Next Article in Journal
Environmental Constraints Mitigation Directly Drove the Diversifications of Fungal Community and Functional Profile in Amended Coastal Salt-Affected Soils
Previous Article in Journal
An Efficient Computer Vision-Based Dual-Face Target Precision Variable Spraying Robotic System for Foliar Fertilisers
Previous Article in Special Issue
High-Quality Complete Genome Resource for Dickeya dadantii Type Strain DSM 18020 via PacBio Sequencing
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 14
Issue 12
10.3390/agronomy14122771
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Cladophialophora guangxiense sp. nov., a New Species of Dark Septate Endophyte, Mitigates Tomato Bacterial Wilt and Growth Promotion Activities

by
Xihong Wei
1,
Yanyan Long
2,3,4,
Yanlu Chen
5,
Stanley Nyenje Mataka
1,
Xue Jiang
1,
Yi Zhou
1,
Zhengxiang Sun
1,* and
Ling Xie
2,3,4,*
1
College of Agriculture, Yangtze University, Jingzhou 434025, China
2
Plant Protection Research Institute, Guangxi Academy of Agricultural Science, Nanning 530007, China
3
Key Laboratory of Green Prevention and Control on Fruits and Vegetables in South China, China Ministry of Agriculture and Rural Affairs, Nanning 530007, China
4
Guangxi Key Laboratory of Biology for Crop Diseases and Insect Pests, Nanning 530007, China
5
Institute of Biological Sciences and Technology, Guangxi Academy of Sciences, Nanning 530007, China
*
Authors to whom correspondence should be addressed.
Agronomy 2024, 14(12), 2771; https://doi.org/10.3390/agronomy14122771
Submission received: 15 October 2024 / Revised: 8 November 2024 / Accepted: 15 November 2024 / Published: 22 November 2024
(This article belongs to the Special Issue Advanced Research on Diagnosis and Biological Control of Crop Diseases)
Browse Figures
Review Reports Versions Notes

Abstract

:
Bacterial wilt of tomatoes, caused by Ralstonia solanacearum, is a significant soilborne disease that often causes significant reductions in the yield of tomatoes. Dark septate endophytic fungi (DSE) represent potential biocontrol agents against plant pathogens that can also enhance plant growth. To collect DSE fungi with potential for biocontrol, the fungus Cladophialophora guangxiense HX2 was isolated from the rhizosphere soil of sugarcane in Hengzhou Guangxi Province, China, and a novel species of Cladophialophora was identified based on morphological properties and DNA sequence analysis. C. guangxiense HX2 demonstrated a controlling effect of 76.7% on tomato bacterial wilt and promoted a 0.5-fold increase in tomato seedling height. It colonized tomato seedling roots, enhancing the activity of antioxidant and defensive enzyme systems. Transcriptomic and qPCR approaches were used to study the induction response of the strain HX2 infection by comparing the gene expression profiles. Gene ontology (GO) and Kyoto Encyclopedia of Gene and Genome (KEGG) pathway enrichment revealed that tomatoes can produce salicylic acid metabolism, ethylene-activated signaling, photosynthesis, and phenylpropanoid biosynthesis to the strain HX2 infection. The expression of IAA4 (3.5-fold change), ERF1 (3.5-fold change), and Hqt (1.5-fold change) was substantially enhanced and Hsc 70 (0.5-fold change) was significantly reduced in the treatment group. This study provides a theoretical foundation for further investigation into the potential of C. guangxiense HX2 as a biological agent for the prevention and control of tomato bacterial wilt.

1. Introduction

Tomatoes (Solanum lycopersicum L.) have significant economic value due to their rich nutrients and bioactive compounds such as lycopenes, ascorbic acid, and polyphenols. China has emerged as the global leader in tomato production [1,2,3,4]. However, tomato cultivation faces challenges from diseases caused by various pathogens, including viruses, bacteria, fungi, and root-knot nematodes (Meloidogyne spp.) [5]. Bacterial wilt of tomatoes is a typical vascular disease caused by Ralstonia solanacearum, which has the characteristics of sudden onset, rapid spread, and high mortality rate [6,7]. R. solanacearum was a soilborne bacterium that can be widely transmitted through soil and water, making it difficult to control and causing serious impact on tomato production [8,9]. Control strategies such as chemical bactericides, field sanitation, resistant variety breeding, and cropping system improvements have been employed [10,11,12]. However, the pathogen’s high variability, limited chemical control options, resilience in various environments, and extensive host range make it difficult to manage [13]. Therefore, sustainable, cost-effective, and environmentally friendly biological control methods have been proposed as viable alternatives in recent decades.
Recent studies have demonstrated the efficacy of various antagonistic microorganisms in controlling R. solanacearum. For instance, Sun et al. [14] reported that Bacillus subtilis R31 effectively colonizes the root tissues of tomatoes, thereby reducing the population of R. solanacearum. Similarly, B. velezensis RC116 produces extracellular enzymes and possesses genes involved in antibiotic biosynthesis, which contribute to its ability to manage R. solanacearum infections [15]. Pseudomonas fluorescens VSMKU3054 has been shown to combat R. solanacearum by producing the phytopathogen inhibitor 2,4-diacetylphloroglucinol (DAPG) [9]. While these findings are promising, the majority of research has been conducted on bacterial agents for controlling tomato bacterial wilt, with a notable lack of investigation into the potential role of endophytic fungi in managing this disease. Endophytic fungi, which colonize the internal tissues of plants without causing disease, have garnered significant interest [16]. These fungi are residents within the host plant and play a vital role in bolstering plant immunity. Moreover, they can enhance the host plant’s antioxidant defenses, thereby managing the detrimental effects of excessive reactive oxygen species (ROS) generated and accumulated during periods of stress [17,18].
Dark septate endophytes (DSEs) are a group of endophytic fungi characterized by their melanized hyphae, which colonize the root epidermis and cortex both intracellularly and intercellularly. These fungi are also known to form microsclerotia [19,20]. Extensive research has underscored the pivotal role played by DSEs in enhancing plant resilience to stress and improving metal tolerance [21,22]. The potential of DSE fungi to combat crop diseases has garnered significant attention from the plant protection scientific community. These fungi have demonstrated remarkable efficacy as biocontrol agents against a variety of pathogens. Notably, DSE fungi have been successfully utilized to manage Fusarium wilt in crops such as strawberries, asparagus, banana, and Chinese cabbage, caused by Fusarium oxysporum, and Verticillium wilt in cabbage, caused by Verticillium longisporum [23,24,25,26,27]. Yakti et al. [28] have highlighted that DSEs can extract nutrients from regions inaccessible to plant roots, thereby making these nutrients available to the host plants. However, there is a notable absence of research focusing on the interaction between DSE fungi and tomato bacterial wilt disease to date.
The research focuses on the following aspects: (I) isolate and characterize DSEs from the rhizosphere soil; (II) identified as a new species of Cladophialophora, confirmed through a combination of morphological examinations and molecular sequencing methods; (III) to evaluate the effectiveness of DSE fungi in combating tomato bacterial wilt disease and promoting growth activities, pot experiments were conducted. The research primarily; (IV) investigated the mechanisms by which the fungi colonize tomato roots and elicit changes in the tomato transcriptome, thereby enhancing the plant’s resistance to the disease. Thus, this study aims to evaluate the potential of C. guangxiense HX2 as a biocontrol agent.

2. Material and Methods

2.1. Fungal Isolation and Endophyte Screening

The rhizosphere soil was collected from a sugarcane field in Baihe Town, Heng County, Nanning City, Guangxi Province (22°41′23.24″ N, 109°27′37.36″ E, altitude 60.74 m) using a five-point sampling method on 17 January 2016. The 5 soil samples were taken back to the laboratory as soon as possible and stored at 4 °C.
The tomato seedings were used as bait plants to capture endophytic fungi from soil samples [29]. The tomato seeds were surface disinfected with 75% alcohol, 1% sodium hypochlorite, and sterile water for 30 s, respectively, and then placed on water agar medium (WA) for germination. The rhizosphere soil was mixed with sterilized seedling substrate in a ratio of 2:1 and placed in culture cups. Germinated tomatoes were transplanted into the cups for baiting. After two months, the roots of the tomato seedlings were collected for endophytic fungi isolation after washing by running tap water and surface sterilizing with 75% alcohol, 1% sodium hypochlorite, and sterile water 3 times for 1 min, respectively. Subsequently, sterilized roots were inoculated onto half-strength cornmeal agar medium (8.5 g corn meal agar, 7.5 g bacto agar, for 1 L distilled water) at 25 °C. Hyphae emerging from the root segments were transferred to cornmeal malt yeast agar medium (CMMY, 10 g malt extract, 2 g yeast extract, 8.5 g corn meal agar, 7.5 g bacto agar, for 1 L distilled water). Finally, a total of 142 fungal isolates were obtained and preserved at the Institute of Plant Protection, Guangxi Academy of Agricultural Sciences.
To eliminate saprotrophic and pathogenic fungal isolates, eighteen isolates were selected based on their morphology as representatives from different species or groups of fungi. The endophyte screening on selected isolates was carried out after growing the fungus in 6 cm Petri dishes filled with oatmeal medium (10 g oatmeal, 18 g bacto agar, 1 g MgSO4·7H2O, 1.5 g KH2PO4, 1 g NaNO3, for 1 L distilled water). After the plates were largely covered by fungal colonies, disinfected 2-day-old seedlings of tomatoes were transplanted onto the growing fungal colonies, placed into a sterile plastic pot, and incubated for two weeks at 23 °C, with 18 h:6 h (L:D) and 180 mol m−2 s−2 light intensity. A control group was concurrently maintained without endophytic fungal exposure. Assessed plants were harvested and oven-dried at 40 °C for 48 h. The dry weight of treated plants per plate was taken and compared with control plants. The single best candidate of fungal isolate was defined and selected for the subsequent assay.

2.2. Fungus Identification

2.2.1. Morphological Observation

The endophytic fungi was inoculated onto CMMY to examine its growth and colony morphological characteristics. The observation of the fungal sporulation structure was conducted as follows: A 0.5 cm × 0.5 cm cube of oatmeal agar medium (OMA, 10 g oatmeal, 10 g bacto agar, 1 g MgSO4∙7H2O, 1.5 g KH2PO4, 1 g NaNO3, for 1 L distilled water) inoculated with endophytic fungi was placed on a sterile coverslip over a WA plate and incubated at 28 °C for 14 days. Following this, the plates were moved to a refrigerator set at 4 °C to promote sporulation [30]. Thereafter, the coverslips were removed and observed under an Olympus BX53 microscope.

2.2.2. Molecular Sequencing and Phylogenetic Analysis

The DNA of endophytic fungi was extracted using the Solebol Fungal Genomic DNA Extraction Kit (Solarbio, China). Polymerase chain reaction (PCR) was employed to amplify the internal transcribed spacer (ITS), the large subunit ribosomal RNA gene (LSU), and the small subunit ribosomal RNA gene (SSU). Amplification was conducted with specific primers: ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) for ITS, LROR (ACCCGCTGAACTTAAGC) and LR5 (TCCTGAGGGAAACTTCG) for LSU, and NS1 (GTAGTCATATGCTTGTCTC) and NS4 (CTTCCGTCAATTCCTTTAAG) for SSU [31,32,33,34]. The PCR reaction mixture consisted of 25 µL 2×Easy Taq PCR SuperMix, 1 µL of each forward and reverse primer, 1 µL DNA template, and ddH2O to a final volume of 50 µL. The PCR reaction parameters were as follows: predenaturation at 94 °C for 5 min, followed by 35 cycles with denaturation at 94 °C for 1 min, annealing at 53 °C for 1 min, extension at 72 °C for 1 min, and final extension at 72 °C for 10 min.
The PCR-amplified products were purified and subsequently sequenced by the Beijing Genomics Institute (BGI). Subsequent sequence alignment and the construction of a neighbor-joining phylogenetic tree were carried out using MEGA 6.0, with all available SSU, ITS, and LSU sequences downloaded from the representative Cladophialophora genus in GenBank (Table S1). The Kimura two-parameter model was used for distance estimation, and bootstrap analysis was conducted with 1000 replicates.

2.3. Pot Experiment

2.3.1. Tomato Culture

Tomato seeds (Guihong II: susceptible tomato bacterial wilt) were treated with a 3% sodium hypochlorite solution for 5 min for disinfection. Following disinfection, the seeds were rinsed repeatedly with sterile distilled water [35,36]. Subsequently, the seeds were cultivated in individual pots with a diameter of 10 cm in a greenhouse environment maintained at a temperature of 30 °C, a humidity of 90%, and an illumination schedule of 16 h light to 8 h darkness (L:D ratio).

2.3.2. Effect of Endophytic Fungi on Tomato Growth

The strain HX2 was cultured on PDA medium at 37 °C for 14 d. Then, the colonies were washed with sterile water to collect the spores, and the spore concentration was adjusted to 1 × 108 spores/mL, 1 × 106 spores /mL, and 1 × 104 spores /mL. Tomato plants with similar growth vigor were selected and treated with endophytic fungal fermentation liquid at three concentrations (1 × 108 spores/mL, 1 × 106 spores /mL, 1 × 104 spores /mL) [37], with PDA treatment as the control. Each treatment consisted of three tomato plants, and the experiment was replicated three times for reliability. The height and stem diameter of the tomato plants were measured at 10, 20, and 30 d post-treatment, and root length was measured at 30 d [38].

2.3.3. Effect of Endophytic Fungal Against R. solanacearum Infection on Tomato

The experiment was carried out when the tomato grew to a 4-leaf stage, with an experimental design as shown in Table 1. Each treatment consisted of three tomato plants, and the experiment was replicated three times for reliability. Disease severity was assessed on the 14th day post-treatment, utilizing a 0–4 scale [39]. Subsequently, the disease index and control efficacy were computed using the following formulas:
Disease index = [∑ (The number of diseased plants in this grade × Disease grade) / (Total number of plants investigated × the highest disease grade)] ×100
Control efficacy (%) = [(Disease index of control-Disease index of treated group) / Disease index of control] × 100

2.4. Root Colonization

Endophytic fungi was were cultured on OMA for 10 days. DesinfestedDisinfested tomato seeds were then transplanted into endophytic fungal colonies and placed within tissue culture bottles, accompanying OMA Petri dishes. Subsequently, these were incubated in an illumination incubator at 25 °C, with a light intensity of 180 μmol/(m2·s) and a photoperiod of 16 h/d. A control group was concurrently maintained without endophytic fungal exposure. Following a 14-day co-cultivation period with tomato seedlings, their growth was assessed, subsequent to which the tomatoes were dried and weighed. The tomato seedling roots were then re-isolated to verify the identity of the initial inoculated strain. Moreover, the colonization of endophytic fungial within the tomato seedling roots was observed using an Olympus BX53 microscope, following staining with lactic acid cotton blue.

2.5. Determination of Antioxidant Enzymes Activities

Consistent with Section 2.3.3., leaf samples were obtained from the same plant parts at 0-, 2-, 4-, 6-, 8-, and 10-day intervals post-experimental treatment and assessed for their tomato peroxidase (POD) [40], phenylalanine ammonia-lyase (PAL) [41], polyphenol oxidase (PPO) [42], catalase (CAT) [43], and superoxide dismutase (SOD) [22] activities. Enzyme extractions and activity measurements were performed using a kit from Solarbio: Phenylalanine Ammonialyase (PAL) Assay Kit (Cat#BC0210); Catalase (CAT) Activity Assay Kit (Cat#BC0200); Peroxidase (POD) Activity Assay Kit (Cat#BC0090); Superoxide Dismutase (SOD) Activity Assay Kit (Cat#BC0170); and Polyphenol Oxidase (PPO) Activity Assay Kit (Cat#BC0190).

2.6. Transcriptome Analysis

Transcriptome analyses of tomato roots was conducted by infecting with endophytic fungi. The experiment was initiated 8 d after inoculation of the endophytic fungi and included a non-inoculated control group. Three biological replicates were executed for each treatment, with each replicate consisting of a pooled sample from at least three distinct plants. Following sample collection, each sample was rapidly frozen in liquid nitrogen and then stored at a low temperature in solid carbon dioxide prior to sending it to Shanghai Majorbio Bio-Pharm Technology Co., Ltd., Shanghai, China, for transcriptomic sequencing.
Subsequently, the Illumina platform sequencing was used to obtain the raw reads, which were subjected to quality control to determine the suitability of the sequencing data for subsequent analysis. After quality control, clean reads were obtained by filtration and compared to the reference sequence. In this study, high-quality sequencing data (clean reads) obtained by sequencing were compared and analyzed using the reference genomic sequence of tomatoes. The false discovery rate (FDR) and fold change (FC) are important indices for screening differentially expressed genes (DEGs). The larger the fold change, the smaller the FDR value, indicating that the expression difference is more significant. Meanwhile, FC ≥ 2 and FDR ≤ 0.05 were defined as DEGs with biological duplication. FC ≥ 2 and FDR ≤ 0.005 were defined as DEGs without biological duplication. Volcano, Venn, and bubble diagrams were used to analyze DEGs among samples. Pathway enrichment analysis and functional annotation of DEGs were performed using the Kyoto Encyclopaedia of Genes and Genomes (KEGG) and Gene Ontology (GO) to identify the significantly enriched pathways of tomatoes in response to endophytic fungi and screen out the key candidate genes involved in the main enrichment pathways.

2.7. Quantitative Real-Time PCR

To ensure the reliability of the transcriptome data, primers targeting three disease-resistant genes and one pathogenic gene were designed using data from NCBI (Table 2). Subsequently, qRT-PCR analysis was performed, with reverse transcription conducted using 1 µg of each RNA sample and the Toloscript ALL-in-one RT EasyMix for qPCR (Tolo Biotech Co., Ltd., Nanjing, China). The relative transcript levels of target genes were determined in triplicate using a 7500 Real-Time PCR System. The GAPDH gene was used as the internal control [44], and the data were analyzed employing the 2−∆∆CT method [45,46].

2.8. Statistical Analyses

The data were subjected to a one-way analysis of variance (ANOVA) with SPSS 26.0 software (IBM, New York, NY, USA), and Duncan’s test was used to determine significant differences. Results were presented as the mean ± standard deviation.

3. Results

3.1. Fungal Isolation and Endophyte Screening

The dominant isolated fungi are species of Pestalotiopsis, Colletotrichum, Fusarium, Thrichoderma, Penicillium, Phythium, Caldosporium, and Phomopsis. Most ineffective isolates, once re-inoculated in axenically-grown tomato seedlings, caused extreme yellowing of leaves and suppression of plant growth. Only one of the isolates (strain HX2) did not cause typical external symptoms on leaves, including etiolation. Compared to non-treated control plants, HX2 could stimulate seedling growth, resulting in taller plants and larger leaves (Figure 1a,b). Thus, strain HX2 was selected for further practical usage.

3.2. Taxonomy and Phylogeny

3.2.1. Taxonomy

  • Cladophialophora guangxiense Y.Y. Long, Yanlu Chen and L. Xie, sp. nov. Figure 2
  • MycoBank 855619.
Etym.: The species is named for Guangxi Province, the locality of the type of strain. Asexual morph: The growth of strain HX2 on CMMY was sluggish, with colonies reaching a diameter of 18–20 mm after 14 d culture at 28 °C. Colonies were approximately circular with a color range from gray to dark gray, and exhibited a black border. The colony texture was slightly firm, and the surface was velutinous (Figure 2a). The mycelia of HX2 on OMA were septate and displayed an olivaceous to yellowish-brown color, measuring 1.3–4.4 μm (av. 3.0 ± 0.7 μm, n = 30) in diameter. Conidiogenous cells were terminal or lateral, olivaceous to light yellowish-brown, oblong, cylindrical to somewhat fusiform, (6.0–17.8) × (3.3–6.4) μm [av. (10.7 ± 2.6) × (4.7 ± 0.8) μm, n = 44] (Figure 2b–h). Conidia one-celled, unbranched, occasionally branched, produced in short coherent chains of 2–17, oval, cylindrical to sub-cylindrical in shape, or curled string of sausage-shaped, olivaceous to yellow-brown in color, measuring (4.9–10.5) × (4.0–6.4) μm [av. (6.7 ± 1.2) × (5.1 ± 0.6) μm, n = 37] in diameter. Phialide-like budding cells were occasionally observed, while chlamydospores were absent and the sexual morph remained unknown.
Type: China, Guangxi Province, Hengzhou City, in the sugarcane rhizosphere, 22°41′23.24″ N, 109°27′37.36″E, altitude 60.74 m, January 2016 (holotype, HMAS 353147, ex-type culture CGMCC 41498).
Notes: The strain HX2 is similar to Cladophialophora based on morphological analysis. However, the strain HX2 exhibits a unique species form characterized by non-septate, melanized, curled conidia arranged in coherent and unbranched chains. Therefore, the strain HX2 is a new species of Cladophialophora, and was named as C. guangxiense.

3.2.2. Phylogenetic Analyses

The ITS, LSU, and SSU regions were sequenced for strain HX2 using the NCBI database (http://www.ncbi.nlm.nih.gov/, accessed on 3 August 2023.) and BLAST analysis. Phylogenetic analysis revealed that strain HX2 and C. inabaensis (EUCL1) constituted a monophyletic group, albeit with a statistical support value of only 87%. The similarity of ITS and LSU sequences between HX2 and C. inabaensis (EUCL1) was 92.07% and 98.91%, respectively (Figure 3). This provided further evidence to support that strain HX2 is a new species of Cladophialophora.

3.3. Effect of Strain HX2 on Tomato Growth

To assess the impact of strain HX2 on tomato growth, we measured various parameters, including shoot height, stem diameter at 10, 20, and 30 d post-treatment, and root length at 30 d. As shown in Figure 4, strain HX2 treatments (1 × 108 spores/ mL, 1 × 106 spores/mL, 1 × 104 spores/mL) significantly enhanced tomato root length (Figure 4A), plant height (Figure 4B), and stem diameter (Figure 4C). Notably, the highest effects were observed with the 1 × 106 spores/mL concentration of strain HX2. Consequently, this concentration was selected for subsequent experiments.

3.4. Effect of HX2 Against R. solanacearum Infection on Tomatoes

The control effect of strain HX2 against R. solanacearum infection on tomatoes was displayed in Figure 5. Compared with the control treatment (T4), both strain HX2 (T2) and Thiourea copper (T3) mitigated the disease index, with control effects of 76.7% and 83.3%, respectively (Table 3). Furthermore, there were negligible differences in disease index between treatment T2 and T3. Additionally, tomato plants treated solely with strain HX2 or distilled water (H2O) exhibited no detrimental effects. These findings indicate that strain HX2 enhances the suppression of 70 R. solanacearum in tomato plants.
CK indicates inoculation with ddH2O (30 mL) as a control; T1 indicates inoculation only with the spore suspension of HX2 (1 × 106 spores /mL, 30 mL); T2 indicates simultaneous inoculation with the spore suspension of HX2 (1 × 106 spores /mL, 30 mL) and the bacterial solution of R. solanacearum (1 × 108 CFU /mL, 30 mL); T3 indicates simultaneous inoculation with the Thiediazole copper (20 mg/L, 30 mL) and the bacterial solution of R. solanacearum (1 × 108 CFU /mL, 30 mL); T4 indicates inoculation only with the bacterial solution of R. solanacearum (1 × 108 CFU /mL, 30 mL).

3.5. Strain HX2 Colonization in Roots of Tomatoes

Microscopy examination revealed that the hyphae of HX2 were capable of colonizing the epidermis and cortex cells of the tomato roots (Figure 6a,b). No typical DSE microsclerotia were detected in this study. The successful establishment of the tomato—HX2 symbiosis was confirmed. These findings suggested that the hyphae of strain HX2 could penetrate the cells of tomato roots and establish colonization.

3.6. Determination Antioxidant Enzymes Activities

To determine whether the tomato plant’s defense system is activated in response to strain HX2, activities of five defense enzymes (PAL, PPO, POD, CAT, and SOD) were selected and detected. Compared with the control, the treatment group exhibited significantly elevated activities of these enzymes. Compared to the CK, the T1 group achieved its peak activity on the 8th day, with increases of 2.75-fold, 1.47-fold, 1.80-fold, 1.72-fold, and 1.40-fold, respectively. In the T2 group, the maximum activities were recorded on the 6th day, which were 1.49-fold, 1.13-fold, 1.36-fold, 1.18-fold, and 1.25-fold greater than those in the T4 group on the 8th day. The T1, T3, and T4 groups all reached their peak activities on the 8th day (Figure 7). These findings indicate that inoculation with strain HX2 significantly enhances the enzymatic defense response in tomato plants, thereby enhancing their resistance against R. solanacearum.

3.7. The Results of Transcriptome Analysis

A total of six cDNA libraries were constructed, each with approximately 44 million reads, and the average error rate was found to be 0.025% (Table 4). The correlation coefficients between biological replicate samples treated identically averaged above 0.95, suggesting high-quality RNA-Seq data (Figure 8a). Upon treatment with HX2, plants exhibited differential expression of 18,553 genes, with 1012 upregulated and 1386 downregulated genes (Figure 8b). GO annotation revealed that these DEGs were predominantly categorized into three domains: biological processes (BP), cellular components (CC), and molecular functions (MF). Notably, a significant number of gene products associated with BP, particularly in cellular and metabolic processes, were identified in the HX2-treated group compared to the control (Figure 8c). KEGG pathway analysis further indicated that the DEGs were most enriched within metabolic pathways (Figure 8d). In terms of significant differentially expressed genes between the control and treatment (CK vs. T) groups, enrichment was observed in both GO and KEGG pathways. The top 20 GO terms included processes such as salicylic acid metabolism, ethylene-activated signaling, photosynthesis, and defense response (Figure 9a). In the KEGG pathway, plant hormone signal transduction ranked second, followed by the MAPK signaling pathway and phenylpropanoid biosynthesis in third and fourth place, respectively (Figure 9b). In conclusion, HX2 strain enhances plant resistance to pathogen attacks by regulating intracellular metabolism and activating the plant’s immune response.

3.8. The Results of Quantitative Real-Time PCR

To assess the expression levels of disease-resistant and pathogenic genes across various treatment groups, samples were subsequently subjected to quantitative real-time PCR analysis. The results indicated that the relative expression levels of IAA4, ERF1, and Hqt were significantly upregulated in the HX2 group compared to the control (CK) group, while the expression level of Hsc70 was markedly downregulated in the HX2 group (Figure 10). Notably, the expression of IAA4 (3.5-fold change), ERF1 (3.5-fold change), and Hqt (1.5-fold change) was substantially enhanced in the treatment group. Conversely, the expression of the pathogenic Hsc70 was significantly reduced (0.5-fold change), suggesting a pronounced inhibitory effect of the HX2 conditions on this gene.

4. Discussion

The genus Cladophialophora was first established by Tanapol with C. ajelloi (currently known as C. carrionii) as the type species [47]. At present, a total of 75 known species of Cladophialophora have been validated, accepted, and recorded in this genus in the Index Fungorum, of which 22 taxa were first introduced in 2023 (Available at: http://www.indexfungorum.org, accessed on 7 September 2024). Cladophialophora is a genus of asexual dematiaceous fungi which were characterized by the presence of branched or unbranched conidial chains with hyaline conidial scars produced through blastic conidiogenesis [48,49]. The conidiophores were typically reduced into oblong or cylindrical conidiogenous cells in the majority of Cladophialophora species. However, our collection is morphologically distinct in having non-septate, melanized, curled strings of sausage-shaped conidia produced in coherent and unbranched chains that often arise from oblong, cylindrical to somewhat fusiform conidiogenous cells, and could not be ascribed to any known species, hence C. guangxiense as new taxon is introduced. Molecular phylogeny showed that C. guangxiense strain HX2 formed a distinct clade with C. inabaensis (EUCL1) based on a combined dataset, however, the ITS and LSU sequence similarities between the two types of strains were only 92.07% (476/517) and 98.91% (818/827). Furthermore, C. guangxiense and C. inabaensis were morphologically easy to distinguish from each other by the shape of conidiogenous cells and conidia [oblong, cylindrical to fusiform conidiogenous cells and oval, cylindrical, sub-cylindrical and curled strings of sausage-shaped conidia in C. guangxiense vs. semi macronematous differentiated conidiophores and subglobose (length/breadth ratio <1 to 2:1) conidia in C. inabaensis] [50], which also provides further evidence to support placement of the fungus as a new species within the genus Cladophialophora. C. guangxiense strain HX2 was morphologically similar to C. tortuosa in possession of conidial chains consisting of ellipsoid to ovoid conidia which were often bent [51], however, C. guangxiense strain HX2 and C. tortuosa BA4b006 were in two distinct clades far from each other in the NJ phylogenetic tree in this research, and the ITS and LSU sequence similarities between the two types of strains were only 92.19% (425/461) and 99.03% (819/827), which indicated they were two different species.
Extant research indicates that DSE fungi potentiate plant defenses by mechanisms including intracellular colonization, modulation of metabolic output, and the triggering of systemic acquired resistance [48,52]. Cladophialophora is the dominant species of DSEs, which can colonize in a wider variety of host plants and is largely distributed in various habitats around the world [53]. This research showed that some Cladophialophora species have the ability to promote plant growth. Our study reported that C. guangxiense as a new species plays an active role in tomato growth promotion and disease prevention for the first time in this paper.
Defense enzymes are crucial for plant physiological responses to disease stress [54], including key enzymes such as PAL, PPO, POD, SOD, and CAT. Recent studies have shown that PAL significantly contributes to the reduction of pathogen infection [55]; PPO and POD are involved in the polymerization of polyphenols into lignin and the production of hydroxyproline-containing glycoproteins (HRGP), which aid plants in resisting penetration by pathogens [40]. Additionally, SOD, POD, and CAT participate in the elimination of reactive oxygen species (ROS), initiating downstream processes that involve the ET, jasmonic acid (JA), and SA pathways, and safeguarding rice crops from rice sheath blight damage [56,57]. Our findings demonstrate that pre-colonization of plants with C. guangxiense HX2 enhanced the activities of SOD, POD, and CAT against the pathogen R. solanacearum. Thus, the augmented antioxidant enzyme activities mediated by C. guangxiense HX2 may represent one of the mechanisms by which tomato resistance to bacterial wilt disease is improved.
The strain HX2 has shown potential to colonize tomato roots. The colonization by endophytic fungi can elicit host defenses, which can establish long-term, systemic resistance against a diverse array of pathogens, thereby proving particularly effective in the control of plant diseases [58]. In this study, we employed Illumina sequencing to delve into the molecular underpinnings of tomato resistance induced by strain HX2. Differentially expressed genes between the control (CK) and treatment (T) groups were significantly enriched in GO and KEGG pathways, primarily involving the SA metabolic process, ethylene-activated signaling, plant hormone signal transduction, MAPK signaling, and phenylpropanoid biosynthesis—processes integral to plant defense mechanisms [59].
Hormone-regulated genes are crucial for plant growth, development, and responses to biotic stresses [60]. Key phytohormones in this context include SA, JA, and ethylene [61]. Recently, Kawagoe [62] et al., revealed that the cyclic lipopeptide iturin A activates the SA signaling pathway to induce the defense response in Arabidopsis. Ethylene, upon pathogenic bacterial infestation, upregulates disease resistance-related genes, thereby enhancing plant disease resistance [31,63]. The ERF (ethylene response factor) gene family constitutes plant-specific transcription factors that bind to ethylene-responsive elements and regulate gene expression subsequent to ethylene signaling [64]. MAPK pathways are among the conserved defense-related signaling pathways [65], and studies have shown that MAPK pathways are interconnected with ethylene signaling in plants [63]. Phenylpropanoid metabolism is vital for the production of typical antibacterial compounds, such as phenols, flavonoids, and lignans [66]. PAL, as the rate-limiting enzyme and the initial step in the phenylpropanoid metabolic pathway, is essential for disease defense [40,67]. In this study, the expression of ERF1 and Hqt were substantially enhanced. Zou [68] et al. revealed that ERF1 acts in a positive feedback loop and regulates autophagy activity by transcriptionally activating ATG expression in response to root-knot nematode (RKN) infection. Therefore, to strengthen the plant’s immune response, enabling it to resist damage from root-knot nematodes. Hqt transferases play a crucial role in the synthesis of chlorogenic acid (CGA). CGA possesses antioxidant and antibacterial properties, which can help plants resist pathogen invasion [69,70].
In conclusion, C. guangxiense HX2 colonizes the tomato root system and induces resistance by activating metabolic processes related to salicylic acid, ethylene-mediated signaling, plant hormone transduction, the MAPK pathways, and phenylpropanoid biosynthesis, triggering a comprehensive defense response against pathogen invasion. This research provides a foundational understanding of the molecular underpinnings of C. guangxiense-induced resistance in tomatoes. However, the underlying mechanism remains elusive. This study demonstrates that strain HX2 has the commercialization potential to be used as a biocontrol agent. Future studies may employ additional omics technologies to dissect the intricate molecular mechanisms by which C. guangxiense confers resistance to tomatoes.

5. Conclusions

The fungus C. guangxiense HX2, isolated from sugarcane rhizosphere soil, was a new species of DSE fungus in the genus Cladophialophora. C. guangxiense HX2 could establish a symbiotic relationship with the roots of tomatoes as an endophytic fungus, significantly enhancing the tomatoes’ resistance to bacterial wilt and promoting tomato growth. C. guangxiense HX2 enhanced the activity of antioxidant enzymes (SOD, POD, CAT, PPO, and PAL). Inoculation with HX2 upregulated genes involved in SA metabolism, ethylene-activated signaling, plant hormone signal transduction, MAPK signaling, and phenylpropanoid biosynthesis, while downregulating pathogenic gene expression. Therefore, C. guangxiense HX2 can effectively enhance the resistance of tomatoes to bacterial wilt disease. Consequently, the antagonistic effect of C. guangxiense HX2 against bacterial wilt of tomatoes was heightened. This research sheds light on the mechanisms associated with the improved antagonistic efficacy of microorganisms used for disease control of tomatoes, offering an innovative solution for the prevention of bacterial wilt of tomatoes.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agronomy14122771/s1, Table S1: List of Cladophialophora species used for phylogenetic study.

Author Contributions

Conceptualization, Y.Z. and Z.S.; Methodology, X.W., Y.L., Y.C. and X.J.; Software, X.W., Y.L. and X.J.; Validation, S.N.M. and Y.Z.; Formal analysis, X.W. and Y.C.; Investigation, X.J. and L.X.; Resources, Z.S.; Data curation, X.W., Y.L. and S.N.M.; Writing—original draft, X.W., Y.L., Y.C. and X.J.; Writing—review & editing, X.W., S.N.M., Z.S. and L.X.; Visualization, Y.C. and S.N.M.; Supervision, Y.Z.; Project administration, Y.Z., Z.S. and L.X.; Funding acquisition, Z.S. and L.X. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by Foundation of Guangxi Key Laboratory of Biology for Crop Diseases and Insect Pests (22-035-31-22KF07); Guangxi Science and Technology Plan Key Research and Development Project (Guike AB2319041); Science and Technology development Foundation of Guangxi Academy of Agricultural Sciences, China (Guinongke 2021JM68).

Data Availability Statement

The original contributions presented in this study are included in the article and Supplementary Materials, further inquiries can be directed to the corresponding authors.

Acknowledgments

The authors extend their gratitude to the technical staff from Wuhan Majorbio Bio-pharm Technology Co., Ltd. for technical assistance.

Conflicts of Interest

The authors declared that they have no conflicts of interest in this work. We declare that we do not have any commercial or associative interest that represents a conflict of interest in connection with the work submitted.

References

  1. Li, Q.Q.; Xie, F.; Zhao, Y.M.; Cao, J.K. Inhibitory effect of postharvest yeast mannan treatment on Alternaria rot of tomato fruit involving the enhancement of hemicellulose polysaccharides and antioxidant metabolism. Sci. Hortic. 2021, 277, 109798. [Google Scholar] [CrossRef]
  2. Panno, S.; Davino, S.; Caruso, A.G.; Bertacca, S.; Crnogorac, A.; Mandić, A. A review of the most common and economically important diseases that undermine the cultivation of tomato crop in the mediterranean basin. Agronomy 2021, 11, 2188. [Google Scholar] [CrossRef]
  3. Han, J.; Zhu, J.; Liu, S.; Sun, X.; Wang, S.; Miao, G. Enhancing tomato disease resistance through endogenous antifungal proteins and introduced nematode-targeting dsRNA of biocontrol agent Bacillus velezensis HS-3. Pest Manag. Sci. 2024, 80, 3839–3851. [Google Scholar] [CrossRef] [PubMed]
  4. Zhang, X.; Xin, Y.; Yue, Q. Insight into the mechanisms involved in the improved antagonistic efficacy of Pichia caribbica against postharvest black spot of tomato fruits by combined application with oligochitosan. Postharvest Biol. Technol. 2024, 213, 112968. [Google Scholar] [CrossRef]
  5. Zhang, Y.; Wang, X.Y.; Liang, S.B.; Shi, Y.Y.; Chen, X.L.; Liu, J.Y. Fermentation optimization, fungistatic effects and tomato growth promotion of four biocontrol bacterial strains. Agriculture 2021, 11, 686. [Google Scholar] [CrossRef]
  6. Chamedjeu, R.R.; Masanga, J.; Matiru, V.; Runo, S. Isolation and characterization of Ralstonia solanacearum strains causing bacterial wilt of potato in Nakuru County of Kenya. Afr. J. Biotechnol. 2018, 17, 1455–1465. [Google Scholar]
  7. Mohammed, F.A.; Oloyede, R.A.; Odeseye, O.A. Biological control of bacterial wilt of tomato caused by Ralstonia solanacearum using Pseudomonas species isolated from the rhizosphere of tomato plants. Arch. Phytopathol. Plant Prot. 2020, 53, 1–16. [Google Scholar] [CrossRef]
  8. Cho, H.; Song, E.S.; Lee, Y.K.; Lee, S.; Lee, S.W.; Jo, A.; Lee, B.M.; Kim, J.G.; Hwang, I. Analysis of genetic and pathogenic diversity of Ralstonia solanacearum causing potato bacterial wilt in Korea. Plant Pathol. J. 2018, 34, 23. [Google Scholar] [CrossRef]
  9. Suresh, P.; Rekha, M.; Gomathinayagam, S.; Ramamoorthy, V.; Sharma, M.P.; Sakthivel, P.; Sekar, K.; Valan Arasu, M.; Shanmugaiah, V. Characterization and assessment of 2, 4-Diacetylphloroglucinol (DAPG)-producing Pseudomonas fluorescens VSMKU3054 for the Management of Tomato Bacterial Wilt Caused by Ralstonia solanacearum. Microorganisms 2022, 10, 1508. [Google Scholar] [CrossRef]
  10. Huang, X.; Zhang, N.; Yong, X. Biocontrol of Rhizoctonia solani damping-off disease in cucumber with Bacillus pumilus SQR-N43. Microbiol. Res. 2012, 167, 135–143. [Google Scholar] [CrossRef]
  11. Belova, A.; Narayan, T.; Olkin, I. Methyl bromide alternatives for strawberry and tomato pre-plant uses: A meta-analysis. Crop Prot. 2013, 54, 3. [Google Scholar] [CrossRef]
  12. Shen, T.; Lei, Y.; Pu, X. Identification and application of Streptomyces microflavus G33 in compost to suppress tomato bacterial wilt disease. Appl. Soil Ecol. 2021, 157, 103724. [Google Scholar] [CrossRef]
  13. Kim, B.; Park, A.R.; Song, C.W.; Song, H.; Kim, J.C. Biological control efficacy and action mechanism of Klebsiella pneumoniae JCK-2201 producing meso-2, 3-butanediol against tomato bacterial wilt. Front. Microbiol. 2022, 13, 914589. [Google Scholar] [CrossRef] [PubMed]
  14. Sun, Y.; Su, Y.; Meng, Z.; Zhang, J.; Zheng, L.; Miao, S.; Qin, D.; Ruan, Y.; Wu, Y.; Xiong, L.; et al. Biocontrol of bacterial wilt disease in tomato using Bacillus subtilis strain R31. Front. Microbiol. 2023, 14, 1281381. [Google Scholar] [CrossRef]
  15. Dong, H.; Gao, R.; Dong, Y.; Yao, Q.; Zhu, H. Bacillus velezensis RC116 inhibits the pathogens of bacterial wilt and fusarium wilt in tomato with multiple biocontrol traits. Int. J. Mol. Sci. 2023, 24, 8527. [Google Scholar] [CrossRef]
  16. Newman, D.J.; Cragg, G.M. Endophytic and epiphytic microbes as “sources” of bioactive agents. Front. Chem. 2015, 3, 34. [Google Scholar] [CrossRef]
  17. Khan, A.L.; Hamayun, M.; Kang, S.M.; Kim, Y.H.; Jung, H.Y.; Lee, J.H.; Lee, I.J. Endophytic fungal association via gibberellins and indole acetic acid can improve plant growth under abiotic stress: An example of Paecilomyces formosus LHL10. BMC Microbiol. 2012, 12, 1–14. [Google Scholar] [CrossRef]
  18. Kang, S.M.; Waqas, M.; Khan, A.L.; Lee, I.J. Plant-growth-promoting rhizobacteria: Potential candidates for gibberellins production and crop growth promotion. Use Microbes Alleviation Soil Stress. 2014, 1, 1–19. [Google Scholar]
  19. Zhang, Y.; Li, T.; Zhao, Z. Colonization characteristics and composition of dark septate endophytes (DSE) in a lead and zinc slag heap in Southwest China. Soil Sediment Contam. Int. J. 2013, 22, 532–545. [Google Scholar] [CrossRef]
  20. Zhou, Y.; Zheng, Y.; Li, P. Ectomycorrhizal fungi and dark septate endophyte inoculation improve growth and tolerance of Pinus tabulaeformis under cadmium stress. Pedosphere 2024, 34, 473–483. [Google Scholar] [CrossRef]
  21. Xu, M.; Li, X.; Ye, Q. Occurrence of dark septate endophytes in Phragmites australis in the Baiyang Lake and their resistance to Cd stress. Pedosphere 2024, 34, 484–496. [Google Scholar] [CrossRef]
  22. Li, C.; Zhang, H.; Yang, Q.; Komla, M.G.; Zhang, X.; Zhu, S. Ascorbic acid enhances oxidative stress tolerance and biological control efficacy of Pichia caribbica against postharvest blue mold decay of apples. J. Agric. Food Chem. 2014, 62, 7612–7621. [Google Scholar] [CrossRef] [PubMed]
  23. Narisawa, K.; Usuki, F.; Hashiba, T. Control of Verticillium yellows in Chinese cabbage by the dark septate endophytic fungus LtVB3. Phytopathology 2004, 94, 412–418. [Google Scholar] [CrossRef] [PubMed]
  24. Khastini, R.O.; Ohta, H.; Narisawa, K. The role of a dark septate endophytic fungus, Veronaeopsis simplex Y34, in fusarium disease suppression in Chinese cabbage. J. Microbiol. 2012, 50, 618–624. [Google Scholar] [CrossRef] [PubMed]
  25. Surono, N.K. The inhibitory role of dark septate endophytic fungus Phialocephala fortinii against Fusarium disease on the Asparagus officinalis growth in organic source conditions. Biol. Control 2018, 121, 159–167. [Google Scholar] [CrossRef]
  26. Su, Q.; Xie, L.; Chen, Y.L.; Liao, S.T.; Zhang, Y.; Nong, Q. Screen and identification of biocontrol strain Cladosporium chlorocephalum LS1 against banana Fusarium wilt. Microbiol. China 2019, 46, 3248–3256. [Google Scholar]
  27. Wiwiek, H.; Malek, M.; Surono, K.N. The effectiveness of a dark septate endophytic fungus, Cladophialophora chaetospira SK51, to mitigate strawberry Fusarium wilt disease and with growth promotion activities. Front. Microbiol. 2020, 11, 585. [Google Scholar]
  28. Yakti, W.; Kovács, G.M.; Vági, P. Impact of dark septate endophytes on tomato growth and nutrient uptake. Plant Ecol. Divers. 2018, 11, 637–648. [Google Scholar] [CrossRef]
  29. Narisawa, K.; Tokumasu, S.; Hashiba, T. Suppression of clubroot formation in Chinese cabbage by the root endophytic fungus, Heteroconium chaetospira. Plant Pathol. 1998, 47, 206–210. [Google Scholar] [CrossRef]
  30. Mahmoud, R.S.; Narisawa, K. A new fungal endophyte, Scolecobasidium humicola, promotes tomato growth under organic nitrogen conditions. PLoS ONE 2013, 8, e78746. [Google Scholar] [CrossRef]
  31. Chang, C. Ethylene signaling: The MAPK module has finally landed. Trends Plant Sci. 2003, 8, 365–368. [Google Scholar] [CrossRef] [PubMed]
  32. Cometto, A.; Leavitt, S.D.; Grube, M.; De Hoog, S.; Muggia, L. Tackling fungal diversity in lichen symbioses: Molecular and morphological data recognize new lineages in Chaetothyriales (Eurotiomycetes, Ascomycota). Mycol. Prog. 2023, 22, 53. [Google Scholar] [CrossRef]
  33. Crous, P.W.; Akulov, A.; Balashov, S.; Boers, J.; Braun, U.; Castillo, J.; Delgado, M.A.; Denman, S.; Erhard, A. New and interesting fungi. 6. Fungal Syst. Evol. 2023, 11, 109–156. [Google Scholar] [CrossRef] [PubMed]
  34. Torres-Garcia, D.; García, D.; Réblová, M. Diversity and novel lineages of black yeasts in Chaetothyriales from freshwater sediments in Spain. Persoonia-Mol. Phylogeny Evol. Fungi 2023, 51, 194–228. [Google Scholar] [CrossRef] [PubMed]
  35. Wen, T.Z.; Lu, L.; Wen, Q.N. Isolation, identification and biocontrol mechanisms of endophytic bacterium D61-A from Fraxinus hupehensis against Rhizoctonia solani. Biol. Control 2021, 158, 104621. [Google Scholar]
  36. Xiang-Jia, M.; Rudoviko, M.G.; Shuai, C. Isolation, identification, and biocontrol mechanisms of endophytic Burkholderia vietnamiensis C12 from Ficus tikoua Bur against Rhizoctonia solani. Biol. Control 2023, 178, 105132. [Google Scholar]
  37. Meng, X.J.; Wang, L.Q.; Ma, B.G.; Wei, X.H.; Zhou, Y.; Sun, Z.X.; Li, Y.Y. Screening, identification and evaluation of an acidophilic strain of Bacillus velezensis B4-7 for the biocontrol of tobacco bacterial wilt. Front. Plant Sci. 2024, 15, 1360173. [Google Scholar] [CrossRef]
  38. Ziane, O.S.; Imehli, Z.; Talibi, A.E.Z. Biocontrol of tomato Verticillium wilt disease by plant growth-promoting bacteria encapsulated in alginate extracted from brown seaweed. Int. J. Biol. Macromol. 2024, 276, 133800. [Google Scholar]
  39. Jinbin, W.; Tong, Y.; Chuan, H. Biocontrol of tomato bacterial wilt by a combination of Bacillus subtilis GSJB-1210 and ningnanmycin. Sci. Hortic. 2023, 321, 112296. [Google Scholar]
  40. Li, G.; Meng, F.; Wei, X.; Lin, M. Postharvest dipping treatment with BABA induced resistance against rot caused by Gilbertella persicaria in red pitaya fruit. Sci. Hortic. 2019, 257, 108713. [Google Scholar] [CrossRef]
  41. Assis, J.S.; Maldonado, R.; Munoz, T.; Escribano, M.I.; Merodio, C. Effect of high carbon dioxide concentration on PAL activity and phenolic contents in ripening cherimoya fruit. Postharvest Biol. Technol. 2001, 23, 33–39. [Google Scholar] [CrossRef]
  42. Xu, J.; Zheng, Y.; Peng, D. Bacillus siamensis N-1 improves fruit quality and disease resistance by regulating ROS homeostasis and defense enzyme activities in pitaya. Sci. Hortic. 2024, 329, 112975. [Google Scholar] [CrossRef]
  43. Wang, Y.S.; Tian, S.P.; Xu, Y.; Qin, G.Z.; Yao, H. Changes in the activities of pro-and anti-oxidant enzymes in peach fruit inoculated with Cryptococcus laurentii or Penicillium expansum at 0 or 20 °C. Postharvest Biol. Technol. 2004, 34, 21–28. [Google Scholar] [CrossRef]
  44. Shengyi, B.; Xiaomin, W.; Meng, G. Selection and evaluation of reference genes for quantitative real-time PCR in tomato (Solanum lycopersicum L.) inoculated with Oidium neolycopersici. Agronomy 2022, 12, 3171. [Google Scholar] [CrossRef]
  45. Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
  46. Ye, W.; Liu, T.; Zhang, W. Disclosure of the molecular mechanism of wheat leaf spot disease caused by Bipolaris sorokiniana through comparative transcriptome and metabolomics analysis. Int. J. Mol. Sci. 2019, 20, 6090. [Google Scholar] [CrossRef]
  47. Tanapol, T.; Jaturong, K.; Surapong, K.; Sirasit, S.; Sinang, H.; Chanokned, S.; Saowaluck, T.; Wasu, P.; Saisamorn, L.; Nakarin, S. Research advances in taxonomy, phylogeny, ecology, and distribution of the genus Cladophialophora. Chiang Mai J. Sci. 2024, 51, e2024004. [Google Scholar]
  48. Chang, R.; Wang, Y.; Liu, Y.; Wang, Y.; Li, S.; Zhao, G.; Zhang, S.; Dai, M.; Zheng, X.; Bose, T.; et al. Nine new species of black lichenicolous fungi from the genus Cladophialophora (Chaetothyriales) from two different climatic zones of China. Front. Microbiol. 2023, 14, 1191818. [Google Scholar] [CrossRef]
  49. Hashiba, T.; Narisawa, K. The development and endophytic nature of the fungus Heteroconium chaetospira. FEMS Microbiol. Lett. 2005, 252, 191–196. [Google Scholar] [CrossRef]
  50. Usui, E.; Takashima, Y.; Narisawa, K. Cladophialophora inabaensis sp. nov., a New Species among the Dark Septate Endophytes from a Secondary Forest in Tottori, Japan. Microbes Environ. 2016, 31, 357–360. [Google Scholar] [CrossRef]
  51. Obase, K.; Douhan, G.W.; Matsuda, Y.; Smith, M.E. Cladophialophora floridana and Cladophialophora tortuosa, new species isolated from sclerotia of Cenococcum geophilum in forest soils of Florida, USA. Mycoscience 2015, 1, 26–34. [Google Scholar] [CrossRef]
  52. Narisawa, K. The dark septate endophytic fungus Phialocephala fortinii is a potential decomposer of soil organic compounds and a promoter of Asparagus officinalis growth. Fungal Ecol. 2017, 28, 1–10. [Google Scholar]
  53. War, A.R.; Paulraj, M.G.; Ignacimuthu, S.; Sharma, H.C. Defensive responses in groundnut against chewing and sap-sucking insects. J. Plant Growth Regul. 2013, 32, 259–272. [Google Scholar] [CrossRef]
  54. Tang, J.; Chen, H.; Lin, H.; Hung, Y.; Xie, H.; Chen, Y. Acidic electrolyzed water treatment delayed fruit disease development of harvested longans through inducing the disease resistance and maintaining the ROS metabolism systems. Postharvest Biol. Technol. 2021, 171, 111349. [Google Scholar] [CrossRef]
  55. Singh, R.; Sunder, S.; Kumar, P. Sheath blight of rice: Current status and perspectives. Indian Phytopathol 2016, 69, 340–351. [Google Scholar]
  56. Nakata, M.; Shiono, T.; Watanabe, Y.; Satoh, T. Salt stress-induced dissociation from cells of a germin-like protein with Mn-SOD activity and an increase in its mRNA in a moss, Barbula unguiculata. Plant Cell Physiol. 2002, 43, 1568–1574. [Google Scholar] [CrossRef]
  57. Tarquin, N.; Jan, B.; Franz, B. Pervasive associations between dark septate endophytic fungi with tree root and soil microbiomes across Europe. Nat. Commun. 2024, 15, 159. [Google Scholar]
  58. Xue, Y.; Sun, J.; Lu, F.; Bie, X.; Li, Y.; Lu, Y.; Lu, Z.; Lin, F. Transcriptomic analysis reveals that Bacillomycin D-C16 induces multiple pathways of disease resistance in cherry tomato. BMC Genom. 2023, 24, 218. [Google Scholar]
  59. Kunkel, B.N.; Brooks, D.M. Cross talk between signaling pathways in pathogen defense. Curr. Opin. Plant Biol. 2002, 5, 325–331. [Google Scholar] [CrossRef]
  60. Pieterse, C.M.J.; Dieuwertje, V.D.D.; Christos, Z.; Antonio, L.R.; Van Wees, S.C.M. Hormonal modulation of plant immunity. Annu. Rev. Cell Dev. Biol. 2012, 28, 489–521. [Google Scholar] [CrossRef]
  61. Lazebnik, J.; Frago, E.; Dicke, M.; Van Loon, J.J.A. Phytohormone mediation of interactions between herbivores and plant pathogens. Chem. Ecol. 2014, 40, 730–741. [Google Scholar] [CrossRef] [PubMed]
  62. Kawagoe, Y.; Shiraishi, S.; Kondo, H.; Yamamoto, S.; Aoki, Y.; Suzuki, S. Cyclic lipopeptide iturin A structure-dependently induces defense response in Arabidopsis plants by activating SA and JA signaling pathways. Biochem. Biophys. Res. Commun. 2015, 460, 1015–1020. [Google Scholar] [CrossRef] [PubMed]
  63. Ouaked, F.; Rozhon, W.; Lecourieux, D. A MAPK pathway mediates ethylene signaling in plants. EMBO J. 2003, 22, 6. [Google Scholar] [CrossRef] [PubMed]
  64. Zhou, J.G.; Mu, Q.; Wang, X.Y.; Zhang, J.; Yu, H.Z.; Huang, T.Z. Multilayered synergistic regulation of phytoalexin biosynthesis by ethylene, jasmonate, and MAPK signaling pathways in Arabidopsis. Plant Cell 2022, 34, 3066–3087. [Google Scholar] [CrossRef]
  65. Pedley, K.F.; Martin, G.B. Identification of MAPKs and their possible MAPK kinase activators involved in the Pto-mediated defense response of tomato. J. Biol. Chem. 2004, 279, 49229–49235. [Google Scholar] [CrossRef]
  66. Huang, T.; Li, Y.; Luo, J.; Wang, J.; Cai, Z.; Shen, Y.; Li, Y.; Zhang, W.; Chen, J.; Zhu, L. Hydrogen sulfide enhances resistance to Penicillium italicum by activating phenylpropanoid metabolism in postharvest navel orange fruit. Postharvest Biol. Technol. 2023, 198, 112259. [Google Scholar] [CrossRef]
  67. Liu, C.; Zheng, H.; Sheng, K.; Liu, W.; Zheng, L. Effects of postharvest UV-C irradiation on phenolic acids, flavonoids, and key phenylpropanoid pathway genes in tomato fruit. Sci. Hortic. 2018, 241, 107–114. [Google Scholar] [CrossRef]
  68. Zou, J.; Chen, X.; Liu, C.; Guo, M.; Kanwar, M.K.; Qi, Z.; Yang, P.; Wang, G.; Bao, Y.; Bassham, D.C.; et al. Autophagy promotes jasmonate-mediated defense against nematodes. Nat. Commun. 2023, 14, 4769. [Google Scholar] [CrossRef]
  69. Pu, G.; Zhou, B.; Xiang, F. Isolation and functional characterization of a Lonicera japonica hydroxycinnamoyl transferase involved in chlorogenic acid synthesis. Biologia 2017, 72, 608. [Google Scholar] [CrossRef]
  70. Peng, X.; Li, W.; Wang, W.; Bai, G. Cloning and characterization of a cDNA coding a hydroxycinnamoyl-CoA quinate hydroxycinnamoyl transferase involved in chlorogenic acid biosynthesis in Lonicera japonica. Planta Medica 2010, 76, 1921–1926. [Google Scholar] [CrossRef]
Agronomy 14 02771 g001
Figure 1. Tomato–HX2 (C. guangxiense) symbiont. (a): Co-culture results of strain HX2 and tomato seedlings. (b): Tomato seedling dry weight. CK: Tomato cultured on PDA; HX2: Tomato treated with strain HX2. Bars indicate the standard error of the mean. Columns marked with the same letter are not significantly different according to Duncan’s Multiple Range Test at p ≤ 0.05.
Figure 1. Tomato–HX2 (C. guangxiense) symbiont. (a): Co-culture results of strain HX2 and tomato seedlings. (b): Tomato seedling dry weight. CK: Tomato cultured on PDA; HX2: Tomato treated with strain HX2. Bars indicate the standard error of the mean. Columns marked with the same letter are not significantly different according to Duncan’s Multiple Range Test at p ≤ 0.05.
Agronomy 14 02771 g001
Agronomy 14 02771 g002
Figure 2. Morphology of endophytic fungi Cladophialophora guangxiense HX2. (a): Colony on CMMY after 2 weeks at 28 °C. (b,c): Lateral conidiogenous cells and oval conidial chains on OMA after 3 weeks at 28 °C. (d–f): Curled string of sausage-shaped conidial chains on OMA after 3 weeks at 28 °C. (g): Cylindrical to sub-cylindrical conidial chains on OMA after 3 weeks at 28 °C. (h): Solitary conidiophores and oval conidial chains on OMA after 3 weeks at 28 °C. (i): Budding cells on OMA after 3 weeks at 28 °C. Scale bars 20 μm.
Figure 2. Morphology of endophytic fungi Cladophialophora guangxiense HX2. (a): Colony on CMMY after 2 weeks at 28 °C. (b,c): Lateral conidiogenous cells and oval conidial chains on OMA after 3 weeks at 28 °C. (d–f): Curled string of sausage-shaped conidial chains on OMA after 3 weeks at 28 °C. (g): Cylindrical to sub-cylindrical conidial chains on OMA after 3 weeks at 28 °C. (h): Solitary conidiophores and oval conidial chains on OMA after 3 weeks at 28 °C. (i): Budding cells on OMA after 3 weeks at 28 °C. Scale bars 20 μm.
Agronomy 14 02771 g002
Agronomy 14 02771 g003
Figure 3. NJ phylogenetic tree based on the combined sequences ITS+LSU+SSU of Cladophialophora species. Bootstrap values > 50% are shown at nodes. Cyphellophora reptans CBS 113.85 was used as an outgroup. T: type strain. The isolated strain of this study is indicated in bold. The bar indicates 0.02 nucleotide substitutions per site.
Figure 3. NJ phylogenetic tree based on the combined sequences ITS+LSU+SSU of Cladophialophora species. Bootstrap values > 50% are shown at nodes. Cyphellophora reptans CBS 113.85 was used as an outgroup. T: type strain. The isolated strain of this study is indicated in bold. The bar indicates 0.02 nucleotide substitutions per site.
Agronomy 14 02771 g003
Agronomy 14 02771 g004
Figure 4. The effect of spore suspension from strain HX2 at different concentrations on tomato growth parameters. This figure illustrates the differences in root length plant height and stem diameter between the treated and control groups. C1: 1 × 108 spores/ mL spore suspension of strain HX2 C2: 1 × 106 spores/mL spore suspension of strain HX2 C3: 1 × 104 spores/mL spore suspension of strain HX2 ck: H2O. (A): Potted Plant Experiment. (B): Root length. (C): Plant height. (D): Stem diameter. Bars indicate the standard error of the mean. Columns marked with the same letter are not significantly different according to Duncan’s Multiple Range Test at p ≤ 0.05.
Figure 4. The effect of spore suspension from strain HX2 at different concentrations on tomato growth parameters. This figure illustrates the differences in root length plant height and stem diameter between the treated and control groups. C1: 1 × 108 spores/ mL spore suspension of strain HX2 C2: 1 × 106 spores/mL spore suspension of strain HX2 C3: 1 × 104 spores/mL spore suspension of strain HX2 ck: H2O. (A): Potted Plant Experiment. (B): Root length. (C): Plant height. (D): Stem diameter. Bars indicate the standard error of the mean. Columns marked with the same letter are not significantly different according to Duncan’s Multiple Range Test at p ≤ 0.05.
Agronomy 14 02771 g004
Agronomy 14 02771 g005
Figure 5. Effect of HX2 on the control of R. solanacearum in tomatoes.
Figure 5. Effect of HX2 on the control of R. solanacearum in tomatoes.
Agronomy 14 02771 g005
Agronomy 14 02771 g006
Figure 6. C. guangxiense HX2 colonized in the roots of tomato seedlings. (a,b): the colonization of endophytic fungal within the tomato root tissue was observed using an Olympus BX53 microscope, following staining with lactic acid cotton blue. Intracellular (black arrows) and intercellular (red arrows) colonization of hyphae.
Figure 6. C. guangxiense HX2 colonized in the roots of tomato seedlings. (a,b): the colonization of endophytic fungal within the tomato root tissue was observed using an Olympus BX53 microscope, following staining with lactic acid cotton blue. Intracellular (black arrows) and intercellular (red arrows) colonization of hyphae.
Agronomy 14 02771 g006
Agronomy 14 02771 g007
Figure 7. Effect of strain HX2 on activities of antioxidant and defense−related enzymes in leaves of tomato plants. Antioxidant enzymes including phenylalanine ammonia−lyase (PAL) (A), peroxidase (POD) (B), and superoxide dismutase (SOD) (C). Defense−related enzymes including polyphenol oxidase (PPO) (D) and catalase (CAT) (E). CK: sterile water. T1: HX2; T2: HX2+ R. solanacearum; T3: Thiediazole copper + R. solanacearum; T4: R. solanacearum. Bars indicate the standard error of the mean.
Figure 7. Effect of strain HX2 on activities of antioxidant and defense−related enzymes in leaves of tomato plants. Antioxidant enzymes including phenylalanine ammonia−lyase (PAL) (A), peroxidase (POD) (B), and superoxide dismutase (SOD) (C). Defense−related enzymes including polyphenol oxidase (PPO) (D) and catalase (CAT) (E). CK: sterile water. T1: HX2; T2: HX2+ R. solanacearum; T3: Thiediazole copper + R. solanacearum; T4: R. solanacearum. Bars indicate the standard error of the mean.
Agronomy 14 02771 g007
Agronomy 14 02771 g008aAgronomy 14 02771 g008b
Figure 8. DEG analyses of tomatoes with HX2 vs. PDA inoculation. (a): The module clusters and their relationships. (b): Volcano plots (the abscissa indicates the multiple changes of gene expression in different samples (log2FoldChange), and the ordinate indicates the significant level of expression difference (−log10padj); upregulated genes are represented by red dots and downregulated genes by blue dots). (c): Gene Ontology (GO) annotation category statistics. (d): Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway classification statistic. ((c,d): The abscissa is the Term, and the ordinate is the number of genes annotated to the Term).
Figure 8. DEG analyses of tomatoes with HX2 vs. PDA inoculation. (a): The module clusters and their relationships. (b): Volcano plots (the abscissa indicates the multiple changes of gene expression in different samples (log2FoldChange), and the ordinate indicates the significant level of expression difference (−log10padj); upregulated genes are represented by red dots and downregulated genes by blue dots). (c): Gene Ontology (GO) annotation category statistics. (d): Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway classification statistic. ((c,d): The abscissa is the Term, and the ordinate is the number of genes annotated to the Term).
Agronomy 14 02771 g008aAgronomy 14 02771 g008b
Agronomy 14 02771 g009
Figure 9. Enrichment analysis of tomatoes with HX2 vs. PDA inoculation. (a): Gene Ontology (GO) enrichment analysis. (b): Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis. Circle size represents the number of enriched genes. The X axis displays the enrichment factor.
Figure 9. Enrichment analysis of tomatoes with HX2 vs. PDA inoculation. (a): Gene Ontology (GO) enrichment analysis. (b): Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis. Circle size represents the number of enriched genes. The X axis displays the enrichment factor.
Agronomy 14 02771 g009
Agronomy 14 02771 g010
Figure 10. The effect of strain HX2 on the expression level of disease-resistant and pathogenic genes by quantitative reverse-transcription PCR analysis. Relative expression levels of (a) IAA4, (b) ERF1, (c) Hqt, and (d) Hsc70 in the root of tomatoes through treatment with strain HX2 and sterile water (CK). Error bars represent mean standard deviation of triplicate experiments. ** p < 0.05 *** p < 0.001.
Figure 10. The effect of strain HX2 on the expression level of disease-resistant and pathogenic genes by quantitative reverse-transcription PCR analysis. Relative expression levels of (a) IAA4, (b) ERF1, (c) Hqt, and (d) Hsc70 in the root of tomatoes through treatment with strain HX2 and sterile water (CK). Error bars represent mean standard deviation of triplicate experiments. ** p < 0.05 *** p < 0.001.
Agronomy 14 02771 g010
Table 1. Determination and treatment of the effect of biocontrol strain on tomato bacterial wilt.
Table 1. Determination and treatment of the effect of biocontrol strain on tomato bacterial wilt.
TreatmentInoculationInoculation After 7 d
CK----
T1HX2 (1 × 106 spores /mL)--
T2HX2 (1 × 106 spores /mL)R. solanacearum (1 × 108 CFU /mL)
T3Thiediazole copper (Jiangsu Huifeng Bio-agriculture Co., Ltd., Jiangsu, China, 20 mg/L)R. solanacearum (1 × 108 CFU /mL)
T4--R. solanacearum (1 × 108 CFU /mL)
Table 2. Sequences of primer sets used in this study.
Table 2. Sequences of primer sets used in this study.
PrimersSequence (5′->3′)LengthTmGCProduct Length
ERF1GAAAGAGGCCATGGGGTAAA2057.4750.00150
GTAGAGACCAAGGACCCCTCA2160.2757.14
IAA4AACAAGAGGGCTTTGCCTGA2059.8150.00160
TCCCACATTCAGCTTCTGCTT2159.9347.62
HqtAATCGCGAGTCCAGTACCAC2059.8355.00226
CTAGGTAACCCGGTGGCAAG2060.1160.00
Hsc70ATTCTTGTGTCGGCGTTTGG2059.4150.00203
AGACGCATCACTGAACCTCC2059.7555.00
GAPDHACCACAAATTGCCTTGCTCCCTTG24------
ATCAACGGTCTTCTGAGTGGCTGT24----
Table 3. Control effect of HX2 against tomato bacterial wilt.
Table 3. Control effect of HX2 against tomato bacterial wilt.
NumberTreatmentDisease
Index		Control Effect/%
CKH2O5.0 ± 1.2 c--
T1HX25.5 ± 1.3 c--
T2HX2+ R. solanacearum12.5 ± 2.1 b76.7 ± 9.9% b
T3Thiediazole copper + R. solanacearum17.5 ± 1.9 b83.3 ± 9.7% a
T4R. solanacearum75.0 ± 8.9 a--
Numerical values were mean ± SD of triplicates; Means were tested with Duncan’s Multiple Range Test. Means followed by the same letter are not significantly different (p ≤ 0.05) within the same column.
Table 4. Description of RNA sequences from CK or HX2-treated tomato roots.
Table 4. Description of RNA sequences from CK or HX2-treated tomato roots.
SampleRaw ReadsClean Reads Error Rate
(%)		Q30
(%)		GC Content
(%)
CK-147,982,21847,518,1340.025794.9342.96
CK-253,646,11053,108,9160.025695.0242.95
CK-357,158,11856,584,4760.025695.0543.13
T-149,639,45449,147,6420.025894.8943.37
T-244,060,60643,574,5680.025794.8943.31
T-346,153,87045,699,2140.025295.343.29
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wei, X.; Long, Y.; Chen, Y.; Mataka, S.N.; Jiang, X.; Zhou, Y.; Sun, Z.; Xie, L. Cladophialophora guangxiense sp. nov., a New Species of Dark Septate Endophyte, Mitigates Tomato Bacterial Wilt and Growth Promotion Activities. Agronomy 2024, 14, 2771. https://doi.org/10.3390/agronomy14122771

AMA Style

Wei X, Long Y, Chen Y, Mataka SN, Jiang X, Zhou Y, Sun Z, Xie L. Cladophialophora guangxiense sp. nov., a New Species of Dark Septate Endophyte, Mitigates Tomato Bacterial Wilt and Growth Promotion Activities. Agronomy. 2024; 14(12):2771. https://doi.org/10.3390/agronomy14122771

Chicago/Turabian Style

Wei, Xihong, Yanyan Long, Yanlu Chen, Stanley Nyenje Mataka, Xue Jiang, Yi Zhou, Zhengxiang Sun, and Ling Xie. 2024. "Cladophialophora guangxiense sp. nov., a New Species of Dark Septate Endophyte, Mitigates Tomato Bacterial Wilt and Growth Promotion Activities" Agronomy 14, no. 12: 2771. https://doi.org/10.3390/agronomy14122771

APA Style

Wei, X., Long, Y., Chen, Y., Mataka, S. N., Jiang, X., Zhou, Y., Sun, Z., & Xie, L. (2024). Cladophialophora guangxiense sp. nov., a New Species of Dark Septate Endophyte, Mitigates Tomato Bacterial Wilt and Growth Promotion Activities. Agronomy, 14(12), 2771. https://doi.org/10.3390/agronomy14122771

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop