Next Article in Journal
Synergistic Ability and Effect of Leaf Color and Leaf Thickness to Improve the Photosynthetic Performance of Wheat
Previous Article in Journal
Effects of Hydrothermal Carbonization Conditions on the Characteristics of Hydrochar and Its Application as a Soil Amendment: A Review
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 15
Issue 2
10.3390/agronomy15020326
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Different Nursery Substrates on the Growth Physiology and Rhizosphere Microorganisms of Two Species of Ornamental Bamboo

by
Menglian Yang
,
Mingyan Jiang
*,
Yixuan Quan
,
Meng Yang
,
Zhi Li
,
Jieying Yao
,
Kaiqing Wang
,
Zhenghua Luo
and
Qibing Chen
College of Landscape Architecture, Sichuan Agricultural University, Chengdu 611130, China
*
Author to whom correspondence should be addressed.
Agronomy 2025, 15(2), 326; https://doi.org/10.3390/agronomy15020326
Submission received: 12 December 2024 / Revised: 16 January 2025 / Accepted: 24 January 2025 / Published: 27 January 2025
(This article belongs to the Section Soil and Plant Nutrition)
Browse Figures
Versions Notes

Abstract

:
The cultivation of ornamental bamboos in pots and gardens has a higher demand for light and clean cultivation substrates, and the effects of such cultivation substrates on the growth of ornamental bamboos are rarely seen. In this study, we compared the effects of physicochemical properties of different cultivation substrates on the growth physiology of ornamental bamboos and analysed the composition of rhizosphere microbial communities by cultivating Pleioblastus chino f. holocrysa (PC), and Arundinaria fortune (AF), in both common soil (CS) and soilless substrate (SS). In PC and AF, compared to biomass at the start of cultivation the aboveground biomass of CS and SS increased by 13.71% and 0.81%, the root biomass increased by 16.01% and 25.52%, and the bamboo whip biomass decreased by 29.72% and 24.75% at the end of the cultivation. In both PC and AF, the abundance of Proteobacteria in SS (42.28% and 48.42%, respectively) was higher than in CS (38.52% and 34.92%, respectively), the abundance of Ascomycota in SS (76.55% and 87.89%, respectively) was higher than that of CS (72.46% and 68.80%, respectively), the abundance of Bacteroidota in SS (10.35% and 9.16%, respectively) was higher in CS (7.42% and 7.61%, respectively), and was positively correlated with organic matter and available nitrogen, phosphorus, and potassium. The abundance of beneficial microbial genera (Haliangium, Acidibacter, BIrii41, Pseudeurotium) increased in SS, and the abundance of pathogenic fungi Fusarium in SS (1.87% and 0.10%, respectively) was lower than in CS (3.97% and 3.10%, respectively). Taken together, the results reveal that SS increased the growth of aboveground parts of ornamental bamboo, inhibited the growth of bamboo whips, and reduced the allocation of biomass to foraging organs compared with CS. The increase in beneficial microbial genera promoted the development of the root system and the accumulation of nitrogen, phosphorus, and potassium in the leaves of ornamental bamboo, and the decrease in pathogenic genera lowered the risk of disease infection in the ornamental bamboo.

1. Introduction

The use of organic and inorganic materials and microbial agents formulated to meet the needs of seedling growth of high-quality soil or soilless substrate is nursery substrate [1,2]. Generally, with soil and other substances, a fertilizer-formulated substrate is called soil substrate; it does not contain natural soil, but with peat, vermiculite, perlite, and other artificial or natural materials, the formulated substrate is called soilless substrates [3]. Soilless substrate releases more nutrients for plant growth in a shorter period of time than soil, and the use of soilless substrate for cultivation also prevents the occurrence of soil-borne diseases in traditional plant cultivation [4]. Ornamental bamboo cultivation in pots and gardens has a higher demand for light, clean nursery substrates. However, little research has been conducted on the frontiers of soilless substrates for ornamental bamboo and they have not been put into production. The contradiction between the market demand for high-quality ornamental bamboo resources and common soil cultivation methods is becoming increasingly prominent. We used two substrates to compare the growth of ornamental bamboo. The two substrates have two compositions; one substrate is the soil commonly used for potting ornamental plants, i.e., a nutrient soil: garden soil = 1:1 (v/v) mix, where the garden soil is taken from uncultivated farmland, so the nutrient-rich soil with preserved leafy soil as the main ingredient is added on top of this to improve the nutrient status of the garden soil. Another type of substrate is the addition of coir to the commonly used substrate formula peat:perlite:vermiculite = 3:1:1 [5,6] to increase the amount of air in the substrate and reduce the use of peat.
The physical and chemical properties of raw materials or properly formulated soilless substrates are more conducive to plant growth than those of common soil [7]. The root system is an important organ for plants to absorb water and nutrients, and two physical properties of nursery substrates, bulk density and porosity, are important factors affecting plant root growth [8]. The root biomass of tomato seedlings is significantly reduced in traditional soil with high bulk density and low porosity [9], whereas soilless substrates are able to achieve a more suitable range of porosity and bulk density (70% to 90% and 0.20 to 0.60 g/cm3, respectively) for root growth through reasonable ratios [10,11]. Among the chemical properties, the contents of nitrogen, phosphorus, and potassium in the nursery substrate can reflect its nutrient supply capacity [12,13], of which available nitrogen, phosphorus, and potassium are more easily absorbed and utilised directly by plants and are inseparable from plant growth and development [14]. Studies have shown that, compared with common soil, soilless substrates contain greater contents of available nitrogen, available phosphorus, and available potassium, which are more conducive to the accumulation of leaf nitrogen, phosphorus, and potassium in kiwifruit rootstock seedlings [15]; the accumulation of nutrients in tomato fruits; and yield [16]. In addition, the organic matter in the nursery substrate can continuously provide nutrients to plants in a short period of time, and the higher organic matter content in soilless substrate can significantly increase the height of plants and the diameter at the ground level of maize compared with soil [17].
There is an interrelationship between rhizosphere microbial community composition and plant growth physiology and the physicochemical properties of nursery substrates [4,18]. The nitrogen content in the nursery substrate is a key factor influencing the composition of the rhizosphere microbial community [19], while phosphorus cycling and phosphorus transformation in the nursery substrate are in turn driven mainly by the rhizosphere microbial community [20]. Studies on aubergine substrates [21] revealed that soilless substrates (coir and peat substrates) were significantly enriched with species of the phylum Proteobacteria and the phylum Actinobacteria compared with soil. Among them, Proteobacteria and Ascomycetes can promote nitrogen cycling and increase the efficiency of phosphorus uptake by plants in nursery substrates [22], whereas Actinobacteriota favours the decomposition of organic matter in cultivation substrates and resistance to pathogenic microorganisms [23].
Pleioblastus chino f. holocrysa and Arundinaria fortunei are both valuable ornamental bamboos with yellow striped leaves and yellow stalks. They are small in size and are suitable for potted plants and garden applications. The cultivation of ornamental bamboo in pots and gardens has a higher demand for light and clean substrates, and the effects of such substrates on the growth of ornamental bamboo has rarely been seen, so there is an urgent need for research to reveal the physicochemical properties, rhizosphere microorganisms, and their effects on the growth and physiology of ornamental bamboo. In this study, we investigated the advantages of soilless substrates over soils in terms of physicochemical properties and rhizosphere microbial community composition, as well as their effects on the growth and physiology of ornamental bamboo.

2. Materials and Methods

2.1. Experimental Materials and Design

The experiment was carried out at the experimental base of the College of Landscape Architecture, Sichuan Agricultural University, and the ornamental bamboo test materials included the dwarf cultivated Pleioblastus chino f. holocrysa (PC) and Arundinaria fortunei (AF). After PC is dwarfed, the plant height is 15–30 cm, and the leaf blade has golden stripes. The AF plant height is 10–15 cm, and the leaf blade is yellowish or has white longitudinal stripes. Both species have beautiful bamboo clusters and are of high ornamental value.
Two types of nursery substrates were used in the experiment: common soil (CS) and soilless substrate (SS). CS was an air-dried mixture of garden soil:nutrient soil (1:1; v/v), which was taken from the uncultivated farmland around the campus of Sichuan Agricultural University in Chengdu, China., and the nutrient soil was purchased from the flower and tree market. SS was prepared with peat, coir, vermiculite, and perlite. Peat:Vermiculite:Perlite = 3:1:1 (v/v/v) is a commonly used formula for the soilless substrate cultivation of other plants [5,6]. The extensive use of peat as a nursery substrate has led to the destruction of ecologically important peat bogs and the need to find sustainable and suitable alternatives [24]. In some experiments, the use of coconut husk to replace the peat has achieved good results [25,26]; therefore, in the present experiment, on the basis of the ratio of peat:vermiculite:perlite = 3:1:1 (v/v/v), the addition of coco coir was comparable to the proportion of peat and did not change the ratio of vermiculite and perlite, and the final SS proportion was as follows: coconut husk:peat:vermiculite:perlite = 3:3:2:2 (v/v/v/v), of which, the peat was obtained from Shandong Guangsu Agricultural Science and Technology Co., Ltd. (Linyi, China); the coco husk was obtained from Shijiazhuang Hangqian Trade Co., Ltd. (Shijiazhuang, China) and the vermiculite and perlite were obtained from Xuzhou Mengmeng Meat Horticulture Co., Ltd. (Xuzhou, China)
The trial was conducted from March to December 2023 in a two-factor, two-level randomised block design with a total of four treatments of two nursery substrates in a crossover configuration with two bamboo species: Pleioblastus chino f. holocrysa (PC)and Arundinaria fortune (AF) in common soil (CS), recorded as CSPC and CSAF, respectively, and Pleioblastus chino f. holocrysa (PC) and Arundinaria fortune (AF) in soilless substrate (SS), recorded as SSPC and SSAF, respectively. In the early part of March (before the shoot emergence of the bamboo plantlets), healthy mother bamboo of equal sizes was selected and divided into several rooted plantlets via split propagation, with 5–7 plantlets planted in each pot. Each plantlet was picked up with its root system, rinsed with water to ensure that the roots did not carry the original soil, pruned appropriately to ensure that the biomass of the above and belowground parts was the same, soaked with the rooting agent NAA(1-Naphthaleneacetic acid):IBA(Indolebutyric acid) = 1:1 (250 ppm) for 10 min, and then transplanted to the prepared nursery substrates. Each treatment was planted in 20 pots that were 10 cm in diameter and 8 cm in height, which were transferred to the greenhouse for uniform management without fertilisation. Irrigation in the form of spraying was done at 1-day intervals in summer and 2-day intervals in winter. The greenhouse temperature was 15–28 °C and had a relative humidity of 65–75%.

2.2. Physicochemical Properties of Nursery Substrates

Before (March 2023) and after the cultivation period (December 2023), the nursery substrates were mixed well and dried naturally (after determining the bulk density), and their physicochemical properties were determined, in which the background value (BV) was determined before planting. The physical properties of the substrate were determined via the ring knife method [27,28]. The pH was determined via the immersion electrode method [29], the organic matter content was determined via the potassium dichromate oxidation method [28], the available nitrogen content was determined via the alkaline dissolution and diffusion methods with reference to LY/T1228-2015 [29], the available phosphorus content was determined via the molybdenum antimony colorimetric method with reference to LY/T1232-2015 [30], and the available potassium content was determined via the provisions of LY/T1234-2015 via the ammonium acetate solution leaching method [31].

2.3. Growth Physiology Indicators of Ornamental Bamboo

In December 2023, in each treatment, three pots with medium growth were selected for growth and physiological indicators. Biomass: The washed bamboo clusters in each pot were divided into four trophic organs, namely, roots, whips, stems, and leaves, dried to a constant weight, and weighed separately to determine the biomass of each trophic organ. The net photosynthetic rate (Pn) of the leaves was determined via a photosynthesis analyser (LI-6400, LI-COR Inc., Lincoln, NE, USA). Chlorophyll was extracted via acetone extraction [32]. Leaf total nitrogen was extracted via H2SO4-H2O2 digestion [33]. Leaf total phosphorus was determined via the vanadium–molybdenum yellow colorimetric method [34]. Leaf total potassium was determined via the flame photometric method [35].

2.4. Rhizosphere Microorganisms

Three pots of plants with consistent growth were selected, and the pots were tapped to remove most of the substrate first. The roots were lightly shaken, and the rhizosphere nursery substrate was mixed well and loaded into three 50-mL sterile centrifuge tubes, which were quickly placed in dry ice for preservation and transportation, then put into a −80 °C refrigerator, and finally kept in an ice box and sent to Personalbio Biotechnology, Ltd. (Shanghai, China) in Shanghai for sequencing. Nucleic acids were extracted via an OMEGA Soil DNA Kit (D5635-02) (Omega Bio-Tek, Norcross, GA, USA). The extracted DNA was subjected to 0.8% agarose gel electrophoresis for molecular size determination, and the DNA was quantified via Nanodrop. PCR amplification was performed via primers specific for the bacterial 16SrRNA-V3-V4 region; 338F (5′-barcode + ACTCCTACGGGGAGGCAGCA-3′), 806R (5′-GGACTACHV-GGGTWTCTAAT-3′), and fungal ITS1 region primers ITS5 (GGAAGTAAAAGTCGTAACAAG-G) and ITS2 (GCTGCGTTCTTCATCGATGC) were amplified and sequenced; and the PCR products were quantified on a microplate reader (BioTek (BioTek Instruments, Inc., Winooski, VT, USA), FLx800) using the QuantiT PicoGreen ds-DNA Assay Kit (Suzhou Rynolds Biotechnology Co., Suzhou, China) and then mixed according to the amount of data required for each sample. Library construction was performed via Illumina’s TruSeq Nano DNA LT Library Prep Kit (Illumina, Inc., San Diego, CA, USA),. Finally, 2-duplex sequencing was performed on an Illumina NovaSeq (PE250 Duplex Sequencing) instrument (Illumina, Inc., San Diego, CA, USA).

2.5. Statistical Analysis

Multiple comparisons of the different treatments were performed via IBM SPSS Statistics 22.0, and the significance of the differences was determined using Duncan’s multiple comparison test via a one-way ANOVA. A level of p ≤ 0.05 indicated that the differences reached statistical significance. Alpha diversity was checked via the QIIME2(2019.4) programme. With the use of QIIME2 software, composition and abundance tables were generated for each sample at the phylum and genus classification levels, and the results of the analysis are presented in bar charts. Correlation analysis was performed via Spearman’s algorithm.

3. Results

3.1. Physical and Chemical Properties of the Two Nursery Substrates

Figure 1a–c shows that after cultivating ornamental bamboo, the bulk weight of CS and SS increased (CS increased by 7.92% and 2.02% for PC and AF, respectively; SS increased by 8.34% and 9.17%, respectively), the aeration porosity of CS and SS increased (CS increased by 10.92% and 10.87%, SS increased by 14.72% and 15.22%, respectively), the total porosity decreased (CS decreased by 6.10% and 0.81%, SS decreased by 0.03% and 8.98%, respectively), where the total and aeration porosity of SS was greater than that of CS, while the bulk weight was significantly lower than that of CS (p < 0.05). Figure 1d shows that the pH of both of the ornamental bamboo was significantly lower in SS than in CS (p < 0.05). The changes in available nitrogen, phosphorus, and potassium in different substrates before and after the cultivation of ornamental bamboo are shown in Figure 1e–h, and the contents of organic matter, available nitrogen, available phosphorus and available potassium in the two kinds of ornamental bamboo were significantly greater in the SS than in the CS (p < 0.05). As a whole, between CS and SS there are big differences. Between before planting and after cultivation, the differences are minor.

3.2. Ornamental Bamboo Growth and Physiological Indicators

As shown in Figure 2a, the total biomass of PC was not significantly different between the two substrates, and the total biomass of AF in SS was significantly greater than that in CS (p < 0.05). Figure 2b,c show the biomass share of each organ of PC and AF, respectively, and both of the ornamental bamboo had higher root biomass and lower whip biomass in SS compared with those in CS. Among them, compared to CS, the root biomass of PC and AF in SS increased by 16.01% and 25.52%, respectively, and the whip biomass decreased by 29.72% and 24.75%, respectively. As shown in Figure 2d,e, the diameter at ground level and height of the plants of the two types of ornamental bamboo in SS were greater than those in CS. Figure 2f,g indicate that the net photosynthetic rate and chlorophyll content of the two kinds of ornamental bamboo in SS were greater than those in CS and that the chlorophyll content in SS was significantly greater than that in CS. Figure 2h–j show the nutrient contents of the leaves of the two kinds of ornamental bamboo under different substrates. The total nitrogen, total phosphorus, and total potassium contents were higher in SS compared with those in CS. The total phosphorus and total potassium contents were greater in SS than those in CS, among which the total nitrogen content of the two ornamental bamboo leaves in SS was significantly greater than that in CS (p < 0.05). The total phosphorus and total potassium contents of the ornamental bamboo PC leaves were significantly greater in SS than those in CS (p < 0.05).

3.3. Rhizosphere Microbes

3.3.1. Bacteria

As shown in Figure 3a, the differences between bamboo species were smaller than the differences in the bacterial communities in different substrates, and the bacterial α diversity (Chao1 and Shannon) of both ornamental bamboos in SS did not show an advantage over that in CS. As shown in Figure 3b,c, there were 113 OTUs shared by the two kinds of ornamental bamboo in CS and SS, and the number of OTUs in the two kinds of ornamental bamboo in SS was lower than that in CS. The difference between the bamboo species was smaller than that in the different treatments, which was consistent with the bacterial diversity results. The number of OTUs shared by PC and AF in the two substrates was 366 and 269, respectively.
The bacterial abundance in SS was lower than that in CS, which altered the composition of the bacterial communities. As shown in Figure 3d, which lists the top 10 bacterial communities in terms of relative abundance at the phylum level, the composition of bacterial phyla was similar across treatments, and there were differences in their relative abundance. Among them, Proteobacteria had the highest percentage of abundance, ranging from 34.92–48.42%, and its percentage of abundance in SSAF and SSPC (48.42% and 42.28%, respectively) was greater than that in CSAF and CSPC (34.92% and 38.52%, respectively). The second highest percentage of abundance was Acidobacteriota in CSAF and CSPC (14.07% and 14.00%, respectively), which was greater than that in SSAF and SSPC (10.09% and 10.02%, respectively). The third highest percentage of abundance was Bacteroidota, which was greater in SSAF and SSPC (9.16% and 10.35%, respectively) than in CSAF and CSPC (7.61% and 7.42%, respectively).
The similarity of the bacterial community composition in the two nursery substrates at the phylum level was high, and to further reflect the differences, as shown in Figure 3e, at the genus level, the change in the abundance of different species in the samples was demonstrated by the colour gradient of the colour blocks of the species abundance clustering heatmap, which facilitated a more intuitive study of the bacterial community composition. The clustering heatmap was generated with the top 10 bacterial genera in terms of the relative abundance of rhizosphere bacteria, and the results revealed that the bacterial genus-level species compositions of the two ornamental bamboos differed significantly between the two nursery substrates, with three dominant genera in CSAF and CSPC, specifically, Vicinamibacteraceae, MND1, and TRA3-20, and seven dominant genera in SSAF and SSPC, specifically, Haliangium, Bauldia, BIrii41, SWB02, Acidibacter, A4b, and Terrimonas.

3.3.2. Fungi

As shown in Figure 4a, the fungal α diversity (Chao1 and Shannon) of both types of ornamental bamboo in SS was lower than that in CS, and no significant difference was detected. As shown in Figure 4b,c, the total number of fungal OTUs of both ornamental bamboos in SS was lower than that in CS.
The fungal abundance in SS was lower than that in CS, which changed the composition of the fungal communities. As shown in Figure 4d, the top 10 fungal communities in terms of the relative abundance of fungi at the phylum level are listed, and Ascomycota was the most abundant fungal phylum among the four treatments, with 68.80–87.90%, and its percentage of abundance in SSAF and SSPC (87.89% and 76.55%, respectively) was greater than that in CSAF and CSPC (68.80% and 72.46%, respectively). To further reflect the differences at the genus level, as shown in Figure 4e, the changes in the abundance of different species in the samples were demonstrated by the colour gradient of the colour blocks of the species abundance clustering heatmap, which facilitated a more intuitive study of the composition of the fungal community. A clustering heatmap was generated with the genera with the top 10 relative abundances of rhizosphere fungi, in which Pseudeurotium had higher abundances in SSPC and SSAF than in CSPC and CSAF. Fusarium had lower abundances in SSPC (1.87%) and SSAF (0.10%) than in CSPC (3.97%) and CSAF (3.10%).

3.3.3. Correlation Analysis

The physicochemical properties, BD, pH, TP, SOM, AN, AP, and AK, of two substrates were selected as the main environmental factor indicators to evaluate their effects on the rhizosphere bacterial/fungal phylum communities. Redundancy analyses of the top 10 bacterial/fungal communities and environmental factors in the rhizosphere of the two types of ornamental bamboo were performed at the phylum level (e.g., Figure 5). RDAs revealed that the correlations increased in significance as the angle decreased and the length of the arrows increased. Figure 5a shows that RDA1 and RDA2 accounted for 82.64% and 10.43% of the variance in the top 10 rhizosphere bacteria in terms of abundance, respectively, with a cumulative explanatory rate of 93.07%, which is a good indication of the correlation between the rhizosphere bacterial communities and the environmental factors. Proteobacteria, Bacteroidota, Actinobacteriota, Myxococcota, and Verrucomicribiota were positively correlated with the organic matter and available nitrogen, available phosphorus, and available potassium contents of substrates (p < 0.05), whereas the abundances of Actinobacteriota and Gemmatimonadota and the organic matter and available nitrogen, available phosphorus, and available potassium contents of substrates were all negatively correlated. Figure 5b shows that among the top 10 rhizosphere fungi in terms of abundance, RDA1 and RDA2 accounted for 86.27% and 4.69% of the variance, respectively, with a cumulative explanatory rate of 90.96%, which can be a good indication of correlations between fungal communities and physicochemical factors in the nursery substrates and that the total porosity of the cultivated substrate and the contents of organic matter, available nitrogen, available phosphorus, and available potassium were positively correlated with the abundance of Ascomycota. The highest positive correlation was found with the abundance of Ascomycota, and a negative correlation was found with the abundances of Basidiomycota, Rozellomycota, and Mortierellomycota.
Microorganisms indirectly affect plant growth physiology by improving the physicochemical properties of the nursery substrates; thus, to explore the direct effects of microbial communities on plant growth physiology in a more in-depth and specific manner, a correlation heatmap analysis was performed at the genus level for the top 10 bacterial/fungal communities in the rhizosphere of the two species of ornamental bamboo and the physiological indices of growth of ornamental bamboo (Figure 5). As shown in Figure 5c,d, among the rhizosphere bacteria, the level of root biomass was significantly and positively correlated with the abundance of Haliangium, Bauldia, BIrii41, SWB02, Acidibacter, A4b, and Terrimonas (p < 0.05); significantly and negatively correlated with the abundance of Vicinamibacteraceae and TRA3-20 (p < 0.05); and significantly negatively correlated with the abundance of MND1. The total nitrogen, total phosphorus, and total potassium contents of leaves were significantly positively correlated (p < 0.05) with the abundance of Haliangium, A4b and Terrimonas; positively correlated (p < 0.05) with the abundance of Bauldia, BIrii41, SWB02, and Acidibacter; and significantly negatively correlated (p < 0.05) with the abundance of Vicinamibacteraceae, TRA3-20, and MND1.
Among the rhizosphere fungi, root biomass and leaf total nitrogen and potassium were significantly and positively correlated (p < 0.05) with the abundance of Pseudeurotium and positively correlated with the abundance of Paecilomyces; they were significantly and negatively correlated (p < 0.05) with the abundances of Furcasterigmium and Scytalidium; and negatively correlated with the abundances of Staphylotrichum and Humicola.

4. Discussion

4.1. Effects of the Physicochemical Properties of Nursery Substrates on the Growth and Physiology of Ornamental Bamboo

Our results demonstrated that the root biomass of both types of ornamental bamboo under the condition of a soilless substrate was significantly greater than that under common soil, which occurred because the bulk density and porosity are the key factors affecting the morphology and biomass of the root system [36]. Compared with common soil, a soilless substrate, with its lower bulk density and greater porosity, was able to provide a favourable environment for the growth of the root system of the ornamental bamboo, which facilitated the increase in the root biomass of the two types of ornamental bamboo, thus, favouring plant growth and development, which is consistent with the results of existing studies [37,38]. In contrast to the root biomass, the percentage of bamboo whip biomass of both types of ornamental bamboo decreased under the soilless substrate condition, possibly because the soilless substrate is richer in organic matter, which creates a fertile environment for survival, and the bamboo whip grows in search of a better environment which has higher organic matter, thus, changing the allocation of biomass of the underground part of the ornamental bamboo, hindering the growth of the whip and promoting the growth of the root system.
In this study, the plant height and stem thickness of ornamental bamboo in the soilless substrate increased, and the total nitrogen, total phosphorus, and total potassium contents in the leaves were greater than those in the common soil, which was attributed to the higher contents of available nitrogen, available phosphorus, and available potassium in the soilless substrate than those in the common soil. Available nitrogen, available phosphorus, and available potassium [39,40], which can be better absorbed and utilised by plants, are important nutrients for plant growth and development on nursery substrates [41]. An increase in the content of these nutrients increases the height of plants and their diameter at the ground level [42]. Studies have shown that leaf nutrients are mainly derived from the soil [43], and good nutrient conditions also promote the accumulation of nitrogen, phosphorus, and potassium in the leaves [44]. Studies have shown a significant correlation between the effective nutrient content of most soils in orchards and the level of the corresponding nutrient content of the tree [45]. In this study, the N, P, and K contents of ornamental bamboo leaves were correspondingly higher in soil-free substrates with higher levels of quick-acting N, P, and K, which was also consistent with a study by Tan, P et al. [46].

4.2. Response of Rhizosphere Microorganisms to the Physicochemical Properties of Nursery Substrates

Compared with common soils, the soilless substrates planted with the two types of ornamental bamboo presented greater organic matter, available nitrogen, available phosphorus, and available potassium contents, which was attributed to the greater rhizosphere aggregation of the phylum Proteobacteria and the phylum Bacteroidota, which facilitated the release and increase of the aforementioned nutrients. Proteobacteria and Bacteroidota are considered eutrophic microbiota with strong survivability [47]. Proteobacteria is the most common endophytic bacterial phylum that promotes plant growth and reduces the risk of plant diseases by interacting with crop root systems [48], and Jenkins et al. reported that it can promote the decomposition and transformation of organic matter [49,50]. There are also studies that have shown a positive correlation between Proteobacteria and the nitrogen content of nursery substrates [51], which promotes the accumulation of nitrogen in nursery substrates [52]. Bacteroidota can solubilise phosphorus and secrete organic acids and phosphatases to convert insoluble phosphorus into two forms (i.e., H2PO4− and HPO42−) that can be absorbed and utilised by plants [53]. Acidobacteriota, as endophytic bacteria in plants, produce various life-supporting substances such as indole-3-acetic acid and phytohormones [53]. Studies have shown that Acidobacteriota phylum can increase soil organic matter by decomposing plants and animals [54]. In addition, common soil planted with ornamental bamboo was enriched with more Acidobacteriota due to its lower organic matter content than did soils with soilless substrates, which is in agreement with the results of existing studies [55,56].
Plant residues are decomposed by the Ascomycota phylum, releasing carbon, nitrogen, and other nutrients that provide nourishment to soil microorganisms and plants, making them the primary fungal decomposers of the soil [57]. The soilless substrate formulated with peat and coconut husks selected in this study was able to enrich Ascomycota to further promote nutrient uptake in the soilless substrate. Ascomycota was found to constitute the dominant fungal community in coconut peat [58], which promotes the release of organic matter [59] and increases the uptake of organic nitrogen from the nursery substrate [60].

4.3. Synergism Between Rhizosphere Microorganisms and Ornamental Bamboo Growth

Among the top 10 genera in terms of the relative abundance of rhizosphere bacteria, there were significant differences between the common soil and soilless substrate. The soilless substrate included seven dominant bacterial genera, such as Haliangium, Acidibacter, BIrii41, and Terrimonas, all of which are beneficial bacteria. A correlation analysis revealed that ornamental bamboo root biomass and leaf total nitrogen, phosphorus, and potassium contents were positively correlated with the seven dominant genera in the rhizosphere of the soilless substrate. These findings suggest that soilless substrates can enrich more beneficial bacterial genera, thus, promoting the growth of ornamental bamboo. Shaojing Yin et al. demonstrated that the content of beneficial genera such as Haliangium in the nursery substrate indirectly favoured the growth of lettuce [61]. A higher content of beneficial genera such as Acidibacter and BIrii41 promoted the growth of kiwifruit [62]. Terrimonas can benefit nutrient uptake by promoting plant root development [63]. For example, Terrimonas is positively correlated with plant height at the seedling stage, plant height and aboveground biomass at the flowering stage, and root biomass at the fruiting stage of chilli [64].
Previous studies have reported that pathogens are suppressed by Pseudeurotium [65]. Lixia Tian et al. reported that Pseudeurotium was significantly enriched in the nursery substrate of healthy plants [66], and Xingjia He et al. reported that an increase in the relative abundance of the potentially beneficial organism Pseudeurotium was favourable for increasing tomato yield [67]. Therefore, more Pseudeurotium can be enriched in soilless substrates with better growing conditions for ornamental bamboos to promote their growth. Fusarium is an important plant pathogen that can infect a wide range of food and cash crops, causing root rot, stem rot, and spindle (grain) rot, which leads to crop yield reduction [68], and an increase in the abundance of Fusarium is associated with root rot in ginseng [69]. As the abundance of Fusarium is lower in soilless substrates, the risk of infection in ornamental bamboo is lower.

5. Conclusions

Compared with common soil, the soilless substrate was able to change the biomass allocation strategy of the underground part of ornamental bamboo, promoting the growth of the root system and inhibiting the growth of bamboo whips. The abundances of Proteobacteria, Ascomycota, and Bacteroidota in the soilless substrate were greater than those in the common soil, and the abundance of beneficial microorganisms (Haliangium, Acidibacter, BIrii41, and Pseudeurotium) in the soilless substrate increased, which facilitated the development of the root system of the ornamental bamboo as well as the accumulation of nitrogen, phosphorus, and potassium in the leaves; moreover, the abundance of pathogenic fungi (Fusarium) decreased, which reduced the risk of infection in the ornamental bamboo.
This study, as a preliminary exploration of soilless substrates for ornamental bamboo, has several limitations. First, only two bamboo species were selected in this study, and future studies can add more different species of bamboo plants to explore whether the effects of soilless substrates differ across bamboo species. Second, future studies could further explore the effects of different ratios of substrates on bamboo plants as well as delve deeper and compare the physicochemical properties of substrates. Finally, the trial time was short and the study of fertilisation measures matching the soilless substrate was not carried out, as well as considering irrigation factors. The effects of these three factors can be added in the future.

Author Contributions

All the authors contributed to the study’s conception and design. Conceptualisation, M.J.; methodology, M.J., Q.C. and Z.L. (Zhenghua Luo); formal analyses, M.Y. (Menglian Yang), Y.Q., M.Y. (Meng Yang), Z.L. (Zhi Li), J.Y. and K.W.; investigation, M.Y. (Menglian Yang) and M.J.; writing—original draft, M.Y. (Menglian Yang); writing—review and editing, M.J., Q.C. and Z.L. (Zhenghua Luo); project administration, M.J.; and funding acquisition, M.J. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Training Programmes of Innovation and Entrepreneurship for Undergraduates (No. 202410626052) and the Hai-Ju Programme for the Introduction of High-end Talents in Sichuan Provincial Science and Technology Programmes (2024JDHJ0017).

Data Availability Statement

The datasets used or analysed during the current study are available from the corresponding author upon reasonable request.

Conflicts of Interest

The authors declare that they have no conflicts of interest.

References

  1. Wang, X.; Xue, X.; Tan, J.; Mai, X.; Tian, J. Research on the formulation of organic fertilizer for seedling nursery. Anhui Agric. Sci. 2024, 52, 119–122. [Google Scholar]
  2. Su, Y.; Zhang, L. Addition of Coco Coir and Rice Hull Ash Improves the Quality of Seedling Substrate Based on Green Waste Compost for Cucurbitaceae Vegetable Seedlings. J. Mater. Cycles Waste Manag. 2024, 26, 562–577. [Google Scholar] [CrossRef]
  3. Rodríguez-Ortega, W.M.; Martínez, V.; Nieves, M.; Simón, I.; Lidón, V.; Fernandez-Zapata, J.C.; Martinez-Nicolas, J.J.; Cámara-Zapata, J.M.; García-Sánchez, F. Agricultural and Physiological Responses of Tomato Plants Grown in Different Soilless Culture Systems with Saline Water under Greenhouse Conditions. Sci. Rep. 2019, 9, 6733. [Google Scholar] [CrossRef] [PubMed]
  4. Rasool, S.; Ahmad, I.; Ziaf, K.; Naveed, M. Plant Growth Promoting Rhizobacteria Incorporated Soilless Substrates—A Potential Arena for High Quality Nursery Production of Ornamentals. Sci. Hortic. 2024, 326, 112745. [Google Scholar] [CrossRef]
  5. Kader, S. Analysis of Physical and Chemical Properties of Alternative Substrate Material for Sustainable Green Roofs. Res. Sq. 2022. [Google Scholar] [CrossRef]
  6. Ku, C.S. Preplant Superphosphate Amendment and Leaching Fraction on Growth of Potted Poinsettia. HortScience 1995, 30, 858G–858. [Google Scholar] [CrossRef]
  7. Zhang, X.; Ling, C.; Wu, X.; Fan, S.; Liang, Q.; Zhou, F. Bacterial Diversity and Function Shift of Strawberry Root in Different Cultivation Substrates. Rhizosphere 2023, 26, 100696. [Google Scholar] [CrossRef]
  8. Shi, B.; Wang, X.; Yang, S.; Chen, H.; Zhao, Y. Addition Pinus massoniana Fallen Wood Improved the Growth of Plagiomnium acutum in a Substrate Cultivation. Sci. Rep. 2022, 12, 17755. [Google Scholar] [CrossRef]
  9. Wajid, H.A.; Alderfasi, A.A.; Afzal, I.; Junaid, M.B.; Mahmood, A.; Ahmad, A.; Arsal, M.N.; Tahir, M.U. Evaluating the Potential Effect of Seed Priming Techniques in Improving Germination and Root Shoot Length of Maize Seed. Cercet. Agron. Mold. 2018, 51, 5–15. [Google Scholar] [CrossRef]
  10. Sun, M.; Meng, X.; Peng, T.; Hu, X. Effect of Bacillus methylotrophicus on Tomato Plug Seedling. Horticulturae 2022, 8, 947. [Google Scholar] [CrossRef]
  11. Gossen, B.D.; Kasinathan, H.; Deora, A.; Peng, G.; McDonald, M.R. Effect of Soil Type, Organic Matter Content, Bulk Density and Saturation on Clubroot Severity and Biofungicide Efficacy. Plant Pathol. 2016, 65, 1238–1245. [Google Scholar] [CrossRef]
  12. Tang, X.; Xia, M.; Guan, F.; Fan, S. Spatial Distribution of Soil Nitrogen, Phosphorus and Potassium Stocks in Moso Bamboo Forests in Subtropical China. Forests 2016, 7, 267. [Google Scholar] [CrossRef]
  13. Donatus, E.O.; Essien, B.A.; Nwanja, O.U.; Nweke, P.E. Rice Husk Dust and NPK Improve Soil Chemical Properties and Growth Response of Jatropha. Int. J. Plant Soil Sci. 2021, 33, 10–21. [Google Scholar] [CrossRef]
  14. Liu, J.; Wang, D.; Yan, X.; Jia, L.; Chen, N.; Liu, J.; Zhao, P.; Zhou, L.; Cao, Q. Effect of Nitrogen, Phosphorus and Potassium Fertilization Management on Soil Properties and Leaf Traits and Yield of Sapindus mukorossi. Front. Plant Sci. 2024, 15, 1300683. [Google Scholar] [CrossRef] [PubMed]
  15. Simón-Grao, S.; Nieves, M.; Martínez-Nicolás, J.J.; Cámara-Zapata, J.M.; Alfosea-Simón, M.; García-Sánchez, F. Response of Three Citrus Genotypes Used as Rootstocks Grown under Boron Excess Conditions. Ecotoxicol. Environ. Saf. 2018, 159, 10–19. [Google Scholar] [CrossRef]
  16. Simiele, M.; Argentino, O.; Baronti, S.; Scippa, G.S.; Chiatante, D.; Terzaghi, M.; Montagnoli, A. Biochar Enhances Plant Growth, Fruit Yield, and Antioxidant Content of Cherry Tomato (Solanum lycopersicum L.) in a Soilless Substrate. Agriculture 2022, 12, 1135. [Google Scholar] [CrossRef]
  17. Ma, C.; Qin, C. Effects of different organic matter ratios on the growth of maize seedlings. Mod. Agric. Sci. Technol. 2021, 13, 9–11. [Google Scholar]
  18. Jansson, J.K.; McClure, R.; Egbert, R.G. Soil microbiome engineering for sustainability in a changing environment. Nat. Biotechnol. 2023, 41, 1716–1728. [Google Scholar] [CrossRef]
  19. Wang, F.; Liu, H.; Yao, H.; Zhang, B.; Li, Y.; Jin, S.; Cao, H. Reducing Application of Nitrogen Fertilizer Increases Soil Bacterial Diversity and Drives Co-Occurrence Networks. Microorganisms 2024, 12, 1434. [Google Scholar] [CrossRef]
  20. Huang, B.; Yan, D.; Wang, Q.; Fang, W.; Song, Z.; Cheng, H.; Li, Y.; Ouyang, C.; Han, Q.; Jin, X.; et al. Effects of Dazomet Fumigation on Soil Phosphorus and the Composition of phoD-Harboring Microbial Communities. J. Agric. Food Chem. 2020, 68, 5049–5058. [Google Scholar] [CrossRef]
  21. Grunert, O.; Hernandez-Sanabria, E.; Vilchez-Vargas, R.; Jauregui, R.; Pieper, D.H.; Perneel, M.; Van Labeke, M.-C.; Reheul, D.; Boon, N. Mineral and Organic Growing Media Have Distinct Community Structure, Stability and Functionality in Soilless Culture Systems. Sci. Rep. 2016, 6, 18837. [Google Scholar] [CrossRef] [PubMed]
  22. Yang, Y.; Chen, J.; Zheng, Y.; Jiang, R.; Sang, Y.; Zhang, J. The Effects of Mixed Robinia pseudoacacia and Quercus variabilis Plantation on Soil Bacterial Community Structure and Nitrogen-Cycling Gene Abundance in the Southern Taihang Mountain Foothills. Microorganisms 2024, 12, 1773. [Google Scholar] [CrossRef]
  23. Ali, A.; Ghani, M.I.; Haiyan, D.; Iqbal, M.; Cheng, Z.; Cai, Z. Garlic Substrate Induces Cucumber Growth Development and Decreases Fusarium Wilt through Regulation of Soil Microbial Community Structure and Diversity in Replanted Disturbed Soil. Int. J. Mol. Sci. 2020, 21, 6008. [Google Scholar] [CrossRef] [PubMed]
  24. Mechergui, T.; Vanderschaaf, C.L.; Jhariya, M.K.; Banerjee, A.; Raj, A. Sheep Manure Compost: A Viable Growing Substrate for Lettuce Seedling Production. J. Soil Sci. Plant Nutr. 2024, 24, 5108–5119. [Google Scholar] [CrossRef]
  25. Machado, R.M.A.; Alves-Pereira, I.; Ferreira, R.; Gruda, N.S. Coir, an Alternative to Peat—Effects on Plant Growth, Phytochemical Accumulation, and Antioxidant Power of Spinach. Horticulturae 2021, 7, 127. [Google Scholar] [CrossRef]
  26. Mariotti, B.; Martini, S.; Raddi, S.; Tani, A.; Jacobs, D.F.; Oliet, J.A.; Maltoni, A. Coconut Coir as a Sustainable Nursery Growing Media for Seedling Production of the Ecologically Diverse Quercus Species. Forests 2020, 11, 522. [Google Scholar] [CrossRef]
  27. Saviozzi, A.; Levi-Minzi, R.; Cardelli, R.; Riffaldi, R. A Comparison of Soil Quality in Adjacent Cultivated, Forest and Native Grassland Soils. Plant Soil 2001, 233, 251–259. [Google Scholar] [CrossRef]
  28. Xiang, Y.; Wu, K.; Lu, G.; Peng, L. Methodological study on the determination of organic matter in bulk soil samples by graphite electric hot plate digestion. Arid. Environ. Monit. 2019, 33, 26–29+48. [Google Scholar]
  29. LY/T1228-2015; State Forestry Administration. Determination of Forest Soil Nitrogen. Forestry Research Institute of China Academy of Forestry Sciences: Beijing, China, 2015; pp. 1–16.
  30. LY/T1232-2015; State Forestry Administration. Determination of Phosphorus in Forest Soil. Forestry Research Institute of China Academy of Forestry Sciences: Beijing, China, 2015; pp. 1–15.
  31. LY/T 1234-2015; State Forestry Administration. Determination of Potassium in Forest Soil. Forestry Research Institute of China Academy of Forestry Sciences: Beijing, China, 2015; pp. 1–8.
  32. Hao, J.J.; Kang, Z.L.; Yu, Y. Experimental Techniques in Plant Physiology; Chemical Industry Press: Beijing, China, 2007. [Google Scholar]
  33. Yao, X.; Ren, H.; Cao, Z.; Tian, Y.; Cao, W.; Zhu, Y.; Cheng, T. Detecting leaf nitrogen content in wheat with canopy hyperspectrum under different soil backgrounds. Int. J. Appl. Earth Obs. Geoinf. 2014, 32, 114–124. [Google Scholar] [CrossRef]
  34. Ge, J.; Xie, Z. Leaf litter carbon, nitrogen, and phosphorus stoichiometric patterns as related to climatic factors and leaf habits across Chinese broad-leaved tree species. Plant Ecol. 2017, 218, 1063–1076. [Google Scholar] [CrossRef]
  35. Berg, W.K.; Cunningham, S.M.; Brouder, S.M.; Joern, B.C.; Johnson, K.D.; Volenec, J.J. Influence of phosphorus and potassium on alfalfa yield, taproot C and N pool, and transcript levels of key genes after defoliation. Crop Sci. 2009, 49, 974–982. [Google Scholar] [CrossRef]
  36. Sun, X.; Zhao, J.; Wang, G.; Guan, Q.; Kuzyakov, Y. Fine Root Extension in Urban Forest Soil Depends on Organic Mulching. Agrofor. Syst. 2023, 97, 235–247. [Google Scholar] [CrossRef]
  37. Mohawesh, O.; Albalasmeh, A.; Gharaibeh, M.; Deb, S.; Simpson, C.; Singh, S.; Al-Soub, B.; Hanandeh, A.E. Potential use of biochar as an amendment to improve soil fertility and tomato and bell pepper growth performance under arid conditions. J. Soil Sci. Plant Nutr. 2021, 21, 2946–2956. [Google Scholar] [CrossRef]
  38. Calcan, S.I.; Pârvulescu, O.C.; Ion, V.A.; Răducanu, C.E.; Bădulescu, L.; Madjar, R.; Dobre, T.; Egri, D.; Moț, A.; Iliescu, L.M.; et al. Effects of Biochar on Soil Properties and Tomato Growth. Agronomy 2022, 12, 1824. [Google Scholar] [CrossRef]
  39. Huang, X.; Li, S.; Li, S.; Ye, G.; Lu, L.; Zhang, L.; Yang, L.; Qian, X.; Liu, J. The Effects of Biochar and Dredged Sediments on Soil Structure and Fertility Promote the Growth, Photosynthetic and Rhizosphere Microbial Diversity of Phragmites communis (Cav.) Trin. Ex Steud. Sci. Total Environ. 2019, 697, 134073. [Google Scholar] [CrossRef]
  40. Gong, X.; Huang, D.; Liu, Y.; Zeng, G.; Chen, S.; Wang, R.; Xu, P.; Cheng, M.; Zhang, C.; Xue, W. Biochar Facilitated the Phytoremediation of Cadmium Contaminated Sediments: Metal Behavior, Plant Toxicity, and Microbial Activity. Sci. Total Environ. 2019, 666, 1126–1133. [Google Scholar] [CrossRef]
  41. Luan, M.; Tang, R.J.; Tang, Y.; Tian, W.; Hou, C.; Zhao, F.; Lan, W.; Luan, S. Transport and homeostasis of potassium and phosphate: Limiting factors for sustainable crop production. J. Exp. Bot. 2017, 68, 3091–3105. [Google Scholar] [CrossRef]
  42. Zhang, C.; Huang, X.; Zhang, X.; Wan, L.; Wang, Z. Effects of biochar application on soil nitrogen and phosphorous leaching loss and oil peony growth. Agric. Water Manag. 2021, 255, 107022. [Google Scholar] [CrossRef]
  43. Yu, D.; Xiao, L. Correlation analysis of soil nutrients and leaf nutrients with yield in hazelnut orchard. Liaoning For. Sci. Technol. 2020, 3, 11–13+33. [Google Scholar]
  44. Tang, Y.; Peng, L.; Chun, C.; Lin, L.; Fang, Y.; Yan, X. Correlation analysis of soil and leaf nutrient elements in red soil sweet orange orchard. J. Hortic. 2013, 40, 623–632. [Google Scholar] [CrossRef]
  45. Lu, C.; Xue, X.; Wang, C.; An, G.; Wang, J. Correlation analysis of fruit quality indexes, leaf nutrition and soil nutrients in apple orchards in Shandong Province. China Agron. Bull. 2011, 27, 168–172. [Google Scholar]
  46. Tan, P.; Wang, S.; Ameen, A.; Xie, J.; Jiang, G.; Han, L. Fertilizer Application to Balance Nitrogen and Phosphorus Nutrients and Improve Agronomic Traits of Okra (Abelmoschus esculentus L.) in Coastal Saline Soil Under Subsurface Pipe Salt Drainage. J. Soil Sci. Plant Nutr. 2023, 23, 5454–5467. [Google Scholar] [CrossRef]
  47. Amaresan, N.; Jayakumar, V.; Kumar, K.; Thajuddin, N. Plant Growth-Promoting Effects of Proteus Mirabilis Isolated from Tomato (Lycopersicon esculentum Mill) Plants. Natl. Acad. Sci. Lett. 2021, 44, 453–455. [Google Scholar] [CrossRef]
  48. Zhu, H.X.; Hu, L.F.; Wang, Y.L.; Mei, P.P.; Zhou, F.; Rozhkova, T.; Li, C.W. Effects of Streptomyces sp. HU2014 inoculation on wheat growth and rhizosphere microbial diversity under hexavalent chromium stres. Ecotoxicol. Environ. Saf. 2024, 276, 116313. [Google Scholar] [CrossRef]
  49. Jenkins, S.N.; Rushton, S.P.; Lanyon, C.V.; Whiteley, A.S.; Waite, I.S.; Brookes, P.C.; Kemmitt, S.; Evershed, R.P.; O’donnell, A.G. Taxon-specific responses of soil bacteria to the addition of low level C inputs. Soil Biol. Biochem. 2010, 42, 1624–1631. [Google Scholar] [CrossRef]
  50. Wang, J.; Xiong, Z.; Kuzyakov, Y. Biochar stability in soil: Metaanalysis of decomposition and priming effects. GCB Bioenergy 2016, 8, 512–523. [Google Scholar] [CrossRef]
  51. Dai, Z.; Su, W.; Chen, H.; Barberán, A.; Zhao, H.; Yu, M.; Yu, L.; Brookes, P.C.; Schadt, C.W.; Chang, S.X. Long-term nitrogen fertilization decreases bacterial diversity and favors the growth of Actinobacteria and Proteobacteria in agro-ecosystems across the globe. Glob. Change Biol. 2018, 24, 3452–3461. [Google Scholar] [CrossRef]
  52. Fraser, T.D.; Lynch, D.H.; Bent, E.; Entz, M.H.; Dunfield, K.E. Soil Bacterial phoD Gene Abundance and Expression in Response to Applied Phosphorus and Long-Term Management. Soil Biol. Biochem. 2015, 88, 137–147. [Google Scholar] [CrossRef]
  53. Kumar, A.; Singh, V.K. Microbial Endophytes; Woodhead Publishing: Cambridge, UK, 2020; pp. 189–229. [Google Scholar]
  54. Li, J.; Wu, X.; Lu, X.; Hou, D.; Liu, H.; Wang, Y.; Wu, L. Study on the Changes in the Microbial Community in Rhizosphere Soil of Blueberry Plants at Different Growth Stages. Agronomy 2024, 14, 2393. [Google Scholar] [CrossRef]
  55. Liu, C.; Xia, R.; Tang, M.; Chen, X.; Zhong, B.; Liu, X.; Bian, R.; Yang, L.; Zheng, J.; Cheng, K.; et al. Improved Ginseng Production under Continuous Cropping through Soil Health Reinforcement and Rhizosphere Microbial Manipulation with Biochar: A Field Study of Panax ginseng from Northeast China. Hortic. Res. 2022, 9, uhac108. [Google Scholar] [CrossRef]
  56. Zhang, C.; Liu, G.; Xue, S.; Wang, G. Soil bacterial community dynamics reflect changes in plant community and soil properties during the secondary succession of abandoned farmland in the Loess Plateau. Soil Biol. Biochem. 2016, 97, 40–49. [Google Scholar] [CrossRef]
  57. Liao, J.; Hao, G.; Guo, H.; Chen, H. Effects of biochar on plant and microbial communities in landfill soil. Appl. Soil Ecol. 2024, 204, 105749. [Google Scholar] [CrossRef]
  58. Yan, K.; Ma, Y.; Bao, S.; Li, W.; Wang, Y.; Sun, C.; Lu, X.; Ran, J. Exploring the Impact of Coconut Peat and Vermiculite on the Rhizosphere Microbiome of Pre-Basic Seed Potatoes under Soilless Cultivation Conditions. Microorganisms 2024, 12, 584. [Google Scholar] [CrossRef]
  59. Zhang, J.; Ye, L.; Chang, J.; Wang, E.; Wang, C.; Zhang, H.; Pang, Y.; Tian, C. Straw Soil Conditioner Modulates Key Soil Microbes and Nutrient Dynamics across Different Maize Developmental Stages. Microorganisms 2024, 12, 295. [Google Scholar] [CrossRef]
  60. Simões, M.F.; Antunes, A.; Ottoni, C.A.; Amini, M.S.; Alam, I.; Alzubaidy, H.; Mokhtar, N.; Archer, J.A.C.; Bajic, V.B. Soil and Rhizosphere Associated Fungi in Gray Mangroves (Avicennia marina) from the Red Sea—A Metagenomic Approach. Genom. Proteom. Bioinform. 2015, 13, 310–320. [Google Scholar] [CrossRef]
  61. Yin, S.; Zhang, X.; Suo, F.; You, X.; Yuan, Y.; Cheng, Y.; Zhang, C.; Li, Y. Effect of biochar and hydrochar from cow manure and reed straw on lettuce growth in an acidified soil. Chemosphere 2022, 298, 134191. [Google Scholar] [CrossRef]
  62. Shen, C.; Li, X.; Qin, J. Kiwifruit-Agaricus Blazei Intercropping Effectively Improved Yield Productivity, Nutrient Uptake, and Rhizospheric Bacterial Community. Sci. Rep. 2024, 14, 16546. [Google Scholar]
  63. Visioli, G.; Sanangelantoni, A.M.; Vamerali, T.; Dal Cortivo, C.; Blandino, M. 16S rDNA Profiling to Reveal the Influence of Seed-Applied Biostimulants on the Rhizosphere of Young Maize Plants. Molecules 2018, 23, 1461. [Google Scholar] [CrossRef]
  64. Ran, T.; Li, J.; Liao, H.; Zhao, Y.; Yang, G.; Long, J. Effects of Biochar Amendment on Bacterial Communities and Their Function Predictions in a Microplastic-Contaminated Capsicum annuum L. Soil. Environ. Technol. Innov. 2023, 31, 103174. [Google Scholar] [CrossRef]
  65. Heo, Y.M.; Lee, H.; Kim, K.; Kwon, S.L.; Park, M.Y.; Kang, J.E.; Kim, G.-H.; Kim, B.S.; Kim, J.-J. Fungal diversity in intertidal mudflats and abandoned solar salterns as a source for biological resources. Mar. Drugs 2019, 17, 601. [Google Scholar] [CrossRef]
  66. Tian, L.; Ou, J.; Sun, X.; Miao, Y.; Pei, J.; Zhao, L.; Huang, L. The Discovery of Pivotal Fungus and Major Determinant Factor Shaping Soil Microbial Community Composition Associated with Rot Root of American Ginseng. Plant Signal. Behav. 2021, 16, 1952372. [Google Scholar] [CrossRef] [PubMed]
  67. He, X.; Xie, H.; Gao, D.; Khashi, U.; Rahman, M.; Zhou, X.; Wu, F. Biochar and Intercropping With Potato–Onion Enhanced the Growth and Yield Advantages of Tomato by Regulating the Soil Properties, Nutrient Uptake, and Soil Microbial Community. Front. Microbiol. 2021, 12, 695447. [Google Scholar] [CrossRef] [PubMed]
  68. Puchkova, E.P.; Ivchenko, V.K. Incidence of microorganisms antagonistic to plant pathogenic fungi Bipolaris sorokiniana and Fusarium sp. in different soil communities. IOP Conf. Ser. Earth Environ. Sci. 2020, 548, 052069. [Google Scholar] [CrossRef]
  69. Song, M.; Yun, H.Y.; Kim, Y.H. Antagonistic Bacillus Species as a Biological Control of Ginseng Root Rot Caused by Fusarium Cf. incarnatum. J. Ginseng Res. 2014, 38, 136–145. [Google Scholar] [CrossRef]
Agronomy 15 00326 g001
Figure 1. Changes in the physicochemical properties of the nursery substrates before and after cultivating ornamental bamboo (from March 2023 to December 2023), including bulk density (BD; (a)), total porosity (TP; (b)), aeration porosity (AP; (c)), pH (d), organic matter (SOM; (e)), available nitrogen (AN; (f)), available phosphorus (AP; (g)), and available potassium (AK; (h)). Note: background value (BV), Pleioblastus chino f. holocrysa (PC), Arundinaria fortunei (AF), common soil (CS), soilless substrate (SS). All data are expressed as mean ± standard error (n = 3). Different lowercase letters indicate significant (p < 0.05) differences between means in different treatments.
Figure 1. Changes in the physicochemical properties of the nursery substrates before and after cultivating ornamental bamboo (from March 2023 to December 2023), including bulk density (BD; (a)), total porosity (TP; (b)), aeration porosity (AP; (c)), pH (d), organic matter (SOM; (e)), available nitrogen (AN; (f)), available phosphorus (AP; (g)), and available potassium (AK; (h)). Note: background value (BV), Pleioblastus chino f. holocrysa (PC), Arundinaria fortunei (AF), common soil (CS), soilless substrate (SS). All data are expressed as mean ± standard error (n = 3). Different lowercase letters indicate significant (p < 0.05) differences between means in different treatments.
Agronomy 15 00326 g001
Agronomy 15 00326 g002
Figure 2. Physiological indices of the growth of two species of ornamental bamboo, including biomass (B; (a)), the biomass of Pleioblastus chino f. holocrysa (b) and Arundinaria fortunei (c), diameter at ground level (D; (d)), height of the plant (H; (e)), net photosynthetic rate (Pn; (f)), chlorophyll (Chl; (g)), leaf total nitrogen (LTN; (h)), leaf total phosphorus (LTP; (i)) and leaf total potassium (LTK; (j)). Note: Pleioblastus chino f. holocrysa (PC), Arundinaria fortunei (AF), Common Soil (CS), Soilless Substrate (SS). (b,c) contains the biomass of leaf biomass (BL), stem biomass (BS), whip biomass (BW) and root biomass (BR) of two species of ornamental bamboo. All data are expressed as mean ± standard error (n = 3). Different lowercase letters indicate significant (p < 0.05) differences between means in different treatments.
Figure 2. Physiological indices of the growth of two species of ornamental bamboo, including biomass (B; (a)), the biomass of Pleioblastus chino f. holocrysa (b) and Arundinaria fortunei (c), diameter at ground level (D; (d)), height of the plant (H; (e)), net photosynthetic rate (Pn; (f)), chlorophyll (Chl; (g)), leaf total nitrogen (LTN; (h)), leaf total phosphorus (LTP; (i)) and leaf total potassium (LTK; (j)). Note: Pleioblastus chino f. holocrysa (PC), Arundinaria fortunei (AF), Common Soil (CS), Soilless Substrate (SS). (b,c) contains the biomass of leaf biomass (BL), stem biomass (BS), whip biomass (BW) and root biomass (BR) of two species of ornamental bamboo. All data are expressed as mean ± standard error (n = 3). Different lowercase letters indicate significant (p < 0.05) differences between means in different treatments.
Agronomy 15 00326 g002
Agronomy 15 00326 g003
Figure 3. Diversity, OTUs, community composition and relative abundance of bacteria in two types of ornamental bamboo under two nursery substrates, including a boxplot of the bacterial α diversity (Chao1 and Shannon; (a)), the number of bacterial OTUs (b,c), the bacterial stacked histograms of community composition of the top 10 relative abundances at the phylum level (d), and heatmap of community composition of the top 10 relative abundances of bacteria at the genus level (e). Note: Pleioblastus chino f. holocrysa (PC); Arundinaria fortunei (AF); Common soil (CS); Soilless substrate (SS). Pleioblastus chino f. holocrysa cultivated in common soil (CSPC); Arundinaria fortunei cultivated in common soil (CSAF); Pleioblastus chino f. holocrysa cultivated in soilless substrate (SSPC); Arundinaria fortunei cultivated in soilless substrate (SSAF). n = 3.
Figure 3. Diversity, OTUs, community composition and relative abundance of bacteria in two types of ornamental bamboo under two nursery substrates, including a boxplot of the bacterial α diversity (Chao1 and Shannon; (a)), the number of bacterial OTUs (b,c), the bacterial stacked histograms of community composition of the top 10 relative abundances at the phylum level (d), and heatmap of community composition of the top 10 relative abundances of bacteria at the genus level (e). Note: Pleioblastus chino f. holocrysa (PC); Arundinaria fortunei (AF); Common soil (CS); Soilless substrate (SS). Pleioblastus chino f. holocrysa cultivated in common soil (CSPC); Arundinaria fortunei cultivated in common soil (CSAF); Pleioblastus chino f. holocrysa cultivated in soilless substrate (SSPC); Arundinaria fortunei cultivated in soilless substrate (SSAF). n = 3.
Agronomy 15 00326 g003
Agronomy 15 00326 g004
Figure 4. Diversity, OTUs, community composition, and relative abundance of fungi in two types of ornamental bamboo under two nursery substrates, including a boxplot of the fungal α diversity (Chao1 and Shannon; (a)), the number of fungal OTUs (b,c), the fungal stacked histograms of community composition of the top 10 relative abundances at the phylum level (d), and heatmap of community composition of the top 10 relative abundances of fungal at the genus level (e). Note: Pleioblastus chino f. holocrysa (PC); Arundinaria fortunei (AF); Common soil (CS); Soilless substrate (SS). Pleioblastus chino f. holocrysa cultivated in common soil (CSPC); Arundinaria fortunei cultivated in common soil (CSAF); Pleioblastus chino f. holocrysa cultivated in soilless substrate (SSPC); Arundinaria fortunei cultivated in soilless substrate (SSAF). n = 3.
Figure 4. Diversity, OTUs, community composition, and relative abundance of fungi in two types of ornamental bamboo under two nursery substrates, including a boxplot of the fungal α diversity (Chao1 and Shannon; (a)), the number of fungal OTUs (b,c), the fungal stacked histograms of community composition of the top 10 relative abundances at the phylum level (d), and heatmap of community composition of the top 10 relative abundances of fungal at the genus level (e). Note: Pleioblastus chino f. holocrysa (PC); Arundinaria fortunei (AF); Common soil (CS); Soilless substrate (SS). Pleioblastus chino f. holocrysa cultivated in common soil (CSPC); Arundinaria fortunei cultivated in common soil (CSAF); Pleioblastus chino f. holocrysa cultivated in soilless substrate (SSPC); Arundinaria fortunei cultivated in soilless substrate (SSAF). n = 3.
Agronomy 15 00326 g004
Agronomy 15 00326 g005
Figure 5. Relationships of rhizosphere microbial communities with environmental factors and growth physiological indices of the two types of ornamental bamboo. Redundancy analysis plots between rhizosphere bacteria, fungal phyla, and environmental factors, respectively, with red arrows denoting bacterial/fungal phylum types and blue arrows denoting environmental factors (a,b). Thermograms of correlations between rhizosphere bacterial and fungal phyla and growth physiological indices of the ornamental bamboo, respectively, with significance levels labelled *, p < 0.05 and **, p < 0.01 (c,d).
Figure 5. Relationships of rhizosphere microbial communities with environmental factors and growth physiological indices of the two types of ornamental bamboo. Redundancy analysis plots between rhizosphere bacteria, fungal phyla, and environmental factors, respectively, with red arrows denoting bacterial/fungal phylum types and blue arrows denoting environmental factors (a,b). Thermograms of correlations between rhizosphere bacterial and fungal phyla and growth physiological indices of the ornamental bamboo, respectively, with significance levels labelled *, p < 0.05 and **, p < 0.01 (c,d).
Agronomy 15 00326 g005
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yang, M.; Jiang, M.; Quan, Y.; Yang, M.; Li, Z.; Yao, J.; Wang, K.; Luo, Z.; Chen, Q. Effects of Different Nursery Substrates on the Growth Physiology and Rhizosphere Microorganisms of Two Species of Ornamental Bamboo. Agronomy 2025, 15, 326. https://doi.org/10.3390/agronomy15020326

AMA Style

Yang M, Jiang M, Quan Y, Yang M, Li Z, Yao J, Wang K, Luo Z, Chen Q. Effects of Different Nursery Substrates on the Growth Physiology and Rhizosphere Microorganisms of Two Species of Ornamental Bamboo. Agronomy. 2025; 15(2):326. https://doi.org/10.3390/agronomy15020326

Chicago/Turabian Style

Yang, Menglian, Mingyan Jiang, Yixuan Quan, Meng Yang, Zhi Li, Jieying Yao, Kaiqing Wang, Zhenghua Luo, and Qibing Chen. 2025. "Effects of Different Nursery Substrates on the Growth Physiology and Rhizosphere Microorganisms of Two Species of Ornamental Bamboo" Agronomy 15, no. 2: 326. https://doi.org/10.3390/agronomy15020326

APA Style

Yang, M., Jiang, M., Quan, Y., Yang, M., Li, Z., Yao, J., Wang, K., Luo, Z., & Chen, Q. (2025). Effects of Different Nursery Substrates on the Growth Physiology and Rhizosphere Microorganisms of Two Species of Ornamental Bamboo. Agronomy, 15(2), 326. https://doi.org/10.3390/agronomy15020326

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop