\times \mathrm{Vt}\times \mathrm{Va}}{\mathrm{Vs}\times \mathrm{FW}}$$

(3)

2.8. Soluble Protein Content and Free Amino Acid Content

The content of soluble protein in bamboo shoots was determined using the Coomassie Brilliant Blue G-250 method [36]. The sample was homogenized with 5 mL of distilled water containing 1.0 g of the sample. Next, it was centrifuged at 4 °C for 20 min at 10,000 r·min⁻¹. A total of 1.0 mL of the sample was taken to extract the supernatant. After mixing the sample with 5.0 mL of Coomassie brilliant blue G-250 solution (Macklin Inc., Shanghai, China), the mixture was placed for 2 min. Afterward, the content of soluble proteins was determined through spectrophotometry at a wavelength of 595 nm.

Using the ninhydrin color method with minor modifications, free amino acids were determined [37]. Approximately 3.0 g of sample were weighed, ground into a homogenate under 10 mL of a 10% acetic acid solution (Macklin Inc., Shanghai, China), diluted with 100 mL of distilled water , shaken, and then filtered. The filtrate was mixed with ninhydrin and ascorbic acid reagents and heated in a boiling water bath for 15 min(Macklin Inc., Shanghai, China). A 95% ethanol solution was added after cooling. Then, the mixed solution was shaken up and diluted with 60% ethanol to 20 mL (Macklin Inc., Shanghai, China). The solution without any filtrate was taken as a blank control, and 570 nm was used to measure absorbance.

2.9. Determination of Ascorbic Acid Content and Total Flavone Content

2,6-dichloro-indophenol was titrated and then improved [38]. Five grams of sample were accurately weighed, and a small amount of a 20 g·L⁻¹ oxalic acid solution was added (Macklin Inc., Shanghai, China). A homogenate of the sample was ground in an ice bath and filtered, and the filtrate exhibited a constant volume of 100 mL. A calibrated solution of 2,6-dichloro-indophenol was titrated with 20 mL of the filtrate in a 100 mL conical flask (Macklin Inc., Shanghai, China). Next, the sample showed a slight red color without fading for 15 s. A total of 20 g·L⁻¹ of oxalic acid solution was employed as the blank control.

The content of total flavonoids varied slightly in accordance with the method of DU et al. [39]. A 3.0 g sample was accurately weighed and ground into a homogenate in 70% ethanol. The solution was diluted to 25 mL. After extraction for 1 h in the dark, the extract was transferred to a centrifuge tube and centrifuged at 10 °C for 10 min at 10,000 r·min⁻¹. 2 mL of 0.1 mol·L⁻¹ AlCl₃ solution and 3 mL of 1 mol·L⁻¹ CH₃COOK solution were added to 1 mL of 1 mL of extract solution (Macklin Inc., Shanghai, China), diluted to a volume with 75% ethanol solution, shaken up, and then through spectrophotometer colorimetry (Macklin Inc., Shanghai, China), the samples were placed at ambient temperature for 30 min and then measured at a 420 nm wavelength.

2.10. Total Phenol Content

In accordance with the method of BAE et al. [40]. 3.0 g (m) of sample was accurately weighed, and 10 mL of 70% absolute ethanol was quickly added. In an ice bath, the sample was ground into a homogenate (Macklin Inc., Shanghai, China). 70% absolute ethanol was adopted to achieve a constant volume of 25 mL. A centrifuge tube containing 50 mL of the mixture was placed in the dark for two hours after standing at 25 °C. In a dark place for 30 s, 2.0 mL of supernatant and 3.0 mL of Folin phenol reagent were added to the centrifuged material and centrifuged for 10 min at 10 °C. After adding 6.0 mL of 12% Na₂O₃ solution, 25 mL of distilled water was added (Macklin Inc., Shanghai, China). Moreover, the absorbance (A) at 760 nm was measured after the solution stood at 25 °C for 1 h. The absorbance of the gradient concentration of gallic acid was obtained under the same conditions, and the standard curve was prepared. The results are expressed in (mg·g⁻¹), and the standard curve equation and total phenol calculation equation are expressed as follows:

$$\mathrm{Y}=0.365\mathrm{x}+0.0165{\mathrm{R}}^2=0.9972$$

(4)

$$\mathrm{M}=\frac{(\mathrm{A}-0.1688)\times 25\times 25}{0.2112\times \mathrm{m}\times 1000}$$

(5)

2.11. Enzyme Activity Measurement

The PPO activity was determined using the method outlined by Yang et al. [41]. A 0.05 mmol·L⁻¹ sodium phosphate buffer solution was added to 10 mg of sample to form a homogenate (Macklin Inc., Shanghai, China), which was then dissolved in a 0.1 mmol sodium phosphate buffer solution for 10 min and centrifuged at 4 °C for 30 min. After 10 min in a 37 °C water bath, three milliliters of supernatant, 3.9 milliliters of sodium phosphate buffer, and one milliliter of catechol solution were added, and two milliliters of 20% TCA solution was added after that (Macklin Inc., Shanghai, China). The absorbance value was measured at 420 nm, and the enzyme solution was replaced with 0.05 mmol·L⁻¹ sodium phosphate buffer as a blank (Macklin Inc., Shanghai, China).

APX activity was determined and modified using the method of Milena et al. [42]. A 3.0 g of sample was ground into a homogenate with 10 mL of extraction buffer (100 mmol·L⁻¹ potassium phosphate buffer, 0.1 mmol·L⁻¹ EDTA, 1 mmol·L⁻¹ ascorbic acid, 20% PVPP) in an ice bath, and centrifuged at 4 °C for 30 min at 10,000 r·min⁻¹ (Macklin Inc., Shanghai, China). A total of 0.6 mL of supernatant and 5.2 mL of reaction buffer (50 mmol·L⁻¹ potassium phosphate buffer, 0.1 mmol·L⁻¹ EDTA, and 1 mmol·L⁻¹ ascorbic acid) (Macklin Inc., Shanghai, China) were taken and fully mixed. A solution of 0.3 mL of 20 mmol·L⁻¹ H₂O₂ was added (Macklin Inc., Shanghai, China), and the oxidation rate of ascorbic acid at 290 nm was measured to determine the enzyme activity. The activity unit was U·g⁻¹·min⁻¹.

POD activity was determined using LIU et al.’s method with minor modification [43]. 3.00 g of sample were accurately weighed, ground into a homogenate, and dissolved in 10 mL of acetic acid sodium acetate extraction buffer (each liter contained 40 g PVPP, 1% Triton X-100, and 1 mmol PEG) (Macklin Inc., Shanghai, China). It was centrifuged for 30 min at 4 °C at 10,000 r·min⁻¹. 1 mL of supernatant, 6 mL of 25 mmol·L⁻¹ guaiacol solution, and 400 μL 0.5 mol·L⁻¹ H₂O₂ were taken, and the absorbance value at 470 nm was quickly measured after mixing (Macklin Inc., Shanghai, China). The active unit U·g⁻¹·min⁻¹ was expressed.

PAL activity was slightly modified using the method of Chen et al. [44]. A sample of 3.00 g in 10 mL of 100 mmol·L⁻¹ boric acid-borax extraction buffer (each liter contains 40 g PVPP, 35 μL β-Mercaptoethanol, and 2 mmol EDTA) (Macklin Inc., Shanghai, China) was accurately weighed, and the homogenate was ground in an ice bath and centrifuged at 4 °C for 30 min at 10,000 r·min⁻¹. 1 ml of supernatant, 6 ml of 50 mmol·L⁻¹ boric acid borax buffer solution, and 1.0 mL of 20 mmol·L⁻¹ L-phenylalanine were taken (Macklin Inc., Shanghai, China). After mixing, the absorbance value at 290 nm was quickly measured. The absorbance value at 290 nm was measured after 1 h of reaction in a water bath at 37 °C. The activity is expressed in U·g⁻¹·min⁻¹.

The SOD activity was determined using the method of QI et al. [45]. A sample of 3.00 g was accurately weighed, homogenized in 10 mL of distilled water in an ice bath, then filtered at 4 °C under low temperatures and kept away from light. 2 mL of filtrate and 2.35 mL of 0.1 mol·L⁻¹ Tris HCI solution (containing 2.0 mmol·L⁻¹ EDTA) (Macklin Inc., Shanghai, China) were taken, and 0.15 mL of 4.5 mol·L⁻¹ pyrogallol was quickly mixed. Afterwards, distilled water was used as the blank control in order to measure the absorbance value at 325 nm.

2.12. RT-PCR

The treated bamboo shoots were operated using the method of WU et al. [46]. The Phyllostachys edulis genomic database was searched and specific gene primers were designed within the conserved domains (Table 1). The specificity of the melting peak and dissociation curve was analyzed (cFX fluorescence quantitative PCR instrument, Bio-rad company, Inc., CA, USA); (sW-CJ-1FD ultra-clean workbench, Inc., China Sujing Antai Company, Suzhou, China); (nanoDrop2000 ultramicro spectrophotometer, Thermo, Inc., Guangzhou, China). Three biological replicates were used for all qRT-PCR analyses. Using 2^−ΔΔCt, Ct was used to calculate relative expression levels, and Table 1 provides a list of relevant genes.

2.13. Statistical Analysis

The experiments were conducted in a completely randomized design. The results indicated the mean ± standard deviation (SD) of at least three replicates. IBM SPSS version 21 (IBM, Armonk, New York, NY, USA) and t-tests were performed for a one-way ANOVA for statistical analysis. p < 0.05 indicated a difference that achieved statistical significance.

3. Results

3.1. Changes of Respiration Rate and Weight Loss Rate

As depicted in Figure 1A, there was an increase in bamboo shoot respiration rate after treatment with CK. In general, CK treatment resulted in a greater respiration rate than other treatment methods; as a result, the respiration rate of the CK treatment significantly exceeded that of the 1-MCP + UVASYS treatment throughout the storage period. The respiration rate of 1-MCP + UVASYS treatment was 242.78 mg CO₂·kg⁻¹·h⁻¹ at 60 d, significantly lower than that of CK, 1-MCP, and UVASYS treatments.

The weight loss rate of bamboo shoots increases with the increase in storage time, as shown in Figure 1B, weight loss rates from CK treatment are higher than those from other treatments in the middle and late stages of storage. 1-MCP + UVASYS treatment was at the lowest level at 30 d, significantly lower than other treatments, and significantly lower than CK treatment from 30 d to 60 d, whereas no significant difference was identified between 1-MCP and UVASYS treatments during the later storage period.

Table 1. The sequences of specific primers used for real-time PCR analysis and conditions.

Species	Gene	Primer Sequences	Size (bp)	Annealing (°C)
Phyllostachys edulis	Actin	F:TGCCCTTGATTATGAGCAGG R:AACCTTTCTGCTCCGATGGT	108	60
Phyllostachys edulis	SOD	F:CTTTCCACTCGCTCCTCCTC R:TGATACGGGCGTTCACTGTT	107	60
Phyllostachys edulis	PPO	F:GATGATTGCCAGTGCCAAGA R:TCGGTGAAGTCGGTGTTGCT	270	60
Phyllostachys edulis	APX	F:CACCAACCGATGAGAAGAA R:GAGTAATTGGCAGCAACGA	103	60
Phyllostachys edulis	PAL	F:GAACAGCACAACCAAGATG R:TCTTTCTAGCCACCGTCGTC	190	60
Phyllostachys edulis	POD	F:CTTCGTCTTTCTCCTCGCATT R:TCTCAAGGTTTGGGCAGATG	95	60

Table 1. The sequences of specific primers used for real-time PCR analysis and conditions.

Species	Gene	Primer Sequences	Size (bp)	Annealing (°C)
Phyllostachys edulis	Actin	F:TGCCCTTGATTATGAGCAGG R:AACCTTTCTGCTCCGATGGT	108	60
Phyllostachys edulis	SOD	F:CTTTCCACTCGCTCCTCCTC R:TGATACGGGCGTTCACTGTT	107	60
Phyllostachys edulis	PPO	F:GATGATTGCCAGTGCCAAGA R:TCGGTGAAGTCGGTGTTGCT	270	60
Phyllostachys edulis	APX	F:CACCAACCGATGAGAAGAA R:GAGTAATTGGCAGCAACGA	103	60
Phyllostachys edulis	PAL	F:GAACAGCACAACCAAGATG R:TCTTTCTAGCCACCGTCGTC	190	60
Phyllostachys edulis	POD	F:CTTCGTCTTTCTCCTCGCATT R:TCTCAAGGTTTGGGCAGATG	95	60

3.2. Changes of Free Amino Acid and Soluble Protein Contents

Bamboo shoots first decreased and then increased in free amino acid content, as shown in Figure 2A. At 45 days, CK treatment had a higher content of free amino acids than other treatments, and it was at the highest level from 45 d to 60 d. At a later stage of storage, 1-MCP, uvasys, and 1-MCP + uvasys treatments slowed down the rise of free amino acids. At 45 days, the 1-MCP + uvasys treatment had a significantly lower level of free amino acids than other treatments.

According to Figure 2B, the amount of soluble protein in bamboo shoots decreased continuously as storage time increased. The CK treatment significantly reduced soluble protein content from 30 to 45 days, and the CK treatment was at its lowest level from 45 to 60 days and was significantly lower than the other treatments at 60 d. In general, 1-MCP + UVASYS treatment slowed down the decrease of soluble protein content, and the soluble protein content was 1.64 mg·g⁻¹ at 30 d, which notably exceeded other treatments.

3.3. Changes of the Total Color Difference (ΔE) and Browning Index (BI)

Based on Figure 3B, the ΔE of bamboo shoots showed an upward trend with storage time, indicating that the appearance and color of square bamboo shoots changed all the time during storage. Among them, fruits treated with CK rose most rapidly and reached their highest level after 30 days. Despite an increase in ΔE, the ΔE of 1-MCP, UVASYS, and 1-MCP + UVASYS treatments was significantly lower than that of CK treatment after 45 days.

As the storage time increases, the browning degree of bamboo shoots increases (Figure 3A,C). Compared with other treatments, browning indexes were highest for CK treatment at 45 d and 60 d, and CK treatment differed significantly from other treatments. On the 60th day, the browning indices of 1-MCP, UVASYS, and 1-MC + UVASYS treatments were only 94.24%, 86.32%, and 90.56% of CK treatments, respectively.

3.4. Changes of the Total Phenolic Content and Polyphenol Oxidase (PPO) Activity

As depicted in Figure 4A, CK treatment increased total phenolic content for the first 45 days but then decreased. Overall, the total phenolic content of CK treatment was high throughout the storage period, and the total phenolic content of CK treatment reached its maximum from 45 d to 60 d, and a significant difference was identified with 1-MCP + UVASYS treatment. Moreover, CK treatment had a significantly higher total phenolic content than other treatments at 15 d, suggesting that 1-MCP and UVASYS treatment may delay this increase.

As depicted in Figure 4B, the overall PPO activity tended to decrease. The CK treatment, however, had a higher level of PPO activity during storage than other treatments, and there were significant differences with other treatments at 15 d and 45 d. In contrast to CK treatment, 1-MCP, UVASYS, and 1-MCP + UVASYS treatments inhibited PPO expression. In comparison with other treatments, the 1-MCP + UVASYS treatment had significantly lower PPO activity at 60 days.

3.5. Changes of the Ascorbic Acid (ASA) and Total Flavonoids Content

Compared to other treatments, the CK treatment had the lowest ASA content during storage, as shown in Figure 5A. At 15 days and 45 days, a significant difference was observed between the CK treatment and the other treatments. The above result indicated that 1-MCP and UVASYS treatments maintained the ASA content to a certain extent, and the ASA content of the 1-MCP + UVASYS treatment notably exceeded that of other treatments at the later stage of storage.

In general, total flavonoids tended to decrease during storage (Figure 5B).

While the 1-MCP + UVASYS treatment maintained total flavonoid content more effectively during storage than CK, 1-MCP, and UVASYS treatments, between 45 and 60 days, the total flavonoid content significantly exceeded that of the CK, 1-MCP, and UVASYS treatments. After 45 days, 1-MCP + UVASYS treatment had 1.21 times, 1.15 times, and 1.18 times the flavonoid content of CK, 1-MCP, and UVASYS, respectively.

3.6. Changes of the ROS Metabolism

MDA continued to accumulate throughout the storage period, and the content continued to rise (Figure 6A). Compared with other treatments, the increase rate of MDA content in the CK treatment significantly exceeded that of other treatments. In the treatment, the 1-MCP, UVASYS, and 1-MCP + UVASYS treatments inhibited MDA accumulation to some extent, but the 1-MCP + UVASYS treatment had the greatest impact, and the MDA content of CK, 1-MCP, and UVASYS at 45 d only reached 67.35%, 84.96%, and 84.59%, respectively. Throughout the storage period, SOD activity increased and then decreased (Figure 6B). At the early stages of storage, CK treatment had significantly lower SOD activity than other treatments. As a result of 1-MCP, UVASYS, and 1-MCP + UVASYS treatments, SOD activity was stimulated and antioxidant capacity was enhanced during storage. SOD activity of the 1-MCP + UVASYS treatment was noticeably higher at 60 days than that of other treatments, suggesting that the 1-MCP + UVASYS treatment more effectively maintained SOD activity. A decrease in APX activity was observed during storage (Figure 6C), and CK treatment had the lowest APX activity during storage and was significantly lower than other treatments at 60 days. Accordingly, APX activity was better maintained in 1-MCP, UVASYS, and 1-MCP + UVASYS treatments during storage than in the other three treatments.

3.7. Changes of Lignification Related Indexes

During storage, the firmness and lignin content showed a rising trend (Figure 7A,B). Compared with the other treatments, while 1-MCP + UVASYS was at the lowest level during the entire storage period overall, the CK treatment significantly exceeded the other treatments in the late storage period. While being stored, PAL activity first increased and then decreased (Figure 7C). Among them, the PAL activity of the 1-MCP + UVASYS treatment was at the lowest level in the whole storage period, significantly different from other treatments at 45 days, and its PAL activity was only 44.35% and 44.10% of that of the CK, 1-MCP, and UVASYS treatments, respectively. 60.97%. POD activity tended to fluctuate throughout the storage period (Figure 7D). At the early storage stage, POD activity was not significantly different between the respective treatments. POD activity of the CK treatment has significantly exceeded that of the other three treatments since 30 days. At 45 days, 1-MCP, UVASYS, and 1-MCP + UVASYS treatments showed 1.32 times, 1.50 times, and 1.57 times activity, respectively. There were no significant differences among the other three treatments during storage.

3.8. 1-MCP and UVASYS Affect the Relative Expression of Enzyme Genes

The change in SOD gene expression coincided with the change in SOD activity over storage, showing an initial increase and then a decrease (Figure 6B and Figure 8A). SOD gene expression could be induced by 1-MCP and UVASYS treatment compared to CK treatment during late storage, and 1-MCP + UVASYS treatment exceeded CK treatment significantly. The results showed that 1-MCP and UVASYS treatments could increase SOD activity by inducing the expression of the SOD gene. The amount of PPO gene expression tended to increase during storage (Figure 8B), in which CK treatment significantly exceeded other treatments in the late storage period, suggesting that 1-MCP and UVASYS treatment could inhibit PPO gene expression, in which 1-MCP + UVASYS treatment was only 41.33% of CK at 60 days. This is consistent with the significantly lower PPO activity observed in the 1-MCP + UVASYS treatment compared to the CK treatment during the later stage of storage (Figure 4B). The expression of the APX gene is shown in Figure 8C. During storage, the 1-MCP and UVASYS treatments both significantly increased the expression of the APX gene compared to the CK treatment, and late storage was significantly different between the two treatments. This result is consistent with the fact that 1-MCP + UVASYS treatment can maintain APX activity well during the later stage of storage and is significantly higher than that of the CK treatment (Figure 6C and Figure 7C). The change trend of PAL gene expression during storage is consistent with that of PAL activity (Figure 7C and Figure 8D). Specifically, 1-MCP + UVASYS treatment was significantly lower than CK treatment in the late storage period. The POD gene expression amount during storage is shown in Figure 8E. In the late storage period, 1-MCP and UVASYS significantly reduced the relative expression amount of POD compared to the CK control group. This result was also consistent with the inhibition of PAL and POD activities observed in bamboo shoots treated with 1-MCP + UVASYS during the later stage of storage.

4. Discussion

4.1. Physiological and Nutritional Quality Changes

The senescence of postharvest fruits and vegetables is considered an irreversible biological process that consumes nutrients until cell death [47]. Fruits and vegetables undergo aerobic respiration as they ripen and age, and it is the main energy source for their cells during this process [48]. Fruits and vegetables will lose quality and senescence quicker after harvest if their respiration rate is excessive. Additionally, it affects the physiological metabolism of fruits and vegetables, determining their storage time [49,50]. Postharvest respiration of bamboo shoots is vigorous, which rapidly consumes the nutrients of the shoots and causes mass loss. Accordingly, inhibiting postharvest respiration rate can prolong the storage time of bamboo shoots [51]. Numerous fruits and vegetables have been found to be inhibited by 1-MCP in previous research [52]. In addition, SO₂ inhibits weight loss during storage of fruits and vegetables [53]. The result of this study suggested that respiration continued during storage; 1-MCP and SO₂ treatments inhibited bamboo shoot respiration during storage compared to CK treatment, inhibited weight loss rate, and maintained soluble protein levels (Figure 1A,B and Figure 2B), consistent with the above description. As a result of the loss of external nutrients and the decomposition of its own protein, the free amino acid content increased at the later stage of storage (Figure 2A). Furthermore, the above-described result is consistent with the study of Li et al. [54]. Thus, 1-MCP and SO₂ can slow down the loss of nutrients by inhibiting respiration to delay senescence and prolong the preservation time of bamboo shoots.

4.2. Appearance Color and Enzymatic Browning

It has been established that browning is a crucial sign of senescence in fruits and vegetables after harvest [55]. Bamboo shoots are prone to browning, especially after peeling and cutting processes. Enzymatic browning is considered a vital cause of bamboo shoot browning [56]. The process of enzyme browning occurs when polyphenol oxidase (PPO) reacts with phenolic compounds, resulting in the browning of fruits and vegetables after harvest [57]. The total color difference (ΔE) and browning index (BI) can indicate the total color change and browning degree of bamboo shoots during storage. Study results indicated that bamboo shoots browned more rapidly as storage time increased, suggesting that bamboo shoots are browning more rapidly (Figure 3A,B). As storage time increases, the ROS scavenging ability of fruits and vegetables decreases, and the MDA content increases, destroying the integrity of the cell membrane in the process. The outflow of phenolic substances made the enzymatic reaction more intense [58]. Based on the increasing amount of total phenol content, these values should be increasing as well. This is consistent with the increase of ΔE and BI values caused by the continuous increase of total phenol content, PPO activity, and gene expression in the late storage period of bamboo shoots in this study (Figure 4A,B and Figure 8B). The results of this study suggest that 1-MCP treatment and SO₂ treatment inhibited PPO activity at a later stage of storage compared with CK treatment, which was consistent with the fluorescence quantitative data of PPO (Figure 4B and Figure 8B). Based on the results, 1-MCP treatment and SO₂ treatment inhibited PPO activity by inhibiting PPO gene expression, thereby inhibiting enzymatic browning and slowing down the increase of ΔE and BI values. Among them, the 1-MCP + SO₂ treatment group exerted the optimal effect, and a significant difference with CK treatment was detected during the later storage period. (Figure 3A,B). This result is consistent with CHEN et al., that is, 1-MCP and SO₂ treatments inhibit postharvest browning of fruits and vegetables [59,60].

4.3. Active Oxygen Metabolism

Cell membrane integrity takes on critical significance to the anti-browning activity of browning-associated enzymes and substrates during storage of fruits and vegetables [61]. The integrity of the cell membrane is significantly correlated with the content of ROS, showing a close association with the content of non-enzymatic antioxidants (e.g., ascorbic acid and total flavonoids) and the activity of APX and SOD [62]. With the senescence of fruits and vegetables, their antioxidant capacity is reduced, and ROS continues to accumulate. Excessive ROS products (H₂O₂, O²⁻) are capable of causing oxidative stress and destroying cell integrity, leading to oxidative damage of the cell membrane. Membrane lipid peroxidation produces MDA as its final product [63,64]. Ascorbic acid and flavonoids exhibit antioxidant capacity. Relevant research has suggested that ascorbic acid and flavonoids, i.e., the main non-enzymatic antioxidants, are capable of significantly inhibiting the accumulation of MDA in fruits and vegetables, thus preventing ROS accumulation from causing oxidative damage during fruit senescence [65]. To alleviate oxidative damage to cell membranes and slow down MDA accumulation, APX and SOD can remove ROS products (H₂O₂, O²⁻) [66]. In this study, the ASA content, SOD, APX enzyme activity, and gene expression of bamboo shoots administered with CK were generally at their lowest levels during storage. The bamboo shoots administrated with 1-MCP and SO₂ maintained and induced the content and activity of the corresponding antioxidant substances (Figure 5A, Figure 6B,C and Figure 8A,C), consistent with Wang et al. [67,68]. Bamboo shoots treated with 1-MCP and SO₂ were significantly inhibited compared to bamboo shoots treated with CK in this study (Figure 6A). It has been shown that 1-MCP and SO₂ treatments can delay the senescence of bamboo shoots by increasing ROS scavenging and inhibiting MDA accumulation [69].

4.4. Lignification

Lignification is another major feature of postharvest senescence of bamboo shoots, which is mainly manifested in the deterioration of texture and taste of bamboo shoots caused by the increase in firmness [33]. At present, most model plant studies have found that lignin accumulation is the direct cause of increased firmness and lignification of postharvest fruits and vegetables [70,71]. Phenylpropanoid metabolism is considered the main metabolic pathway of lignin biosynthesis. PAL and POD are the essential enzymes involved in phenylpropanoid metabolism [72]. The key rate-limiting enzyme in the lignin synthesis pathway is PAL, which catalyzes the formation of cinnamic acid derivatives, and POD is responsible for lignin synthesis from lignin monomers [73]. In this study, the firmness of bamboo shoots increased with the increase in storage time. Consistent with the increase in firmness, the lignin content also tended to be increased (Figure 7A,B). This study supports the findings of Yang et al. that bamboo shoots became lignified during storage [74]. Relevant research has suggested that 1-MCP treatment is capable of effectively inhibiting the increase of firmness and lignin during fruit and vegetable storage, which is achieved by inhibiting lignin biosynthesis and its enzyme activity [75]. Research has shown that SO₂ delays the postharvest senescence of fruits and vegetables [76]. At the later stage of storage, 1-MCP treatment and SO₂ treatment significantly inhibited POD and PAL activities (Figure 7A,B), and the relative gene expression changes further verified the above result (Figure 8D,E). As indicated by the results, bamboo shoots were inhibited by 1-MCP and SO₂ treatments due to inhibition of enzyme activity and gene expression in the lignin biosynthesis process. The low level of lignin content and firmness of 1-MCP and SO₂ treatments in this study is consistent with this conclusion (Figure 7A,B). The above results indicate that 1-MCP and SO₂ treatments can effectively delay bamboo shoot senescence and inhibit lignification.

5. Conclusions

The purpose of this study is to extend the storage time of fresh bamboo shoots, increase income for local bamboo growers, promote the development of the bamboo industry, and delay rocky desertification in karst mountainous areas. The results are presented in Figure 9. As indicated by the results, the 1-MCP + SO₂ treatment delayed bamboo shoot senescence and maintained bamboo shoot quality during storage. The treatment inhibited the respiration of bamboo shoots, reduced the physiological metabolism, and slowed down nutrient loss. Additionally, the treatment inhibited the activity of PPO and POD, stimulated the content of ASA and total flavonoids, and stimulated the activity of SOD and APX. As a result, the bamboo shoots that were administered with 1-MCP + SO₂ exhibited higher antioxidant capacity, reduced ROS-induced oxidative damage, prevented MDA accumulation, and significantly reduced browning (Figure 9). Furthermore, the treatment inhibited POD and PAL enzyme activities, lignin production, and firmness increase, ultimately delaying lignification (Figure 9). Therefore, 1-MCP + SO₂ treatment was found to be the most effective method for delaying bamboo shoot senescence during storage, making it a suitable preservation method. Desertification in karst areas has always hindered southwest China’s economic development. Planting bamboo forests has been proven to be an effective way to conserve water and improve soil water quality. Chimonobambusa quadrangularis, a native plant of southwest China’s karst mountainous areas, is favored by consumers for its fresh bamboo shoots. This study explored the preservation method of fresh bamboo shoots, clarified the senescence mechanism, prolonged the storage time, and provided technical support for expanding the planting area of bamboo. This, in turn, stimulates local economic development and delays rocky desertification.