Selective Proliferation of Highly Functional Adipose-Derived Stem Cells in Microgravity Culture with Stirred Microspheres
Abstract
:1. Introduction
2. Materials and Methods
2.1. Primary Culture of hASCs
2.2. Characterization of SSEA-3-Positive Cells in the hASC Pool
2.3. Preparation of Microspheres
2.4. hASC Loading onto Microspheres for Microgravity Culture
2.5. Cell Retrieval from Microspheres
2.6. Cell Growth in Microsphere Cultures
2.7. Proliferation of SSEA-3-Positive hASCs in Microsphere Cultures
2.8. Immunocytochemistry
2.9. Quantitative Real-Time Polymerase Chain Reaction (RT-PCR)
2.10. Colony-Forming Assay
2.11. In Vitro Angiogenesis (Network Formation) Assay
2.12. Multilineage Differentiation Assay
2.13. Statistics
3. Results
3.1. Characterization of SSEA-3-Positive hASCs
3.2. Cell Growth in Microgravity Microsphere Cultures
3.3. Proliferation of SSEA-3-Positive hASCs in Microgravity/Microsphere Cultures
3.4. Immunocytochemistry
3.5. Selected Gene Expression Analysis by RT-PCR
3.6. Colony-Forming Assay
3.7. In Vitro Angiogenesis Assay
3.8. Multilineage Differentiation Assay
4. Discussions
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Mashiko, T.; Takada, H.; Wu, S.-H.; Kanayama, K.; Feng, J.; Tashiro, K.; Asahi, R.; Sunaga, A.; Hoshi, K.; Kurisaki, A.; et al. Therapeutic effects of a recombinant human collagen peptide bioscaffold with human adipose-derived stem cells on impaired wound healing after radiotherapy. J. Tissue Eng. Regen. Med. 2018, 12, 1186–1194. [Google Scholar] [CrossRef]
- Kim, E.K.; Li, G.; Lee, T.J.; Hong, J.P. The Effect of Human Adipose-Derived Stem Cells on Healing of Ischemic Wounds in a Diabetic Nude Mouse Model. Plast. Reconstr. Surg. 2011, 128, 387–394. [Google Scholar] [CrossRef]
- Amos, P.J.; Kapur, S.K.; Stapor, P.C.; Shang, H.; Bekiranov, S.; Khurgel, M.; Rodeheaver, G.T.; Peirce, S.M.; Katz, A.J. Human Adipose-Derived Stromal Cells Accelerate Diabetic Wound Healing: Impact of Cell Formulation and Delivery. Tissue Eng. Part A 2010, 16, 1595–1606. [Google Scholar] [CrossRef] [Green Version]
- Hodgetts, S.I.; Beilharz, M.W.; Scalzo, A.A.; Grounds, M.D. Why do cultured transplanted myoblasts die in vivo? DNA quantification shows enhanced survival of donor male myoblasts in host mice depleted of CD4+ and CD8+ cells or Nk1.1+ cells. Cell Transplant. 2000, 9, 489–502. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Oh, J.S.; Kim, K.N.; An, S.S.; Pennant, W.A.; Kim, H.J.; Gwak, S.J.; Yoon, D.H.; Lim, M.H.; Choi, B.H.; Ha, Y. Cotransplantation of mouse neural stem cells (mNSCs) with adipose tissue-derived mesenchymal stem cells improves mNSC survival in a rat spinal cord injury model. Cell Transplant. 2010, 20, 837–849. [Google Scholar] [CrossRef] [PubMed]
- Mingliang, R.; Bo, Z.; Zhengguo, W. Stem Cells for Cardiac Repair: Status, Mechanisms, and New Strategies. Stem Cells Int. 2011, 2011, 1–8. [Google Scholar] [CrossRef] [Green Version]
- Phinney, D.G.; Pittenger, M.F. Concise Review: MSC-Derived Exosomes for Cell-Free Therapy. Stem Cells 2017, 35, 851–858. [Google Scholar] [CrossRef] [Green Version]
- Kuo, Y.-R.; Chen, C.-C.; Goto, S.; Lee, I.-T.; Huang, C.-W.; Tsai, C.-C.; Wang, C.-T.; Chen, C.-L. Modulation of Immune Response and T-Cell Regulation by Donor Adipose-Derived Stem Cells in a Rodent Hind-Limb Allotransplant Model. Plast. Reconstr. Surg. 2011, 128, 661e–672e. [Google Scholar] [CrossRef] [PubMed]
- Hong, S.J.; Traktuev, D.O.; March, K.L. Therapeutic potential of adipose-derived stem cells in vascular growth and tissue repair. Curr. Opin. Organ Transplant. 2010, 15, 86–91. [Google Scholar] [CrossRef]
- Isakson, M.; De Blacam, C.; Whelan, D.; McArdle, A.; Clover, A.J.P. Mesenchymal Stem Cells and Cutaneous Wound Healing: Current Evidence and Future Potential. Stem Cells Int. 2015, 2015, 1–12. [Google Scholar] [CrossRef] [Green Version]
- Kimbrel, E.A.; Kouris, N.A.; Yavanian, G.J.; Chu, J.; Qin, Y.; Chan, A.; Singh, R.P.; McCurdy, D.; Gordon, L.; Levinson, R.D.; et al. Mesenchymal stem cell population derived from human pluripotent stem cells displays potent immunomodulatory and therapeutic properties. Stem Cells Dev. 2014, 23, 1611–1624. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, D.C.; Boyd, A.S.; Wood, K.J. Embryonic stem cell transplantation: Potential applicability in cell replacement therapy and regenerative medicine. Front. Biosci. 2007, 12, 4525–4535. [Google Scholar] [CrossRef] [Green Version]
- Raaijmakers, M.H.; Scadden, D.T. Divided within: Heterogeneity within Adult Stem Cell Pools. Cell 2008, 135, 1006–1008. [Google Scholar] [CrossRef] [Green Version]
- Graf, T.; Stadtfeld, M. Heterogeneity of Embryonic and Adult Stem Cells. Cell Stem Cell 2008, 3, 480–483. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rennert, R.C.; Januszyk, M.; Sorkin, M.; Rodrigues, M.; Maan, Z.N.; Duscher, D.; Whittam, A.J.; Kosaraju, R.; Chung, M.T.; Paik, K.; et al. Microfluidic single-cell transcriptional analysis rationally identifies novel surface marker profiles to enhance cell-based therapies. Nat. Commun. 2016, 7, 1–9. [Google Scholar] [CrossRef]
- Safford, K.M.; Safford, S.D.; Gimble, J.M.; Shetty, A.K.; Rice, H.E. Characterization of neuronal/glial differentiation of murine adipose-derived adult stromal cells. Exp. Neurol. 2004, 187, 319–328. [Google Scholar] [CrossRef] [PubMed]
- Seo, M.J.; Suh, S.Y.; Bae, Y.C.; Jung, J.S. Differentiation of human adipose stromal cells into hepatic lineage in vitro and in vivo. Biochem. Biophys. Res. Commun. 2005, 328, 258–264. [Google Scholar] [CrossRef]
- Uccelli, A.; Moretta, L.; Pistoia, V. Mesenchymal stem cells in health and disease. Nat. Rev. Immunol. 2008, 8, 726–736. [Google Scholar] [CrossRef] [PubMed]
- Kuroda, Y.; Kitada, M.; Wakao, S.; Nishikawa, K.; Tanimura, Y.; Makinoshima, H.; Goda, M.; Akashi, H.; Inutsuka, A.; Niwa, A.; et al. Unique multipotent cells in adult human mesenchymal cell populations. Proc. Natl. Acad. Sci. USA 2010, 107, 8639–8643. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Iseki, M.; Kushida, Y.; Wakao, S.; Akimoto, T.; Mizuma, M.; Motoi, F.; Asada, R.; Shimizu, S.; Unno, M.; Chazenbalk, G.; et al. Muse cells, nontumorigenic pluripotent-like stem cells, have liver regeneration capacity through specific homing and cell replacement in a mouse model of liver fibrosis. Cell Transplant. 2017, 26, 821–840. [Google Scholar] [CrossRef]
- Uchida, H.; Niizuma, K.; Kushida, Y.; Wakao, S.; Tominaga, T.; Borlongan, C.V.; Dezawa, M. Human Muse Cells Reconstruct Neuronal Circuitry in Subacute Lacunar Stroke Model. Stroke 2017, 48, 428–435. [Google Scholar] [CrossRef]
- Hosoyama, K.; Wakao, S.; Kushida, Y.; Ogura, F.; Maeda, K.; Adachi, O.; Kawamoto, S.; Dezawa, M.; Saiki, Y. Intravenously injected human multilineage-differentiating stress-enduring cells selectively engraft into mouse aortic aneurysms and at-tenuate dilatation by differentiating into multiple cell types. J. Thorac. Cardiovasc. Surg. 2018, 155, 2301–2313. [Google Scholar] [CrossRef]
- Yoshimura, K.; Shigeura, T.; Matsumoto, D.; Sato, T.; Takaki, Y.; Aiba-Kojima, E.; Sato, K.; Inoue, K.; Nagase, T.; Koshima, I.; et al. Characterization of freshly isolated and cultured cells derived from the fatty and fluid portions of liposuction aspirates. J. Cell. Physiol. 2006, 208, 64–76. [Google Scholar] [CrossRef] [PubMed]
- Imura, T.; Otsuka, T.; Kawahara, Y.; Yuge, L. “Microgravity” as a unique and useful stem cell culture environment for cell-based therapy. Regen. Ther. 2019, 12, 2–5. [Google Scholar] [CrossRef] [PubMed]
- Feng, J.; Mineda, K.; Wu, S.-H.; Mashiko, T.; Doi, K.; Kuno, S.; Kinoshita, K.; Kanayama, K.; Asahi, R.; Sunaga, A.; et al. An injectable non-cross-linked hyaluronic-acid gel containing therapeutic spheroids of human adipose-derived stem cells. Sci. Rep. 2017, 7, 1–13. [Google Scholar] [CrossRef]
- Van Wezel, A.L. Growth of Cell-strains and Primary Cells on Micro-carriers in Homogeneous Culture. Nat. Cell Biol. 1967, 216, 64–65. [Google Scholar] [CrossRef] [PubMed]
- Frondoza, C.; Sohrabi, A.; Hungerford, D. Human chondrocytes proliferate and produce matrix components in microcarrier suspension culture. Biomaterials 1996, 17, 879–888. [Google Scholar] [CrossRef]
- Tang, N.-H.; Chen, Y.-L.; Wang, X.-Q.; Li, X.-J.; Yin, F.-Z. Construction of IL-2 gene-modified human hepatocyte and its cultivation with microcarrier. World J. Gastroenterol. 2003, 9, 79–83. [Google Scholar] [CrossRef] [PubMed]
- Rodrigues, C.A.V.; Diogo, M.M.; Da Silva, C.L.; Cabral, J.M.S. Microcarrier expansion of mouse embryonic stem cell-derived neural stem cells in stirred bioreactors. Biotechnol. Appl. Biochem. 2011, 58, 231–242. [Google Scholar] [CrossRef] [PubMed]
- Yao, R.; Zhang, R.; Luan, J.; Lin, F. Alginate and alginate/gelatin microspheres for human adipose-derived stem cell encapsulation and differentiation. Biofabrication 2012, 4, 025007. [Google Scholar] [CrossRef] [PubMed]
- Karam, J.-P.; Bonafè, F.; Sindji, L.; Muscari, C.; Montero-Menei, C.N. Adipose-derived stem cell adhesion on laminin-coated microcarriers improves commitment toward the cardiomyogenic lineage. J. Biomed. Mater. Res. Part A 2014, 103, 1828–1839. [Google Scholar] [CrossRef] [PubMed]
- Wakao, S.; Kuroda, Y.; Ogura, F.; Shigemoto, T.; Dezawa, M. Regenerative Effects of Mesenchymal Stem Cells: Contribution of Muse Cells, a Novel Pluripotent Stem Cell Type that Resides in Mesenchymal Cells. Cells 2012, 1, 1045–1060. [Google Scholar] [CrossRef] [Green Version]
- Li, Q.; Kumar, A.; Makhija, E.; Shivashankar, G.V. The regulation of dynamic mechanical coupling between actin cytoskele-ton and nucleus by matrix geometry. Biomaterials 2014, 35, 961–969. [Google Scholar] [CrossRef] [PubMed]
- Vining, K.H.; Mooney, D.J. Mechanical forces direct stem cell behaviour in development and regeneration. Nat. Rev. Mol. Cell Biol. 2017, 18, 728–742. [Google Scholar] [CrossRef] [PubMed]
- Dai, Z.Q.; Wang, R.; Ling, S.K.; Wan, Y.M.; Li, Y.H. Simulated microgravity inhibits the proliferation and osteogenesis of rat bone marrow mesenchymal stem cells. Cell Prolif. 2007, 40, 671–684. [Google Scholar] [CrossRef] [PubMed]
- Monticone, M.; Liu, Y.; Pujic, N.; Cancedda, R. Activation of nervous system development genes in bone marrow derived mesenchymal stem cells following space flight exposure. J. Cell Biochem. 2010, 111, 442–452. [Google Scholar] [CrossRef]
- Plett, P.; Abonour, R.; Frankovitz, S.M.; Orschell, C.M. Impact of modeled microgravity on migration, differentiation, and cell cycle control of primitive human hematopoietic progenitor cells. Exp. Hematol. 2004, 32, 773–781. [Google Scholar] [CrossRef] [PubMed]
- Yuge, L.; Kajiume, T.; Tahara, H.; Kawahara, Y.; Umeda, C.; Yoshimoto, R.; Wu, S.-L.; Yamaoka, K.; Asashima, M.; Kataoka, K.; et al. Microgravity Potentiates Stem Cell Proliferation While Sustaining the Capability of Differentiation. Stem Cells Dev. 2006, 15, 921–929. [Google Scholar] [CrossRef]
- Mihailova, M.; Trenev, V.; Genova, P.; Konstantinov, S. Process Simulation in a Mechatronic Bioreactor Device with Speed-Regulated Motors for Growing of Three-Dimensional Cell Cultures. Ann. N. Y. Acad. Sci. 2006, 1091, 470–489. [Google Scholar] [CrossRef]
- Borst, A.G.; van Loon, J.J.W.A. Technology and developments for the random positioning machine, RPM. Microgravity Sci. Technol. 2009, 21, 287–292. [Google Scholar] [CrossRef]
- Dominici, M.; Le Blanc, K.; Mueller, I.; Slaper-Cortenbach, I.; Marini, F.; Krause, D.; Deans, R.; Keating, A.; Prockop, D.; Horwitz, E. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 2006, 8, 315–317. [Google Scholar] [CrossRef] [PubMed]
- Parvizi, M.; Plantinga, J.A.; Van Speuwel-Goossens, C.A.; Van Dongen, E.M.; Kluijtmans, S.G.; Harmsen, M.C. Development of recombinant collagen-peptide-based vehicles for delivery of adipose-derived stromal cells. J. Biomed. Mater. Res. Part A 2016, 104, 503–516. [Google Scholar] [CrossRef]
- Natesan, S.; Baer, D.G.; Walters, T.J.; Babu, M.; Christy, R.J. Adipose-derived stem cell delivery into collagen gels using chitosan microspheres. Tissue Eng. Part A 2010, 16, 1369–1384. [Google Scholar] [CrossRef]
- Heneidi, S.; Simerman, A.A.; Keller, E.; Singh, P.; Li, X.; Dumesic, D.A.; Chazenbalk, G. Awakened by cellular stress: Isolation and characterization of a novel population of pluripotent stem cells derived from human adipose tissue. PLoS ONE 2013, 8, e64752. [Google Scholar] [CrossRef]
- Suga, H.; Matsumoto, D.; Eto, H.; Inoue, K.; Aoi, N.; Kato, H.; Araki, J.; Yoshimura, K. Functional implications of CD34 ex-pression in human adipose-derived stem/progenitor cells. Stem Cells Dev. 2009, 18, 1201–1210. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gronthos, S.; Franklin, D.M.; Leddy, H.A.; Robey, P.G.; Storms, R.W.; Gimble, J.M. Surface protein characterization of human adipose tissue-derived stromal cells. J. Cell. Physiol. 2001, 189, 54–63. [Google Scholar] [CrossRef] [PubMed]
- Lee, R.H.; Kim, B.; Choi, I.; Kim, H.; Choi, H.S.; Suh, K.; Bae, Y.C.; Jung, J.S. Characterization and Expression Analysis of Mesenchymal Stem Cells from Human Bone Marrow and Adipose Tissue. Cell. Physiol. Biochem. 2004, 14, 311–324. [Google Scholar] [CrossRef]
- Casey, T.; Patel, O.V.; Plaut, K. Transcriptomes reveal alterations in gravity impact circadian clocks and activate mechanotransduction pathways with adaptation through epigenetic change. Physiol. Genom. 2015, 47, 113–128. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene | Primer Sequence (5′–3′) | |
---|---|---|
ACTB | Forward: | TGAAGTGTGACGTGGACATC |
Reverse: | GGAGGAGCAATGATCTTGAT | |
OCT4 | Forward: | AGCGAACCAGTATCGAGAAC |
Reverse: | TTACAGAACCACACTCGGAC | |
SOX2 | Forward: | AGCTACAGCATGATGCAGGA |
Reverse: | GGTCATGGAGTTGTACTGCA | |
NANOG | Forward: | TGAACCTCAGCTACAAACAG |
Reverse: | TGGTGGTAGGAAGAGTAAAG | |
MYC | Forward: | ACTCTGAGGAGGAACAAGAA |
Reverse: | TGGAGACGTGGCACCTCTT | |
KLF4 | Forward: | TCTCAAGGCACACCTGCGAA |
Reverse: | TAGTGCCTGGTCAGTTCATC | |
CD34 | Forward: | CCTCAGTGTCTACTGCTGGTCT |
Reverse: | GGAATAGCTCTGGTGGCTTGCA |
Cell Number | Cell Viability | SSEA-3 Positivity | SSEA-3(+) Cell Growth Rate | |
---|---|---|---|---|
Polystyrene dish | (5.9 ± 0.7) × 105 | 99.8 ± 0.2% | 1.1 ± 0.4% | 5.1 |
Collagen dish | (6.3 ± 0.8) × 105 | 99.9 ± 0.1% | 1.0 ± 0.5% | 4.8 |
Polystyrene beads (static) | (3.8 ± 1.2) × 105 | 81.3 ± 7.7% | 2.5 ± 0.9% | 6.1 |
Collagen beads (static) | (3.9 ± 1.4) × 105 | 89.0 ± 9.2% | 2.4 ± 1.1% | 6.6 |
Polystyrene beads (dynamic) | (3.8 ± 1.6) × 105 | 95.8 ± 3.6% | 4.8 ± 1.5% | 14.0 |
Collagen beads (dynamic) | (4.0 ± 1.1) × 105 | 98.9 ± 1.0% | 4.7 ± 1.4% | 14.7 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mashiko, T.; Kanayama, K.; Saito, N.; Shirado, T.; Asahi, R.; Mori, M.; Yoshimura, K. Selective Proliferation of Highly Functional Adipose-Derived Stem Cells in Microgravity Culture with Stirred Microspheres. Cells 2021, 10, 560. https://doi.org/10.3390/cells10030560
Mashiko T, Kanayama K, Saito N, Shirado T, Asahi R, Mori M, Yoshimura K. Selective Proliferation of Highly Functional Adipose-Derived Stem Cells in Microgravity Culture with Stirred Microspheres. Cells. 2021; 10(3):560. https://doi.org/10.3390/cells10030560
Chicago/Turabian StyleMashiko, Takanobu, Koji Kanayama, Natsumi Saito, Takako Shirado, Rintaro Asahi, Masanori Mori, and Kotaro Yoshimura. 2021. "Selective Proliferation of Highly Functional Adipose-Derived Stem Cells in Microgravity Culture with Stirred Microspheres" Cells 10, no. 3: 560. https://doi.org/10.3390/cells10030560
APA StyleMashiko, T., Kanayama, K., Saito, N., Shirado, T., Asahi, R., Mori, M., & Yoshimura, K. (2021). Selective Proliferation of Highly Functional Adipose-Derived Stem Cells in Microgravity Culture with Stirred Microspheres. Cells, 10(3), 560. https://doi.org/10.3390/cells10030560