Next Article in Journal
Durum Wheat (Triticum durum Desf.): Origin, Cultivation and Potential Expansion in Sub-Saharan Africa
Next Article in Special Issue
Iron Biofortification of Red and Green Pigmented Lettuce in Closed Soilless Cultivation Impacts Crop Performance and Modulates Mineral and Bioactive Composition
Previous Article in Journal
Wx Gene in Hordeum chilense: Chromosomal Location and Characterisation of the Allelic Variation in the Two Main Ecotypes of the Species
Previous Article in Special Issue
Biostimulant Application with a Tropical Plant Extract Enhances Corchorus olitorius Adaptation to Sub-Optimal Nutrient Regimens by Improving Physiological Parameters
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 9
Issue 5
10.3390/agronomy9050262
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Urea Addition Promotes the Metabolism and Utilization of Nitrogen in Cucumber

by
Chao Ma
1,2,
Tiantian Ban
2,
Hongjun Yu
3,
Qiang Li
3,
Xiaohui Li
2,
Weijie Jiang
1,3,* and
Jianming Xie
1,*
1
College of Horticulture, Gansu Agricultural University, Anning District, Lanzhou 730070, Gansu, China
2
Institute of Horticulture, Guizhou Academy of Agricultural Science, Xiaohe District, Guiyang 550006, Guizhou, China
3
Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences, 12 Zhongguancun S. St., Beijing 100081, China
*
Authors to whom correspondence should be addressed.
Agronomy 2019, 9(5), 262; https://doi.org/10.3390/agronomy9050262
Submission received: 25 April 2019 / Revised: 20 May 2019 / Accepted: 21 May 2019 / Published: 23 May 2019
(This article belongs to the Collection Nutrition Management of Hydroponic Vegetable Crops)
Browse Figures
Review Reports Versions Notes

Abstract

:
Nitrogen (N) forms include ammonium [NH4+-N], nitrate [NO3−-N], and urea [CO(NH2)2]. Urea is the most common nitrogen fertilizer in agriculture due to its inexpensive price and high N content. Although the reciprocal influence between NO3−-N and NH4+-N is well known, CO(NH2)2 interactions with these inorganic N forms have been poorly studied. We studied the effects of different nitrogen forms with equal nitrogen on dry matter, yield, enzyme activity, and gene expression levels in cucumber. NO3−-N treatment with equal CO(NH2)2 promoted nitrate reduction, urea utilization, and the GS/GOGAT cycle but reduced the nitrate content. UR-2, NR-2, NR-3, NiR, GOGAT-1-1, and GS-4 were upregulated in response to these changes. NH4+-N treatment with equal CO(NH2)2 promoted nitrogen metabolism and relieved the ammonia toxicity of pure NH4+-N treatment. UR-2, GOGAT-2-2, and GS-4 were upregulated, and GDH-3 was downregulated in response to these changes. Treatment with both NO3−-N with added equal CO(NH2)2 and NH4+-N with added equal CO(NH2)2 enhanced the activities of GOGAT, GS, and UR and the amino acid pathway of urea metabolism; manifested higher glutamate, protein, chlorophyll, and nitrogen contents; and improved dry matter weight. A greater proportion of dry matter was distributed to the fruit, generating significantly higher yields. Therefore, the addition of urea to ammonium or nitrate promoted N metabolism and N utilization in cucumber plants, especially treatments with 50% NO3−-N + 50% CO(NH2)2, as the recommended nitrogen form in this study.

1. Introduction

Cucumber (Cucumis sativus L.) is an important vegetable crop cultivated worldwide due to its economic and nutritional benefits. The growth and development of cucumber are associated with increased nitrogen dependence [1,2]. Nitrogen (N) is an important phytonutrient that is usually required in large amounts, and its deficiency generally limits plant growth and development [3,4]. Thus, N functions as a signaling element that sustains plant growth and development, particularly under stressful conditions [5,6]. Deficient or excessive amounts of N have a significant negative impact on vegetables [3,7], suggesting that changing the forms of nitrogen supply without changing the molar amount of nitrogen is a very important pathway that influences the growth of plants.
Plants have the ability to take up several chemical forms of nitrogen, and different nitrogen forms have significant effects on the growth of plants [8]. The most common forms of nitrogen are ammonium (NH4+), which has a positive charge; nitrate (NO3−), which has a negative charge; and urea (CO(NH2)2), which has no charge [9]. Due to its inexpensive price and high N content (46% of the mass), urea is the most common N fertilizer used in agriculture worldwide, accounting for approximately 50% of the total world N fertilizer consumption [10].
The three forms of nitrogen have a common metabolic pathway, the glutamate pathway, through which nitrogen is assimilated into amino acids, and glutamine synthase (GS) and glutamate synthesis (GOGAT) play roles; therefore, this pathway is also called the GS/GOGAT cycle [11]. NH3 is converted into glutamine by GS, and glutamine is converted into glutamate by GOGAT; subsequently, these amino acids are assimilated into proteins, nucleic acids, etc. [12]. Glutamate dehydrogenase (GDH) plays an auxiliary role in the glutamate pathway by catalyzing the conversion of α-ketoglutaric acid and NH3 into glutamate, and this enzyme can also catalyze the inverse reaction [13]. Therefore, GS, GOGAT, and GDH are regarded as the main enzymes of nitrogen metabolism in higher plants [14]. However, these three forms of nitrogen undergo different absorption and metabolic processes before they are assimilated into NH4+-N. Plants directly assimilate NH4+-N into glutamate and indirectly assimilate NO3−-N into glutamate by reducing nitrate to nitrite and then to NH4+-N and by converting urea to glutamate through urease (Ur), which catalyzes the hydrolysis of CO(NH2)2 to carbamate and NH3 and then to NH4+-N [15,16]. Nitrate absorption is an active energy-requiring process involving an inverse electrochemical potential gradient [17]. There is an exclusive transport of nitrate nitrogen in the cytomembrane, in which NO3− is transported into the cell by the proton driving force generated by plasma membrane hydrolysis [18], and NH4+-N uptake by plant roots involves the ammonium transporter family [19]. The CO(NH2)2 transport systems in plant root cells have been identified and are mediated by the urea transporter DUR3 and aquaporins [15].
In general, NO3−-N is considered the most effective nitrogen form for cucumber growth, and cucumber prefers NO3−-N to NH4+-N; thus, KNO3 or Ca(NO3)2 is widely used in the production of cucumber [20,21,22]. However, scholars have also found that single nitrate could sometimes inhibit the growth of plants [23]. For good N nutrition, most plants prefer a mixture of NO3− and NH4+ rather than NH4+ or NO3− alone [15,24]. Single ammonium or nitrate nitrogen has adverse effects on the growth and development, yield, and quality of plants, while appropriate proportions of nitrate and ammonium nitrogen have favorable effects on plant growth, nitrogen absorption, and nitrogen metabolism processes, as well as on mineral element absorption [8,25]. Treatment with ammonium/nitrate at a ratio of 75/25 significantly increases the accumulation of N, P, and K in plants [26]. There are also reports on the effect of urea on plant growth. Combined applications of ammonium and nitrate were more effective than pure urea applications in perilla under salt stress [27]. On the other hand, a proper ratio of nitrate nitrogen and amide nitrogen can improve the nitrogen use efficiencies of pepper [28]. Additionally, urease activity was studied in soil [29] and potato [30]. Urea uptake was studied in maize [15] and oilseed [31]. However, few studies have reported on the metabolism and utilization of urea in crops, especially in cucumbers.
To date, there is limited information concerning the physiological and molecular responses of cucumber plants and the reciprocal influence of the different N forms. In this study, the responses to biochemical substances, N assimilation enzyme changes, nitrogen metabolism gene expression, and fruit yield of cucumber plants exposed to different N forms (NH4+-N, NO3−-N, CO(NH2)2, and their combinations) were examined. The purpose of these experiments is to determine whether urea and its combination are more favorable for cucumber growth and development and to explain its mechanism, further providing a theoretical basis for research on the nitrogen fertilizer supply for cucumber.

2. Materials and Methods

2.1. Plant Materials and Growth Conditions

The experiment was implemented in 2017 in a greenhouse at the Guizhou Academy of Agricultural Science (26°35′ N, 106°42′ E), China. The cucumber variety “Zhongnong 26” was acquired from Institute of Vegetables and Flowers, CAAS, P. R. China. The cucumber seeds were sterilized with 2.5% NaClO and germinated in gauze in the dark at 28 °C. After emergence, the seedlings were planted on plastic aperture disks (72 holes). Three weeks later, seedlings with two leaves were transplanted into plastic pots (diameter 25 cm and height 30 cm) containing 8 L of coir dust and grown in a greenhouse (28 ± 3 °C day/20 ± 2 °C night, relative humidity of 80%, 13 h light/11 h dark). There was one cucumber plant per pot, and their vines were hung when the cucumber plants had eight leaves. Cucumber plants were watered with nutrient solution at each watering to maintain the substrate water content at approximately 60% of its water-holding capacity. A tray was placed at the bottom of each pot to catch and return the leaked nutrient solution to the tray to fertilize the substrate in the pot.

2.2. Nitrogen Treatment

Each nitrogen treatment was characterized by the proportions of different nitrogen forms in the nutrient solution, and the nitrogen treatments were applied to each plant with the corresponding nutrient solution. Six treatments with the same total nitrogen contents were set with three single and three mixed forms of nitrogen (ammonium, nitrate, and amide) on the basis of Shanqi’s formula [24], in which AN represents ammonium nitrogen, NN represents nitrate nitrogen, and UN represents amide (urea) nitrogen in the treatments (Table 1). These treatments were 14 mM N, which was NH4+ as (NH4)2SO4 or NH4H2PO4 and NO3− as Ca(NO3)2·4H2O or KNO3. In all the N treatments, the other nutrient compositions were 3.5 Ca, 6.0 K, 2.0 Mg, and 1.0 P (mmol L−1) and 110 Fe, 20.6 B, 0.16 Cu, 5.3 Mn, 0.49 Mo, and 0.34 Zn (μmol L−1). For all N treatments, the solution pH was adjusted to 5.5 before addition to the substrate. Each experimental pot was fertilized with 1 L nutrient solution every five days until the harvest of the experimental plants; therefore, the applied nitrogen can be calculated from the nutrient solution input per cucumber plant throughout its growth period. In this experiment, there were two controls: one was 100% NH4+-N(AN) as a NO3−-N treatment with added CO(NH2)2, and the other was 100% NO3−-N(NN) as a NO3−-N treatment with added CO(NH2)2. Besides these, both 100% CO(NH2)2 and (50% NH4+ + 50% NO3−) were involved in the present study; the purpose of this was that the treatments could be compared with each other. Six treatments with 108 pots were employed in the experiment, allowing 18 pots for each treatment in three replicates. Six pots were randomly included in each replicate.

2.3. Determination of Plant Yield, Dry Weight, and Nitrogen Content

Measurement of yield: After the cucumber fruits reached harvest standard, which was usually 15 days after pollination, the fruits were harvested and weighed separately.
Determination of plant dry weight: The cucumber plants were harvested after undergoing N treatment for 60 days. At harvest, the plants were separated into leaf, stem, fruit, and root tissues before washing with distilled water. The fresh tissues were dried carefully at 105 °C for 20 min and then further dried at 80 °C for 48 h and subsequently weighed.
Nutrient element measurements: The dried samples were ground and passed through a 0.5 mm screen. Then, 0.5 g dry leaf, stem, fruit, and root tissue samples were soaked in 10 mL concentrated sulfuric acid (H2SO4) for 24 h, digested in 10 mL H2SO4 digestion buffer in a fume hood, and heated to 180 °C for 3 h, followed by the addition of 5 mL hydrogen peroxide (H2O2). The extract solution was transferred to 100 mL volumetric flasks and then diluted to 100 mL with deionized water for N assays. The N concentration was analyzed using an automatic Kjeldahl apparatus according to the manufacturer’s instructions (K9840, Shanghai, China), and the nitrogen content was calculated [22].

2.4. Biochemical Analysis

The third top leaf at the 15-leaf stage was taken from cucumber plants, immediately frozen in liquid nitrogen, and stored at −80 °C for biochemical and expression analyses. The protein-dye binding method was used to determine the protein content and the chlorophyll relative quantity was measured using a SPAD-502 chlorophyll analyzer (Konica Minolta, Tokyo, Japan) [32]; nitrates and total free amino acids were measured by hydroxybenzoic acid colorimetric analysis and ninhydrin chromogenic analysis, respectively [33,34]; an ELISA method was used to determine glutamate; and the citrulline content was measured by an HPLC method as described by Witte [30,35].
The nitrate reductase activity and GS activity were determined by sulfanilamide colorimetry and γ-glutamyl hydroxamate analysis, respectively [33,36]; GOGAT activity was measured by HPLC method as described by Esposito [37]; Turano’s method was used to determine GDH activity; and urease activity was measured by indophenol blue colorimetry [31,38].

2.5. Total RNA Isolation and cDNA Synthesis

The total RNA of the leaves from cucumber plants was extracted using a commercial RNA extraction kit (Tiangen, Beijing, China) according to the manufacturer’s instructions. The RNA quality was then assessed using a One-Drop spectrophotometer (Nanodrop Technologies Inc., Montchanin, DE, USA). The total RNA was incubated at 42 °C for 2 min with gDNA Eraser (TaKaRa, Dalian, China) to remove genomic DNA contamination. cDNA was synthesized using the Prime Script RT Reagent Kit (TaKaRa, Dalian, China), according to the manufacturer’s instructions. Finally, cDNA was diluted 15-fold with sterile ddH2O, and 2 μL of this diluted cDNA was used for quantitative real-time PCR (qRT-PCR) analysis.

2.6. Gene Expression Analysis by qRT-PCR

To detect the expression level of N-metabolism-related genes in cucumber, a total of 18 genes involved in N metabolism were identified from the transcriptomic database (http://cucurbitgenomics.org/) of cucumber after alignment with the sequences in Arabidopsis (Table 2). Primers were designed using Primer Premier 5 software (Primer Co., Waterloo, ON, Canada) according to the acquired gene sequences. The primer sequences used for qRT-PCR are shown in Table 2 and Table 3. qRT-PCR was carried out on the Bio-Rad CFX 96 Real-time System (Bio-Rad, San Diego, CA, USA) using TaKaRa SYBR Premix Ex Taq (TaKaRa, Dalian, China). Each PCR mixture comprised a total volume of 20 μL, containing 10 μL SYBR Premix Ex Taq, 7 μL sterile deionized water, 2 μL diluted cDNA template, 0.5 μL forward primer, and 0.5 μL reverse primer. qRT-PCR was conducted according to the manufacturer’s instructions. The conditions were controlled as follows: 95 °C for 30 s, followed by 40 cycles at 95 °C for 10 s, 60 °C for 20 s, and 65 °C for 10 s. The internal parameter was Actin. The data were obtained by using Bubner’s Ct (2−ΔΔCt) method to calculate the relative gene expression [39].

2.7. Statistical Analysis

The analysis of the variance was conducted by way of ANOVA with Tukey’s multiple range test at p < 0.05 in different N forms. Analyses were conducted on three replicates per treatment. Pearson’s correlation was carried out using SPSS 22.0 software (version 22, International Business Machines Corporation, Armonk, NY, USA).

3. Results

3.1. Effect of Different Nitrogen Forms on Cucumber Growth

The AN treatment showed the minimum dry matter (Figure 1A,C), nitrogen content (Figure 1D), and yield (Figure 1E), and this treatment was significantly lower than the other nitrogen treatments. The NN-UN treatment exhibited the maximum dry matter weights in plants, leaves, and fruits among the six treatments (Figure 1A,C). Furthermore, analysis of the dry matter proportion of the fruit weight to the total weight in the six treatments revealed a greater proportion of dry matter distributed to the fruit in the NN-UN treatment than in other treatments and a greater proportion of dry matter in the fruit after AN-UN treatment than after AN treatments (Figure 1A,F). The nitrogen content of the plants was highest after mixed or single urea treatments (UN, NN-UN, AN-UN), followed by the NN and AN-NN treatments (Figure 1D). These results showed that the nitrogen content in treatments containing urea was higher than that in treatments without urea (Figure 1B). The yield was highest in treatment with NN-UN, followed by AN-UN, UN, NN, and AN-NN treatments (Figure 1E), which indicated that treatment with NO3−-N and the addition of equal CO(NH2)2 could improve the yield of cucumber. Additionally, NH4+-N treatment with added equal CO(NH2)2 also improved the dry matter weight, nitrogen content, and yield of cucumber.

3.2. Effect of Different Nitrogen Forms on the Biochemical Metabolites in Cucumber

The highest content of proteins, free amino acids, and glutamate was observed in the NN-UN treatment and the lowest content was observed in the AN treatment, while a moderate content was detected in the other treatments (Figure 2A–C). The results demonstrated different protein, amino acid, and glutamate contents in cucumber after treatment with different nitrogen forms, and the trend was similar to that of the dry matter and yield.
The AN treatment showed the lowest nitrate content and glutamate content (Figure 2C,D).The glutamate content was highest after the NN-UN treatment, followed by the NN and UN treatments (Figure 2C). This trend was similar to that of the dry matter and yield of cucumber. Also, the NN treatment exhibited the maximum nitrate content, and the mixed NO3− treatments (AN-NN, NN-UN) manifested the second highest nitrate content (Figure 2D). The results showed that the application of NO3−-N increased the content of nitrate in cucumber. The nitrate content in cucumber can be reduced by changing the form of nitrogen under application of the same amount of nitrogen.
The UN treatment manifested the maximum citrulline content and the NN-UN treatment manifested the second highest citrulline content, while the AN-NN treatment showed minimum citrulline content and the AN treatment showed the second lowest citrulline content (Figure 2E). These results showed that the citrulline content in the treatment with added CO(NH2)2 was higher than that in the treatment with added NH4+-N with equal proportions of NO3−-N, in which the content of the former was twice as much as that of the latter. In addition, the citrulline content in treatments containing CO(NH2)2 was higher than that in treatments without CO(NH2)2, while that in the AN-UN treatment was higher than that in the AN treatment (Figure 2E).
The chlorophyll relative content of the two mixed nitrogen treatments (AN-NN, NN-UN) was higher than that of the single nitrogen application (AN, NN, UN). The mixed NH4+ treatment (AN-UN, AN-NN) showed the highest chlorophyll relative content, while the NN treatment manifested the lowest chlorophyll relative content (Figure 2F).

3.3. The Correlation between Biochemical Substance and the Growth Index of Cucumber

The leaf protein content and amino acid content were significantly correlated with leaf dry matter and total dry matter; their correlation coefficients were 0.930, 0.954, 0.968, and 0.985, respectively. Moreover, there was a significant positive correlation between leaf protein content and yield (r = 0.986), revealing that different nitrogen forms affected the protein content of cucumber and that cucumber yield is inseparable from its leaf protein content (Table 4).
There was also a significant positive correlation between the N content and the dry matter of leaves, as well as between the total N content and total dry matter (r = 0.930, 0.888), indicating that the N content had a close relationship with dry matter under the same application amount but with different forms of nitrogen supply (Table 4); thus, the yield and dry matter weight of cucumber can be increased by changing the form of nitrogen to improve the nitrogen content under the same amount of nitrogen supply.
Additionally, correlation analysis showed that there are significant positive correlations between NR activity and nitrate in cucumber (r = 0.871) (Table 4). This result indicates that the NR activity may be enhanced when the proportion of NO3−-N in treatments is increased.

3.4. Effect of Different Nitrogen Forms on Nitrogen-Metabolizing Enzymes in Cucumber

The NN-UN treatment exhibited maximum GOGAT activity and GS activity in the leaves among the six treatments with equal nitrogen (Figure 3A,B). Whether NH4+-N, NO3−-N, or CO(NH2)2, mixed nitrogen (AN-NN, NN-UN, AN-UN) showed higher GOGAT and GS activity than single nitrogen (AN, NN, UN). Conversely, single nitrogen showed higher GDH activity than mixed nitrogen, especially the AN treatment, which exhibited the highest activity (Figure 3C).
The NN-UN treatment exhibited the highest NR activity, and the AN-NN and NN treatment containing NO3− manifested the second highest NR activity, while other treatments without NO3−-N showed minimum NR activity (Figure 3D). These results showed that NR activity was improved in the NO3−-N treatment with added CO(NH2)2. Similarly, the urease activity was highest in the single urea treatment (UN), followed by the mixed urea treatments (NN-UN, AN-UN), and the other treatments without urea showed the lowest activity (Figure 3E). This result indicated that urease activity may be induced by the application of CO(NH2)2.

3.5. Expression Profiles of the N-Metabolism-Related Genes of Cucumber Treated with Different Nitrogen Forms

qRT-PCR was used to measure the relative expression levels of 18 genes involved in the nitrogen metabolism pathway in cucumber leaves under different nitrogen treatments (Table 2). In this experiment, the gene expression level was obtained for each gene on the basis of delta Ct at each treatment. Figure 4B,C show that the expression levels of the two genes involved in nitrate reduction, NR-2 and NR-3, were increased after NO3−-N treatment with added NH4+-N or CO(NH2)2 (NN-UN, AN-NN). The expression levels of NiR, the gene involved in nitrite reduction, increased after NO3−-N treatment with added NH4+-N or CO(NH2)2 (NN-UN, AN-NN), showing the same tendency as NR-2 and NR-3 (Figure 4E). The expression levels of the UR-2 gene involved in the urea cycle were increased significantly after NO3−-N treatment with added CO(NH2)2 (NN-UN), and its expression levels were also increased after NH4+-N treatment with added CO(NH2)2 (AN-UN). However, the expression levels of the UR-1 gene could not be detected in the experiment (Figure 4F).
There are 11 genes involved in the glutamate cycle of nitrogen metabolism in cucumber, including the glutamate synthesis genes GOGAT-1-1, GOGAT-1-2, GOGAT-2-1, and GOGAT-2-2; the glutamine synthesis genes GS-1 GS-2, GS-3, and GS-4; and the glutamate dehydrogenation genes GDH-1, GDH-2, and GDH-3 (Figure 4G–Q). Figure 4G shows that the expression level of the glutamate synthesis gene GOGAT-1-1 was increased after NO3−-N treatment with added CO(NH2)2 (NN-UN), while its expression levels decreased after NO3−-N treatment with added NH4+-N (AN-NN). In addition, the expression levels of the GS-1 and GS-4 genes involved in glutamine synthesis were increased after NO3−-N treatment with added CO(NH2)2, while their expression levels decreased after NO3−-N treatment with added NH4+-N. The expression levels of the two genes GS-4 and GOGAT-2-2 increased after NH4+-N treatment with added CO(NH2)2 (Figure 4K,L). The glutamate dehydrogenase gene GDH-3 had higher expression levels after treatment with single NH4+-N (AN) than after other treatments. Additionally, the GDH-2 gene had a higher expression level with a single nitrogen form than with mixed nitrogen forms (Figure 4P).

4. Discussion

4.1. Nitrogen Assimilation Response to Nitrogen Forms Prior to the Glutamate Cycle

Nitrogen assimilation mainly includes the reduction of NO3−-N and hydrolysis of CO(NH2)2 before nitrogen enters the glutamate cycle. In general, NO3−-N is thought to be the most effective nitrogen form for cucumber [21,22], but the application of single nitrate easily leads to excessive nitrate content in spinach, and the yield is sometimes not ideal [40]. A study has shown that the nitrate content in Chinese cabbage is too high, and the quality of vegetable is affected when large amounts of nitrate nitrogen are absorbed [41]. Therefore, determining how to promote nitrate reduction and reduce nitrate content is important. The NR activity of the single NO3−-N treatment was lower than that of the NO3−-N treatment with added CO(NH2)2 in our study, which showed that the NO3−-N treatment with added equal CO(NH2)2 promoted nitrate reduction in cucumber. A similar result showed that the content of nitrate in Chinese cabbage was reduced when NO3−-N was partially replaced with CO(NH2)2 [42]. However, the molecular responses of CO(NH2)2 were not investigated in their study. Our study found that the gene expression levels of the NR-2, NR-3, and NiR genes involved in nitrate reduction were increased after NO3−-N treatment with added NH4+-N or CO(NH2)2, which could promote nitrate reduction and reduce the nitrate content of cucumber.
At present, few studies examine urease activity, UR gene expression, and CO(NH2)2 metabolism. In the present study, we found that the urease activity was highest in single urea treatments, which indicated that this activity may be induced by the application of CO(NH2)2. The expression levels of the UR-2 gene involved in urea degradation were increased significantly after NO3−-N treatment with added CO(NH2)2. Additionally, the expression levels of the UR-2 gene were increased after NH4+-N treatment with added CO(NH2)2. Moreover, dry matter and yield in the NO3−-N and CO(NH2)2 treatments were higher than those in the NO3−-N and NH4+-N treatments with equal nitrogen in the two mixed NO3−-N treatments, which may be due to the multi-pathway metabolism of CO(NH2)2. Urea metabolism mainly occurs through two pathways: the urease pathway and the amino acid pathway. In the urease pathway, urea is hydrolyzed to NH3 and then enters into the GS/GOGAT pathway, which is the same pathway as that for ammonium assimilation [43,44]. The amino acid metabolic pathway is completely different from the ammonium and nitrate metabolism pathway in that urea is not decomposed to NH3 but is assimilated directly into amino acids. First, CO(NH2)2 is transferred into the cell by transport molecules and combines with phosphate groups; then, this molecule is synthesized into citrulline. Subsequently, citrulline enters the urea cycle and synthesizes the amino acids that plants need. Thus, citrulline is the most important intermediate in CO(NH2)2 metabolism, and its content reflects the activity of amide nitrogen metabolism in the amino acid pathway [31,44]. In the present study, the citrulline content after treatment with added CO(NH2)2 was higher than that after treatment with added NH4+-N with equal proportions of NO3−-N, in which the content of the former is twice as much as that of the latter. Therefore, we deduced that the amino acid pathway of urea metabolism promoted N metabolism in treatments containing CO(NH2)2 and enhanced the protein content and N content in the leaves, which further increased the dry matter weight of plants. Similarly, the amino acid pathway metabolism of CO(NH2)2 may cause higher dry matter weight and yield after NH4+-N and CO(NH2)2 treatments than after the pure NH4+-N treatment.
After NO3−-N treatment with added equal CO(NH2)2, the expression levels of the NR-2, NR-3, and NiR genes involved in nitrate reduction were increased, and the NR activity increased, promoting nitrate assimilation. Moreover, the mixture of NO3−-N and CO(NH2)2 exhibited higher urease activity and increased the expression levels of the UR-2 gene involved in urea metabolism, resulting in the promotion of urea metabolism. In addition, urea metabolism lies in the amino acid metabolic pathway to enhance metabolic channels; urea is not decomposed to NH3 but is assimilated directly into amino acids. Consequently, the NO3−-N treatment with added CO(NH2)2 promoted nitrogen metabolism to improve biomass but reduced the content of nitrate. After NH4+-N treatment with added equal CO(NH2)2, the change in nitrogen form promoted both the urease pathway and the amino acid metabolic pathway of urea metabolism, resulting in the partial substitution of CO(NH2)2 with NH4+-N, which also promoted nitrogen metabolism to improve biomass.

4.2. Glutamate Cycle Response to Nitrogen Forms

The three forms of nitrogen have a common metabolic pathway, the glutamate pathway, in which NH4+-N is assimilated into amino acids, and three important enzymes—GS, GOGAT, and GDH—play a role (Figure 1). The present study showed that the mixed form of nitrogen had higher GOGAT activity and GS activity than the single form of nitrogen, and the mixed NO3−-N and CO(NH2)2 supply exhibited the maximum GOGAT activity and GS activity in plant leaves among the six treatments with equal nitrogen. The results suggest that mixed nitrogen may promote nitrogen metabolism. Similar conclusions have been drawn from studies on the effects of N forms on GS/GOGAT after NO3−-N treatment with added NH4+-N in cucumber [45] and cotton seedlings [46], but CO(NH2)2 was not included in their study. Furthermore, we found that the gene expression levels were slightly different from enzyme activity but consistent with dry matter accumulation. The expression levels of the genes GOGAT-1-1, GS-1, and GS-4 involved in the glutamate cycle were increased after NO3−-N treatment with added CO(NH2)2, while the expression levels of the former two genes decreased after NO3−-N treatment with added NH4+-N. This finding suggested that NO3−-N treatment with added equal CO(NH2)2 could promote nitrogen metabolism, but NO3−-N treatment with added equal NH4+-N could restrain nitrogen metabolism. Moreover, the NH4+-N treatment with added equal CO(NH2)2 also promoted nitrogen metabolism, and the expression levels of the two genes related to nitrogen metabolism (GS-4, GOGAT-2-2) were increased. In addition, the change in glutamate content was similar to that of dry matter and cucumber yield in the present study because glutamate was the most important intermediate in the nitrogen metabolism pathway, and its content reflects the vitality of nitrogen metabolism [35]. After NH4+-N treatment with added equal CO(NH2)2, the glutamate content in cucumber was enhanced.
Contrary to GS/GOGAT, a single form of nitrogen manifested higher GDH activity than mixed nitrogen, and the single NH4+-N treatment manifested the highest activity, which indicated that GDH played a critical role as the GS-GOGAT cycle was restrained. Many studies reported that the role of GDH in the nitrogen metabolism pathway was greatly increased during plant growth stress, especially ammonia toxicity, and suggested that GDH may play an important role in removing excessive ammonia and removing ammonia toxicity in plants [47,48]. Moreover, gene expression analyses in the present study also indicated GDH activity. GDH-3 had higher expression levels in the treatment with single NH4+-N than in other treatments. Additionally, the GDH-2 gene with a single form of nitrogen showed higher expression levels than with the mixed form of nitrogen, which was consistent with GDH activity. Additionally, the deamination catalyzed by GDH can provide a sufficient carbon skeleton for the tricarboxylic cycle in plants under stress [13]. In the present study, there was higher nitrogen content, dry matter weight, and yield in the treatment with 50% NH4+-N + 50% CO(NH2)2 than in the 100% NH4+-N treatment; this may be because the substitute of CO(NH2)2 for NH4+-N relieves the ammonia toxicity of the pure NH4+-N treatment, which downregulates the GDH-3 gene expression response to the changes after NH4+-N treatment with added CO(NH2)2.
As a result, the NO3−-N treatment with added equal CO(NH2)2 increased GOGAT-1-1 and GS-4 gene expression, improved GOGAT and GS activities, promoted the GS-GOGAT cycle of nitrogen metabolism, and increased the protein and nitrogen contents in cucumber leaves. Additionally, the treatment of NH4+-N with added equal CO(NH2)2 increased GOGAT-2-2 and GS-4 gene expression, improved GOGAT and GS activities, promoted the GS-GOGAT cycle, increased the protein and nitrogen contents in cucumber leaves, and relieved the ammonia toxicity of pure NH4+-N treatment.

4.3. Utilization of the Nitrogen Response to Nitrogen Forms

From the experimental findings about nitrate reduction, urea hydrolysis, and NH4+-N assimilation of cucumber, we can observe that the majority of mixed nitrogen could promote nitrogen metabolism, including NO3−-N with added equal CO(NH2)2, NH4+-N with added equal CO(NH2)2, and NH4+-N with added equal NO3−-N. The mixed forms of nitrogen had higher GOGAT activity and GS activity than the single forms of nitrogen, which suggested that mixed nitrogen may promote the GS-GOGAT cycle of nitrogen metabolism. Additionally, the chlorophyll relative content in plants after the three mixed nitrogen treatments was higher than that after the single nitrogen application, which indicated that mixed nitrogen treatments with high chlorophyll relative content could promote photosynthesis in cucumber.
In experiments on cucumber growth, both NO3−-N treatment with added equal CO(NH2)2 and NH4+-N treatment with added CO(NH2)2 could improve dry matter weight and total nitrogen content, and more dry matter was distributed to the fruit, resulting in a significantly higher yield of cucumber than after treatment with pure NO3−-N or pure NH4+-N. However, not all mixed nitrogen forms of equal ratio could enhance dry matter weight and yield. The NO3−-N treatment with added equal NH4+-N did not improve the total dry matter weight or yield in the experiment. What accounts for this finding? In addition to being affected by the expression of nitrogen metabolism genes involved in nitrate reduction, urea utilization, and the glutamate cycle, NO3−-N treatment with added equal NH4+-N may lead to ammonia toxicity. Scholars believe that high ammonium concentrations can inhibit the absorption of K+ and Ca2+ through ammonia toxicity [43,49]. The NH4+-N + NO3−-N treatment has been reported to affect the absorption and assimilation of nitrogen because excessive ammonium in the nutrient solution led to toxic effects on muskmelon [50]. The growth of lettuce, spinach, cabbage, and garden sass were good with a single NO3−-N source, while the growth of these four vegetables was restrained with a NO3−-N + NH4+-N (1:1) N source and decreased greatly with single NH4+-N [51]. Similar conclusions about ammonia toxicity have also been shown by other scholars in studies on nitrogen utilization in cucumbers [52,53]. The present study found that pure NH4+-N treatment had a minimum effect on the content of glutamate, protein, and nitrogen; dry matter; and yield compared with the effects of the other treatments, which may be due to the ammonia toxicity. NH4+-N treatment with added equal CO(NH2)2 is likely to significantly increase the total dry matter weight and may relieve the ammonia toxicity of pure NH4+-N treatment.
To reveal the effects of biochemical metabolism on cucumber growth, the important nitrogen metabolites were studied herein. The results showed that leaf protein content was significantly correlated with dry matter and yield. In line with these relationships, we deduced that leaf protein content is inseparable from the yield of cucumber under treatment with different nitrogen forms but with the same amount of nitrogen. Other studies have also reported that the biochemical processes of plants are also different with different nitrogen forms [54]. Furthermore, there was a significant positive correlation between leaf nitrogen content and leaf dry matter and between total nitrogen content and total dry matter in the present study. Therefore, it seems feasible that the dry matter weight of cucumber could be increased by changing the form of nitrogen to improve the nitrogen content under conditions with the same amount of nitrogen.

5. Conclusions

In the present study, the expression levels of six genes, including US-2, NR-2, NR-3, NiR, GOGAT-1-1, and GS-4, were upregulated after treatment with NO3−-N with added equal CO(NH2)2, demonstrating that urea addition could increase the expression of the genes involved in nitrogen metabolism. The gene expression levels of US-2, GOGAT-2-2, and GS-4 were upregulated after treatment with NH4+-N with added equal CO(NH2)2, but GDH-3 expression was downregulated, demonstrating that urea could increase the expression of nitrogen metabolism genes and relieve the ammonia toxicity of pure NH4+-N treatment. Consequently, treatment with both NO3−-N with added equal CO(NH2)2 and NH4+-N with added CO(NH2)2 enhanced GOGAT, GS, and UR activities; increased the amino acid pathway of N metabolism; improved the content of glutamate, protein, chlorophyll, and nitrogen; and improved the dry matter weight. Furthermore, a greater proportion of dry matter was distributed to the fruit to improve yield. Additionally, the mixed NO3−-N and CO(NH2)2 supply promoted nitrate reduction, urea utilization, and the GS-GOGAT cycle of nitrogen metabolism in cucumber plants but reduced the nitrate content in cucumber. Therefore, treatment with 50% NO3−-N + 50% CO(NH2)2 was the most appropriate combination of nitrogen forms used in the study. Also, it must be pointed out that the result cannot be used in soil culture by farmers because this experiment was carried out in coir dust rather than in soil, but it could provide a scientific reference from a fundamental and plant physiology point of view in soilless culture. Additionally, a significant positive correlation was found between nitrogen content and dry matter as well as between leaf protein content and yield in different treatment forms with equal nitrogen, indicating that different nitrogen forms affected the protein content in the leaves, which was correlated with the yield and dry matter of cucumber.

Author Contributions

W.J. conceived and designed the experiment; C.M., T.B. and X.L. performed the experiments; H.Y. and Q.L. analyzed the data; C.M. wrote the paper; W.J., C.M. and J.X. revised the paper. All authors have read and approved the final manuscript.

Funding

This study was supported by the National Natural Science Foundation of China [31760596] and the Youth Fund of Guizhou Academy of Agricultural Science [2018(84)].

Acknowledgments

We thank Heng Wang for gene searching. We thank Tiantian Ban and Xiaohui Li for their assistance. Finally, we acknowledge for their helpful discussions all the members of our research team. In addition, we thank American Journal Experts (www.aje.com) for its linguistic assistance during the preparation of this manuscript.

Conflicts of Interest

The authors declare that they have no conflict of interest.

References

  1. Yang, X.; Wang, X.; Wei, M.; Hikosaka, S.; Goto, E. Changes in growth and photosynthetic capacity of cucumber seedings in response to nitrate stress. Braz. J. Plant Phyalol. 2009, 21, 309–317. [Google Scholar] [CrossRef]
  2. Wu, T.Z.; Qin, L.; Fan, C.; Xue, X.; Zhou, M.; Xin, Y. Involvement of CsNRT1.7 in nitrate recycling during senescence in cucumber. Plant Nutr. Soil Sci. 2014, 177, 714–721. [Google Scholar] [CrossRef]
  3. Iqbal, N.; Umar, S.; Khan, N.A. Nitrogen availabiity regulates proline and ethylene production and alleviates salinity stress in mustard (Brassica juncea). J. Plant Physlol. 2015, 178, 84–91. [Google Scholar] [CrossRef]
  4. Muhammad, S.; Muhammad, Y.; Rashid, M.; Lftikhar, A. Effect of Soil applied CaC2 on gas exchange characters, nitrogen metabolism and fruit yield in cucumber (Cucumis sativus). N. Z. J. Crop Hortic. Sci. 2017, 45, 251–262. [Google Scholar] [CrossRef]
  5. Mi, G.; Chen, F.; Zhang, F. Multiple signaling pathways controls nitrogen-mediated root elongation in maize. Plant Signal Behav. 2008, 3, 1030–1032. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  6. Mohd-Radzman, N.A.; Djordjevic, M.A.; Imin, N. Nitrogen modulation of legume architecture root signaling pathways involves phytohormones and small regulatory molecules. Front. Plant Sci. 2013, 4, 385. [Google Scholar] [CrossRef]
  7. Zhao, W.; Yang, X.; Yu, H.; Jiang, W.; Sun, N.; Liu, X.; Liu, X.; Zhang, X.; Wang, Y.; Gu, X. RNA-seq-based transcriptome profiling of early nitrogen deficiency response in cucumber seedlings provides new insight into the putative nitrogen regulatory. Plant Cell Physiol. 2015, 56, 455–467. [Google Scholar] [CrossRef]
  8. Helali, S.M.R.; Nebli, H.; Kaddour, R. Influence of nitrate/ammonium ratio on growth and nutrition of Arabidopsis thaliana. Plant Soil 2010, 336, 65–74. [Google Scholar] [CrossRef]
  9. Lentherwood, N.R.; Peter, C. Nitrogen: All forms are not equal. Greenh. Manag. 2009, 29, 22–23. [Google Scholar]
  10. Antonio, L.; Maria, P.P.; Fabrizio, A.; Anthony, J.M.; Francesco, S.; Maria, R. Physiological and molecular responses in tomato under different forms of N nutrition. J. Plant Physiol. 2017, 216, 17–25. [Google Scholar] [CrossRef]
  11. Chen, L.; Zhu, Y.L.; Yang, L.F. Effects of nitrogen forms and ratios on plant growth, seed antioxidant enzyme activities and reactive oxygen metabolism of vegetable soybean. Plant Nutr. Fertil. Sci. 2010, 16, 768–772, (In Chinese with English Abstract). [Google Scholar]
  12. Miflin, B.J.; Habash, D.Z. The role of glutamine synthetase and glutamate dehydrogenase in nitrogen assimilation and possibilities for improvement in the nitrogen utilization of crops. J. Exp. Bot. 2002, 53, 979–987. [Google Scholar] [CrossRef] [Green Version]
  13. Aubert, S.; Bligny, R.; Douce, R.; Gout, E.; Ratcliffe, R.G.; Roberts, J.K.M. Contribution of glutamate dehydrogenase to mitochondrial glutamate metabolism studied by 13C and 31P nuclear magnetic resonance. J. Exp. Bot. 2001, 52, 37–45. [Google Scholar] [CrossRef]
  14. Zhou, Y.H.; Zhang, Y.L.; Wang, X.M.; Cui, J.X. Effects of nitrogen form on growth, CO2 assimilation, chlorophyll fluorescence, and photosynthetic electron allocation in cucumber and rice plants. J. Zhejiang Univ. Sci. B 2011, 12, 126–134. [Google Scholar] [CrossRef]
  15. Zanin, L.; Zamboni, A.; Monte, R.; Tomasi, N.; Varanini, Z.; Cesco, S.; Pinton, R. Transcriptomic analysis highlights reciprocal interactions of urea and nitrate for nitrogen acquisition by maize roots. Plant Cell Physiol. 2015, 56, 532–548. [Google Scholar] [CrossRef]
  16. Baligar, V.C.; Fageriat, N.K. Influence of nitrogen forms and levels on the growth and nutrition of cacao. J. Plant Nutr. 2017, 40, 709–718. [Google Scholar] [CrossRef]
  17. Marschner, H. Mineral nutrition in higher plants. Acad. Press Univ. Hohenh. Ger. 2011, 8, 147–148. [Google Scholar]
  18. Li, Q.Y.; Xu, X.J.; Gu, H.L.; Gao, H.Y.; Zhu, Y.Y.; Dong, C.X.; Shen, Q.R. Effects of applying different nitrogen form on cherry tomato nitrogen metabolism during fruit development. Chin. J. Appl. Ecol. 2010, 21, 2335–2341. [Google Scholar] [CrossRef]
  19. He, X.; Zhang, P.W.; Ding, C.Y. Effects of nitrate/ammonium ratio on nitrate absorption and distribution of carbon and nitrogen in pakchoi growing under low light intensity. Acta. Pedologica Sinica. 2009, 46, 452–458. [Google Scholar]
  20. Lu, J.M.; Yang, R.T.; Wang, H.C.; Huang, X.M. Stress effects of chlorate on longan (Dimocarpus longanlour) trees:changes in nitrogen and carbon nutrition. Hortic. Plant J. 2017, 3, 237–246. [Google Scholar] [CrossRef]
  21. Gangwar, S.; Singh, V.P. Indole acetic acid differently changes growth and nitrogen metabolism in Pisum sativum L. seedlings under chromium (VI) phytotoxicity: Implication of oxidative stress. Sci. Hortic. 2011, 129, 321–328. [Google Scholar] [CrossRef]
  22. Kotsiras, A.; Olympios, C.M.; Drosopoulos, J. Effects of nitrogen form and concentration on the distribution of ions within cucumber fruits. Sci. Hortic. 2002, 95, 175–183. [Google Scholar] [CrossRef]
  23. Narumol, P.; Xu, Z.; Hans, B. Nitrogen nutrition of Cyperus laevigatus and Phormium tenax: Effects of ammonium versus nitrate on growth, nitrate reductase activity and N uptake kinetics. Aquat. Bot. 2013, 106, 42–51. [Google Scholar] [CrossRef]
  24. Marschner, H. Mineral Nutrition of Higher Plants, 2nd ed.; California Academic Press: San Diego, CA, USA, 1995; pp. 138–146. [Google Scholar] [CrossRef]
  25. Yang, Y.; Zheng, Q.L.; Pei, C.G. Effects of NO3−-N/NH4+-N ratios on chardonnay grape seedling growth and nitrogen nutrition. Plant Nutr. Fertil. Sci. 2010, 16, 370–375. [Google Scholar] [CrossRef]
  26. Lu, Y.L.; Li, Q.Y.; Xu, X.J. Effects of different nitrogen forms on nutrient element contents in tomato seedlings. Chin. Agric. Sci. Bull. 2011, 26, 122–130, (In Chinese with English Abstract). [Google Scholar]
  27. Sui, L.; Yi, J.N.; Wang, K.C.; Li, Y.Q. Effects of different forms and ratios of nitrogen on physiological characteristic of Perilla frutescens (L.) Britt under salt stress. Chin. J. Ecol. 2018, 37, 3277–3283. [Google Scholar]
  28. Guan, X.L.; Wang, X.Z.; Liu, B.; Fan, S.S.; Chen, X.P. Yield, fruit quality of pepper and nitrogen loss under different amide/nitrate ratios in three types of soils. J. Plant Nutr. Fertil. 2017, 23, 730–739. [Google Scholar]
  29. Huang, Y.; Zhao, L.Q.; Kong, Q.S.; Cheng, F.; Niu, M.L.; Xie, J.J.; Muhammad, A.N.; Bie, Z.L. Comprehensive mineral nutrition analysis of watermelon grafted onto two different rootstocks. Hortic. Plant J. 2016, 2, 105–113. [Google Scholar] [CrossRef]
  30. Witte, C.; Tiller, S.A.; Taylor, M.A.; Davies, H.V. Leaf urea metabolism in potato. Urease activity profiles and patterns of recovery and distribution of 15N after foliar urea application in wild-type and urease-antisense transgenics. Plant Physiol. 2002, 129, 1129–1136. [Google Scholar] [CrossRef]
  31. Mustapha, A.; Xavier, S.; Laëtitia, J.; Philippe, L.; Philippe, E.; José, M. Hydroponics versus field lysimeter studies of urea, ammonium and nitrate uptake by oilseed rape (Brassica napus L.). J. Exp. Bot. 2012, 63, 5245–5258. [Google Scholar] [CrossRef]
  32. Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
  33. Hageman, R.H.; Hucklesby, D.P. Nitrate reductase from higher plants. Methods Enzymol. 1971, 23, 491–503. [Google Scholar] [CrossRef]
  34. Li, B.Z.; Xin, W.J.; Sun, S.B. Physiological and molecular responses of nitrogen-starved rice plants to re-supply of different nitrogen sources. Plant Soil 2006, 287, 145–159. [Google Scholar] [CrossRef]
  35. Cross, J.M.; Korff, M.; Altmann, T.; Bartzetko, L.; Sulpice, R.; Gibon, Y.; Palacios, N.; Stitt, M. Variation of enzyme activities and metabolite levels in 24 Arabidopsis accessions growing in carbon-limited conditions. Plant Physiol. 2006, 142, 1574–1588. [Google Scholar] [CrossRef]
  36. O’Neal, D.; Joy, K.D. Glutamine synthetase of pea leaves. I. Purification, stabilisation and pH optima. Arch. Biochem. Biophys. 1973, 159, 113–122. [Google Scholar] [CrossRef]
  37. Esposito, S.; Guerriero, G.; Vona, V.; Martino, V.; Carfagna, S.; Rigano, C. Glutamate synthase activities and protein changes in relation to nitrogen nutrition in barley: the dependence on different plastidic glucose-6P dehydrogenase isoforms. J. Exp. Bot. 2005, 56, 55–64. [Google Scholar] [CrossRef] [PubMed]
  38. Turano, F.J.; Dashner, R.; Upadhyaya, A.; Caldwell, C.R. Purification of mitochondrial glutamate dehydrogenase from dark-grown soybean seedlings. Plant Physiol. 1996, 112, 1357–1364. [Google Scholar] [CrossRef]
  39. Bubner, B.; Baldwin, T. Use of real-time PCR for determining copy number and zygosity in transgenic plants. Plant Cell Rep. 2004, 23, 263–271. [Google Scholar] [CrossRef]
  40. Wang, J.f.; Dong, C.X.; Yue, X.; Shen, Q. Effects of NH4+-N/ NO3−-N ratios on growth, nitrate uptake and organic acid levels of spinach (Spinacia oleracea L.). Afr. J. Biotechnol. 2009, 15, 3597–3602. [Google Scholar] [CrossRef]
  41. Chen, G.L.; Gao, X.R. Effect of partial replacement of nitrate by amino acid and urea on nitrate content of nonheading Chinese cabbage and lettuce in hydroponics. Sci. Agric. Sin. 2002, 4, 444–449. [Google Scholar] [CrossRef]
  42. Zhu, Y.; Gang, L.; Liu, H.; Sun, G.; Chen, R.; Song, S. Effects of partial replacement of nitrate with different nitrogen forms on the yield, quality and nitrate content of Chinese kale. Commun. Soil Sci. Plant Anal. 2018, 49, 1384–1393. [Google Scholar] [CrossRef]
  43. Cao, F.Q.; Liu, G.W.; Wang, W.H.; Wu, X.M.; Liu, L.H. Molecular processes of urea metabolism and transport in higher plants. Chin. Bull. Bot. 2009, 44, 273–282. [Google Scholar] [CrossRef]
  44. Caroline, M.S.; Collier, J.; Berg, G.; Glibert, P. Role of urea in microbial metabolism in aquatic systems: a biochemical and molecular review. Aquat. Microb. Ecol. 2010, 59, 67–88. [Google Scholar] [CrossRef]
  45. Zhang, X.C.; Liu, Y.M.; Yu, X.C. Effects of different NO3−-N/NH4+-N ratios on cucumber seedlings growth, nitrogen absorption and metabolism under suboptimal temperature and light intensity. Chin. J. Appl. Ecol. 2016, 27, 2527–2534. [Google Scholar] [CrossRef]
  46. Zhang, S.Y.; Chu, G.X.; Liang, Y.C. Effects of enhancing ammonium nutrition on the nitrogenous metabolisms of cotton seedlings grown hydroponically under low-temperature stress. J. Plant Nutr. Fertil. 2017, 23, 983–990, (In Chinese with English Abstract). [Google Scholar]
  47. Céline, M.D.; Valadier, M.H.; Carrayol, E.; Haw, J. Diurnal changes in the expression of glutamate dehydrogenase and nitrate reductase are involved in the C/N balance of tobacco source leaves. Plant Cell Environ. 2002, 25, 1451–1462. [Google Scholar] [CrossRef]
  48. Villa, M.S.; Gonzalez, G.A.; Torres, J.L. Effect of the NH4+/NO3− ratio on GS and PEPcase activities and on dry matter prodution in wheat. J. Plant Nutr. Fertil. 1992, 15, 2545–2557. [Google Scholar] [CrossRef]
  49. Botella, M.A.; Martínez, V.; Nieves-Cerdá, M.A. Effect of salinity on the growth and nitrogen uptake by wheat seedlings. J. Plant Nutr. 1997, 20, 793–804. [Google Scholar] [CrossRef]
  50. Xu, R.Y.; Bie, Z.L.; Huang, D.F. Effects of different nitrogen forms on the dry matter accumulation and leaf nitrogen metabolism of muskmelon. Trans. CSAE. 2005, 21, 147–150, (In Chinese with English Abstract). [Google Scholar]
  51. Tian, X.H.; Li, S.H. Uptake capacity of several vegetable crops to nitrate and ammonium. Plant Nutr. Fertil. Sci. 2000, 6, 194–201, (In Chinese with English Abstract). [Google Scholar]
  52. Roosta, H.R.; Schjoerring, J.K. Effects of ammonium toxicity on nitrogen metabolism and elemental profile of cucumber plants. J. Plant. Nutr. 2007, 30, 1933–1951. [Google Scholar] [CrossRef]
  53. Baev, M.V.; Kiriukhin, M.Y. Regulation of ammonia assimilation in an obligate methylotroph Methylobacillus flagellatum under steady-state and transient growth conditions. Antonie Leeuwenhoek 1997, 71, 353–361. [Google Scholar] [CrossRef] [PubMed]
  54. Lopes, M.S.; Araus, J.L. Comparative genomic and physiological analysis of nutrient response to NH4+, NH4+:NO3− and NO3− in barley seedlings. Physiol. Plant. 2008, 134, 134–150. [Google Scholar] [CrossRef] [PubMed]
Agronomy 09 00262 g001 550
Figure 1. Effect of different nitrogen forms on dry matter weight, nitrogen content, and yield in cucumber. (A) Dry matter weight of each individual organ; (B) Nitrogen content of each individual organ; (C) Dry matter weight of each individual plant; (D) Nitrogen content of each individual plant; (E) Yield of each individual plant; (F) Effect on root–shoot ratio of the nitrogen form. Bars represent the standard error. Different letters above the bars indicate significant differences at p < 0.05 according to Tukey’s multiple comparison test.
Figure 1. Effect of different nitrogen forms on dry matter weight, nitrogen content, and yield in cucumber. (A) Dry matter weight of each individual organ; (B) Nitrogen content of each individual organ; (C) Dry matter weight of each individual plant; (D) Nitrogen content of each individual plant; (E) Yield of each individual plant; (F) Effect on root–shoot ratio of the nitrogen form. Bars represent the standard error. Different letters above the bars indicate significant differences at p < 0.05 according to Tukey’s multiple comparison test.
Agronomy 09 00262 g001
Agronomy 09 00262 g002 550
Figure 2. Effect of different nitrogen forms on the biochemical metabolites in cucumber. (A) protein content; (B) Amino acid content; (C) Glutamate content; (D) Nitrate content; (E) Citrulline content; (F) chlorophyll relative content. Bars represent the standard error. Different letters above the bars indicate significant differences at p < 0.05 according to Tukey’s multiple comparison test.
Figure 2. Effect of different nitrogen forms on the biochemical metabolites in cucumber. (A) protein content; (B) Amino acid content; (C) Glutamate content; (D) Nitrate content; (E) Citrulline content; (F) chlorophyll relative content. Bars represent the standard error. Different letters above the bars indicate significant differences at p < 0.05 according to Tukey’s multiple comparison test.
Agronomy 09 00262 g002
Agronomy 09 00262 g003 550
Figure 3. Effect of different nitrogen forms on nitrogen-metabolizing enzymes in cucumber. (A) GOGAT activity; (B) GS activity; (C) GDH activity; (D) NR activity; (E) Urease activity. Bars represent the standard error. Different letters above the bars indicate significant differences at p < 0.05 according to Tukey’s multiple comparison test.
Figure 3. Effect of different nitrogen forms on nitrogen-metabolizing enzymes in cucumber. (A) GOGAT activity; (B) GS activity; (C) GDH activity; (D) NR activity; (E) Urease activity. Bars represent the standard error. Different letters above the bars indicate significant differences at p < 0.05 according to Tukey’s multiple comparison test.
Agronomy 09 00262 g003
Agronomy 09 00262 g004 550
Figure 4. The expression profiles of genes involved in metabolizing nitrogen in cucumber. (A) NR-1; (B) NR-2; (C) NR-3; (D) NR-4; (E) NiR; (F) UR-2; (G) GOGAT-1-1; (H) GOGAT-1-2; (I) GOGAT-2-1; (J) GOGAT-2-2; (K) GS-1; (L) GS-2; (M) GS-3; (N) GS-4; (O) GDH-1; (P) GDH-2; (Q) GDH-3. Bars represent the standard error. Different letters above the bars indicate significant differences at p < 0.05 according to Tukey’s multiple comparison test.
Figure 4. The expression profiles of genes involved in metabolizing nitrogen in cucumber. (A) NR-1; (B) NR-2; (C) NR-3; (D) NR-4; (E) NiR; (F) UR-2; (G) GOGAT-1-1; (H) GOGAT-1-2; (I) GOGAT-2-1; (J) GOGAT-2-2; (K) GS-1; (L) GS-2; (M) GS-3; (N) GS-4; (O) GDH-1; (P) GDH-2; (Q) GDH-3. Bars represent the standard error. Different letters above the bars indicate significant differences at p < 0.05 according to Tukey’s multiple comparison test.
Agronomy 09 00262 g004
Table
Table 1. The composition of nitrogen treatments in terms of different nitrogen forms.
Table 1. The composition of nitrogen treatments in terms of different nitrogen forms.
TreatmentsSingle Nitrogen FormsTreatmentsMixed Nitrogen Forms
AN(Control 1)100% NH4+-NAN-NN50% NO3−-N + 50% NH4+-N
NN(Control 2)100% NO3−-NNN-UN50% NO3−-N + 50% CO(NH2)2
UN100% CO(NH2)2AN-UN50% NH4+-N + 50% CO(NH2)2
AN: ammonium nitrogen; NN nitrate nitrogen; UN: urea nitrogen.
Table
Table 2. List of 18 genes related to nitrogen metabolism in cucumber.
Table 2. List of 18 genes related to nitrogen metabolism in cucumber.
Gene AbbreviationAccession No.Biological Process and Molecular FunctionFunction
NR-1XM004139616.2Cyclic pyranopterin monophosphate synthase accessory protein Mitochondrial transcript variant X1,nitrate reduction
NR-2NM001280767.1nitrate reductase [NADH]-like (NR2)nitrate reduction
NR-3XM004135853.2Cyclic pyranopterin monophosphate synthase, mitochondrialnitrate reduction
NR-4XM011661764.1Molybdopterin biosynthesis protein CNX1nitrate reduction
NiRXM004140647.2Ferredoxin-nitrite reductase, chloroplastic (NIR)nitrite reduction
GS-1NM001280715.1Glutamine synthetase cytosolic isozyme-like (GS1)glutamine synthesis
GS-2XM011661119.1Glutamine synthetase nodule isozyme-likeglutamine synthesis
GS-3XM011656924.1Glutamine synthetase nodule isozymeglutamine synthesis
GS-4XM004134113.2Glutamine synthetase leaf isozyme, chloroplastic transcript variant X1glutamine synthesis
GOGAT-1-1XM004136730.2Ferredoxin-dependent glutamate synthase, chloroplastic, transcript variant X1glutamate synthesis
GOGAT-1-2XM011653889.1Ferredoxin-dependent glutamate synthase, chloroplastic, transcript variant X2glutamate synthesis
GOGAT-2-1XM011653296.1Glutamate synthase [NADH], amyloplastic, transcript variant X1glutamate synthesis
GOGAT-2-2XM011653298.1Glutamate synthase [NADH], amyloplastic, transcript variant X3glutamate synthesis
GDH-1XM004147487.2Glutamate dehydrogenase 1, transcript variant X2glutamate dehydrogenation
GDH-2XM004146845.2Glutamate dehydrogenase 2glutamate dehydrogenation
GDH-3XM004143618.2Glutamate dehydrogenase 2-likeglutamate dehydrogenation
Urease-1XM011657264.1Urease, transcript variant X2urea decomposition
Urease-2XM011659065.1Urease accessory protein Gurea decomposition
Table
Table 3. Primer sequences for qRT-PCRs.
Table 3. Primer sequences for qRT-PCRs.
GeneForward Primer (5′)Reverse Primer (3′)Length
NR-1TACTTCGGCTTTGACTCATGTTGGTATGTTTTGCTCCGCTTATTCC207 bp
NR-2TACTGGTGCTGGTGTTTCTGGTCGATTTCTCCCTTGTGAGGTTTGC195 bp
NR-3GAACTGTGTTATAATGCGTGGTTCAAGTCGTGTAAGGTTTGTGAAG197 bp
NR-4CAGAGAACACAGAAAAGAAGGAACACAATGAAACAGTGGTCGAATA207 bp
NiRGTCCCTCTCTGTGGAGCCATCTTCCCTTCTTTCCCATTGCTTATTT199 bp
GS-1TTCTTTCTTTTGATCCAAAACCAATGTCGCCCTGTGAGACGACGCT197 bp
GS-2CAAGTCGGTCCTACCGTTGGTATTGTCGAAGTAGACCTGTAATTGGTG188 bp
GS-3CTTTTGACCCCAAACCAATTCAGGTGTCGACCAGTTAGACGACGCT191 bp
GS-4GTGCCCATCCCTACAAACAAACGACACCACAGTAATAAGGCCCCTG185 bp
GOGAT-1-1GAACGAGAACTTTACATTTGTAGCTATATCTTCGATGATAAATAGC206 bp
GOGAT-1-2GAAATTGATTGAAAGAGAAGCAACTATATCTTCGATGATAAATAGC183 bp
GOGAT-2-1AGTTGGGATCGTGCTCAGCCTCTAATTAAAAGCTCAAGAACACC216 bp
GOGAT-2-2ATGCGTGTTTTGGGCCACAATGCTAATTAAAAGCTCAAGAACACC194 bp
GDH-1GCAATCCTGGAGAATTAAGTATAAGAGATCCACCTAGATCAATAGG217 bp
GDH-2TAAAGAAAGTACTGGAAGCCTTGTCATCTGCCTCTGGATCTGTGGG195 bp
GDH-3ATTGATGTACCTGAGCTGATTATTCAATCTGCTTCTGGATCAGTAGGATG219 bp
Urease-1GATGGCTTCATTATGACCCTTGGTGTGATGCCGCTTGATATTGCTT195 bp
Urease-2GAAAGGATTAGAGCAGTGGAAACAGACACATCGATGATATAGATGA201 bp
Table
Table 4. Correlations between different parameters.
Table 4. Correlations between different parameters.
Correlation Coefficient (r)Leaf Dry Matter (g·plant−1)Total Dry Matte
(g·plant−1)		Leaf N Content
(g·plant−1)		Leaf Protein Content
(g·plant−1)		Total N Content
(g·plant−1)		Nitrate
(μg·g−1)
Leaf dry matter (g·plant−1)--0.987 **--------
Leaf N content (g·plant−1)0.895 *0.861 *--------
Leaf protein content (mg·g−1)0.930 **0.968 **0.768------
Leaf amino acid content (μmol·g−1)0.954 **0.985 **0.7410.967 **0.827 *--
Total N content (g·plant−1)0.895 *0.888 *0.962 **0.813 *--
Yield (g·plant−1)0.885 *0.939 **0.6840.986 **0.731--
NR (μmol·h−1·g−1)----------0.871 *
* Indicates significance at the 0.05 probability levels. ** Indicates significance at the 0.01 probability levels.

Share and Cite

MDPI and ACS Style

Ma, C.; Ban, T.; Yu, H.; Li, Q.; Li, X.; Jiang, W.; Xie, J. Urea Addition Promotes the Metabolism and Utilization of Nitrogen in Cucumber. Agronomy 2019, 9, 262. https://doi.org/10.3390/agronomy9050262

AMA Style

Ma C, Ban T, Yu H, Li Q, Li X, Jiang W, Xie J. Urea Addition Promotes the Metabolism and Utilization of Nitrogen in Cucumber. Agronomy. 2019; 9(5):262. https://doi.org/10.3390/agronomy9050262

Chicago/Turabian Style

Ma, Chao, Tiantian Ban, Hongjun Yu, Qiang Li, Xiaohui Li, Weijie Jiang, and Jianming Xie. 2019. "Urea Addition Promotes the Metabolism and Utilization of Nitrogen in Cucumber" Agronomy 9, no. 5: 262. https://doi.org/10.3390/agronomy9050262

APA Style

Ma, C., Ban, T., Yu, H., Li, Q., Li, X., Jiang, W., & Xie, J. (2019). Urea Addition Promotes the Metabolism and Utilization of Nitrogen in Cucumber. Agronomy, 9(5), 262. https://doi.org/10.3390/agronomy9050262

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop