Electrical Stimulation Increases the Secretion of Cardioprotective Extracellular Vesicles from Cardiac Mesenchymal Stem Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Isolation of Mouse C-MSC and Cell Culture
2.2. ELSM Treatment and EV Purification
2.3. Electron Microscopy and Zeta Analysis
2.4. Small-Interference RNA (siRNA) Transfection
2.5. Assessment of Acetylcholinesterase (AchE) Activity
2.6. Isolation and Quantification of mRNA
2.7. Western Blotting
2.8. Cell Apoptosis Assay
2.9. Statistical Analysis
3. Results
3.1. ELSM Stimulates EV Secretion of C-MSC
3.2. EVs from ELSM-Treated C-MSC Protect Cardiomyocytes against Hypoxia-Induced Apoptosis
3.3. ELSM Increases nSMase2 Expression in C-MSC
3.4. ELSM-Induced EV Secretion Is Dependent on nSMase2
3.5. nSMase2 Is Directly Involved in the Modulation of Apoptosis in HL-1 Cells by the CM from ELSM-Treated C-MSC
4. Discussion
5. Limitations and Future Direction
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Jin, Y.; Shen, Y.; Su, X.; Cai, J.; Liu, Y.; Weintraub, N.L.; Tang, Y. The Small GTPases Rab27b Regulates Mitochondrial Fatty Acid Oxidative Metabolism of Cardiac Mesenchymal Stem Cells. Front. Cell Dev. Biol. 2020, 8, 209. [Google Scholar] [CrossRef] [Green Version]
- Su, X.; Jin, Y.; Shen, Y.; Kim, I.M.; Weintraub, N.L.; Tang, Y. RNAase III-Type Enzyme Dicer Regulates Mitochondrial Fatty Acid Oxidative Metabolism in Cardiac Mesenchymal Stem Cells. Int. J. Mol. Sci. 2019, 20, 5554. [Google Scholar] [CrossRef] [Green Version]
- Ju, C.; Shen, Y.; Ma, G.; Liu, Y.; Cai, J.; Kim, I.M.; Weintraub, N.L.; Liu, N.; Tang, Y. Transplantation of Cardiac Mesenchymal Stem Cell-Derived Exosomes Promotes Repair in Ischemic Myocardium. J. Cardiovasc. Transl. Res. 2018, 11, 420–428. [Google Scholar] [CrossRef] [PubMed]
- Tan, S.J.O.; Floriano, J.F.; Nicastro, L.; Emanueli, C.; Catapano, F. Novel Applications of Mesenchymal Stem Cell-derived Exosomes for Myocardial Infarction Therapeutics. Biomolecules 2020, 10, 707. [Google Scholar] [CrossRef] [PubMed]
- Ma, L.; Rao, N.; Jiang, H.; Dai, Y.; Yang, S.; Yang, H.; Hu, J. Small extracellular vesicles from dental follicle stem cells provide biochemical cues for periodontal tissue regeneration. Stem Cell Res. Ther. 2022, 13, 92. [Google Scholar] [CrossRef]
- He, C.; Zheng, S.; Luo, Y.; Wang, B. Exosome Theranostics: Biology and Translational Medicine. Theranostics 2018, 8, 237–255. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Wang, Y.; Pan, Y.; Zhang, L.; Shen, C.; Qin, G.; Ashraf, M.; Weintraub, N.; Ma, G.; Tang, Y. Cardiac progenitor-derived exosomes protect ischemic myocardium from acute ischemia/reperfusion injury. Biochem. Biophys. Res. Commun. 2013, 431, 566–571. [Google Scholar] [CrossRef] [Green Version]
- Khan, K.; Caron, C.; Mahmoud, I.; Derish, I.; Schwertani, A.; Cecere, R. Extracellular Vesicles as a Cell-free Therapy for Cardiac Repair: A Systematic Review and Meta-Analysis of Randomized Controlled Preclinical Trials in Animal Myocardial Infarction Models. Stem Cell Rev. Rep. 2022, 18, 1143–1167. [Google Scholar] [CrossRef]
- Bristow, M.R.; Saxon, L.A.; Boehmer, J.; Krueger, S.; Kass, D.A.; De Marco, T.; Carson, P.; DiCarlo, L.; DeMets, D.; White, B.G.; et al. Cardiac-resynchronization therapy with or without an implantable defibrillator in advanced chronic heart failure. N. Engl. J. Med. 2004, 350, 2140–2150. [Google Scholar] [CrossRef]
- Xie, M.; Burchfield, J.S.; Hill, J.A. Pathological ventricular remodeling: Therapies: Part 2 of 2. Circulation 2013, 128, 1021–1030. [Google Scholar] [CrossRef]
- Moss, A.J.; Hall, W.J.; Cannom, D.S.; Klein, H.; Brown, M.W.; Daubert, J.P.; Estes, N.A., 3rd; Foster, E.; Greenberg, H.; Higgins, S.L.; et al. Cardiac-resynchronization therapy for the prevention of heart-failure events. N. Engl. J. Med. 2009, 361, 1329–1338. [Google Scholar] [CrossRef] [Green Version]
- Antoniou, C.-K.; Manolakou, P.; Magkas, N.; Konstantinou, K.; Chrysohoou, C.; Dilaveris, P.; Gatzoulis, K.A.; Tousoulis, D. Cardiac Resynchronisation Therapy and Cellular Bioenergetics: Effects beyond Chamber Mechanics. Eur. Cardiol. Rev. 2019, 14, 33–44. [Google Scholar] [CrossRef] [Green Version]
- Yu, Z.; Chen, X.; Han, F.; Qin, S.; Li, M.; Wu, Y.; Su, Y.; Ge, J. Electro-Echocardiographic Indices to Predict Cardiac Resynchronization Therapy Non-Response on Non-Ischemic Cardiomyopathy. Sci. Rep. 2017, 7, 44009. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Niazi, I.; Baker, J., 2nd; Corbisiero, R.; Love, C.; Martin, D.; Sheppard, R.; Worley, S.J.; Varma, N.; Lee, K.; Tomassoni, G. Safety and Efficacy of Multipoint Pacing in Cardiac Resynchronization Therapy: The MultiPoint Pacing Trial. JACC Clin. Electrophysiol. 2017, 3, 1510–1518. [Google Scholar] [CrossRef]
- Schiedat, F.; Schöne, D.; Aweimer, A.; Bösche, L.; Ewers, A.; Gotzmann, M.; Patsalis, P.C.; Mügge, A.; Kloppe, A. Multipoint left ventricular pacing with large anatomical separation improves reverse remodeling and response to cardiac resynchronization therapy in responders and non-responders to conventional biventricular pacing. Clin. Res. Cardiol. 2020, 109, 183–193. [Google Scholar] [CrossRef] [PubMed]
- Borggrefe, M.; Mann, D.L. Cardiac Contractility Modulation in 2018. Circulation 2018, 138, 2738–2740. [Google Scholar] [CrossRef] [Green Version]
- Chinyere, I.R.; Balakrishnan, M.; Hutchinson, M.D. The emerging role of cardiac contractility modulation in heart failure treatment. Curr. Opin. Cardiol. 2022, 37, 30–35. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.W.; Kim, H.W.; Huang, W.; Okada, M.; Welge, J.A.; Wang, Y.; Ashraf, M. Cardiac stem cells with electrical stimulation improve ischaemic heart function through regulation of connective tissue growth factor and miR-378. Cardiovasc. Res. 2013, 100, 241–251. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, Z.; Shi, J.; Xie, J.; Wang, Y.; Sun, J.; Liu, T.; Zhao, Y.; Zhao, X.; Wang, X.; Ma, Y.; et al. Large-scale generation of functional mRNA-encapsulating exosomes via cellular nanoporation. Nat. Biomed. Eng. 2020, 4, 69–83. [Google Scholar] [CrossRef]
- Yoo, S.W.; Agarwal, A.; Smith, M.D.; Khuder, S.S.; Baxi, E.G.; Thomas, A.G.; Rojas, C.; Moniruzzaman, M.; Slusher, B.S.; Bergles, D.E.; et al. Inhibition of neutral sphingomyelinase 2 promotes remyelination. Sci. Adv. 2020, 6, eaba5210. [Google Scholar] [CrossRef]
- Rojas, C.; Barnaeva, E.; Thomas, A.G.; Hu, X.; Southall, N.; Marugan, J.; Chaudhuri, A.D.; Yoo, S.W.; Hin, N.; Stepanek, O.; et al. DPTIP, a newly identified potent brain penetrant neutral sphingomyelinase 2 inhibitor, regulates astrocyte-peripheral immune communication following brain inflammation. Sci. Rep. 2018, 8, 17715. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tang, Y.L.; Zhu, W.; Cheng, M.; Chen, L.; Zhang, J.; Sun, T.; Kishore, R.; Phillips, M.I.; Losordo, D.W.; Qin, G. Hypoxic preconditioning enhances the benefit of cardiac progenitor cell therapy for treatment of myocardial infarction by inducing CXCR4 expression. Circ. Res. 2009, 104, 1209–1216. [Google Scholar] [CrossRef] [Green Version]
- Ruan, X.F.; Ju, C.W.; Shen, Y.; Liu, Y.T.; Kim, I.M.; Yu, H.; Weintraub, N.; Wang, X.L.; Tang, Y. Suxiao Jiuxin pill promotes exosome secretion from mouse cardiac mesenchymal stem cells in vitro. Acta Pharmacol. Sin. 2018, 39, 569–578. [Google Scholar] [CrossRef] [Green Version]
- Su, X.; Shen, Y.; Jin, Y.; Kim, I.M.; Weintraub, N.L.; Tang, Y. Aging-Associated Differences in Epitranscriptomic m6A Regulation in Response to Acute Cardiac Ischemia/Reperfusion Injury in Female Mice. Front. Pharmacol. 2021, 12, 654316. [Google Scholar] [CrossRef] [PubMed]
- Barialai, L.; Strecker, M.I.; Luger, A.-L.; Jäger, M.; Bruns, I.; Sittig, A.C.M.; Mildenberger, I.C.; Heller, S.M.; Delaidelli, A.; Lorenz, N.I.; et al. AMPK activation protects astrocytes from hypoxia-induced cell death. Int. J. Mol. Med. 2020, 45, 1385–1396. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhu, J.; Lu, K.; Zhang, N.; Zhao, Y.; Ma, Q.; Shen, J.; Lin, Y.; Xiang, P.; Tang, Y.; Hu, X.; et al. Myocardial reparative functions of exosomes from mesenchymal stem cells are enhanced by hypoxia treatment of the cells via transferring microRNA-210 in an nSMase2-dependent way. Artif. Cells Nanomed. Biotechnol. 2018, 46, 1659–1670. [Google Scholar] [CrossRef] [Green Version]
- Jabbari, N.; Nawaz, M.; Rezaie, J. Bystander effects of ionizing radiation: Conditioned media from X-ray irradiated MCF-7 cells increases the angiogenic ability of endothelial cells. Cell Commun. Signal 2019, 17, 165. [Google Scholar] [CrossRef] [Green Version]
- Abraham, W.T.; Kuck, K.H.; Goldsmith, R.L.; Lindenfeld, J.; Reddy, V.Y.; Carson, P.E.; Mann, D.L.; Saville, B.; Parise, H.; Chan, R.; et al. A Randomized Controlled Trial to Evaluate the Safety and Efficacy of Cardiac Contractility Modulation. JACC Heart Fail. 2018, 6, 874–883. [Google Scholar] [CrossRef]
- Meng, S.; Rouabhia, M.; Zhang, Z. Electrical Stimulation and Cellular Behaviors in Electric Field in Biomedical Research. Materials 2021, 15, 165. [Google Scholar] [CrossRef]
- Ryan, C.N.M.; Doulgkeroglou, M.N.; Zeugolis, D.I. Electric field stimulation for tissue engineering applications. BMC Biomed. Eng. 2021, 3, 1. [Google Scholar] [CrossRef]
- Ruan, J.L.; Tulloch, N.L.; Razumova, M.V.; Saiget, M.; Muskheli, V.; Pabon, L.; Reinecke, H.; Regnier, M.; Murry, C.E. Mechanical Stress Conditioning and Electrical Stimulation Promote Contractility and Force Maturation of Induced Pluripotent Stem Cell-Derived Human Cardiac Tissue. Circulation 2016, 134, 1557–1567. [Google Scholar] [CrossRef] [PubMed]
- Kalluri, R.; LeBleu, V.S. The biology, function, and biomedical applications of exosomes. Science 2020, 367, eaau6977. [Google Scholar] [CrossRef] [PubMed]
- Hu, M.; Hong, L.; Liu, C.; Hong, S.; He, S.; Zhou, M.; Huang, G.; Chen, Q. Electrical stimulation enhances neuronal cell activity mediated by Schwann cell derived exosomes. Sci. Rep. 2019, 9, 4206. [Google Scholar] [CrossRef] [Green Version]
- Grigorian Shamagian, L.; Madonna, R.; Taylor, D.; Climent, A.M.; Prosper, F.; Bras-Rosario, L.; Bayes-Genis, A.; Ferdinandy, P.; Fernández-Avilés, F.; Izpisua Belmonte, J.C.; et al. Perspectives on Directions and Priorities for Future Preclinical Studies in Regenerative Medicine. Circ. Res. 2019, 124, 938–951. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Peng, Z.; Yang, Z. Metabolomics studies of cell-cell interactions using single cell mass spectrometry combined with fluorescence microscopy. Chem. Sci. 2022, 13, 6687–6695. [Google Scholar] [CrossRef] [PubMed]
- Sahoo, S.; Adamiak, M.; Mathiyalagan, P.; Kenneweg, F.; Kafert-Kasting, S.; Thum, T. Therapeutic and Diagnostic Translation of Extracellular Vesicles in Cardiovascular Diseases: Roadmap to the Clinic. Circulation 2021, 143, 1426–1449. [Google Scholar] [CrossRef]
- Gupta, S.; Knowlton, A.A. HSP60 trafficking in adult cardiac myocytes: Role of the exosomal pathway. Am. J. Physiol. Heart Circ. Physiol. 2007, 292, H3052–H3056. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, W.; Zhou, X.; Yao, Q.; Liu, Y.; Zhang, H.; Dong, Z. HIF-1-mediated production of exosomes during hypoxia is protective in renal tubular cells. Am. J. Physiol. Ren. Physiol. 2017, 313, F906–F913. [Google Scholar] [CrossRef] [Green Version]
- Zhang, M.; Xin, W.; Ma, C.; Zhang, H.; Mao, M.; Liu, Y.; Zheng, X.; Zhang, L.; Yu, X.; Li, H.; et al. Exosomal 15-LO2 mediates hypoxia-induced pulmonary artery hypertension in vivo and in vitro. Cell Death Dis. 2018, 9, 1022. [Google Scholar] [CrossRef] [Green Version]
- Panigrahi, G.K.; Praharaj, P.P.; Peak, T.C.; Long, J.; Singh, R.; Rhim, J.S.; Abd Elmageed, Z.Y.; Deep, G. Hypoxia-induced exosome secretion promotes survival of African-American and Caucasian prostate cancer cells. Sci. Rep. 2018, 8, 3853. [Google Scholar] [CrossRef]
- Appel, H.; Janssen, L.; Listing, J.; Heydrich, R.; Rudwaleit, M.; Sieper, J. Serum levels of biomarkers of bone and cartilage destruction and new bone formation in different cohorts of patients with axial spondyloarthritis with and without tumor necrosis factor-alpha blocker treatment. Arthritis Res. Ther. 2008, 10, R125. [Google Scholar] [CrossRef] [Green Version]
- Fukushima, A.; Takahashi, E.; Saruwatari, J.; Tanihara, H.; Inoue, T. The angiogenic effects of exosomes secreted from retinal pigment epithelial cells on endothelial cells. Biochem. Biophys. Rep. 2020, 22, 100760. [Google Scholar] [CrossRef]
- Wang, R.; Li, J.; Zhang, X.; Zhang, X.; Zhang, X.; Zhu, Y.; Chen, C.; Liu, Z.; Wu, X.; Wang, D.; et al. Extracellular vesicles promote epithelial-to-mesenchymal transition of lens epithelial cells under oxidative stress. Exp. Cell Res. 2021, 398, 112362. [Google Scholar] [CrossRef]
- Klein, J.D.; Wang, X.H. Electrically stimulated acupuncture increases renal blood flow through exosome-carried miR-181. Am. J. Physiol. Ren. Physiol. 2018, 315, F1542–F1549. [Google Scholar] [CrossRef] [PubMed]
- Trajkovic, K.; Hsu, C.; Chiantia, S.; Rajendran, L.; Wenzel, D.; Wieland, F.; Schwille, P.; Brügger, B.; Simons, M. Ceramide triggers budding of exosome vesicles into multivesicular endosomes. Science 2008, 319, 1244–1247. [Google Scholar] [CrossRef] [PubMed]
- Asai, H.; Ikezu, S.; Tsunoda, S.; Medalla, M.; Luebke, J.; Haydar, T.; Wolozin, B.; Butovsky, O.; Kügler, S.; Ikezu, T. Depletion of microglia and inhibition of exosome synthesis halt tau propagation. Nat. Neurosci. 2015, 18, 1584–1593. [Google Scholar] [CrossRef] [Green Version]
- Kosaka, N.; Iguchi, H.; Yoshioka, Y.; Takeshita, F.; Matsuki, Y.; Ochiya, T. Secretory mechanisms and intercellular transfer of microRNAs in living cells. J. Biol. Chem. 2010, 285, 17442–17452. [Google Scholar] [CrossRef] [Green Version]
- Dinkins, M.B.; Enasko, J.; Hernandez, C.; Wang, G.; Kong, J.; Helwa, I.; Liu, Y.; Terry, A.V., Jr.; Bieberich, E. Neutral Sphingomyelinase-2 Deficiency Ameliorates Alzheimer’s Disease Pathology and Improves Cognition in the 5XFAD Mouse. J. Neurosci. 2016, 36, 8653–8667. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yuyama, K.; Sun, H.; Mitsutake, S.; Igarashi, Y. Sphingolipid-modulated exosome secretion promotes clearance of amyloid-beta by microglia. J. Biol. Chem. 2012, 287, 10977–10989. [Google Scholar] [CrossRef] [Green Version]
- Xie, S.; Zhang, Q.; Jiang, L. Current Knowledge on Exosome Biogenesis, Cargo-Sorting Mechanism and Therapeutic Implications. Membranes 2022, 12, 498. [Google Scholar] [CrossRef] [PubMed]
- Singh, R.; Pochampally, R.; Watabe, K.; Lu, Z.; Mo, Y.-Y. Exosome-mediated transfer of miR-10b promotes cell invasion in breast cancer. Mol. Cancer 2014, 13, 256. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hopp, J.F.; Palmer, W.K. Electrical stimulation alters fatty acid metabolism in isolated skeletal muscle. J. Appl. Physiol. 1990, 68, 2473–2481. [Google Scholar] [CrossRef]
- Shin, H.; Lee, S.Y.; Cho, H.U.; Oh, Y.; Kim, I.Y.; Lee, K.H.; Jang, D.P.; Min, H.K. Fornix Stimulation Induces Metabolic Activity and Dopaminergic Response in the Nucleus Accumbens. Front. Neurosci. 2019, 13, 1109. [Google Scholar] [CrossRef]
- Mengeste, A.M.; Nikolić, N.; Dalmao Fernandez, A.; Feng, Y.Z.; Nyman, T.A.; Kersten, S.; Haugen, F.; Kase, E.T.; Aas, V.; Rustan, A.C.; et al. Insight into the Metabolic Adaptations of Electrically Pulse-Stimulated Human Myotubes Using Global Analysis of the Transcriptome and Proteome. Front. Physiol. 2022, 13, 928195. [Google Scholar] [CrossRef] [PubMed]
- Garikipati, V.N.S.; Shoja-Taheri, F.; Davis, M.E.; Kishore, R. Extracellular Vesicles and the Application of System Biology and Computational Modeling in Cardiac Repair. Circ. Res. 2018, 123, 188–204. [Google Scholar] [CrossRef] [PubMed]
- Xia, Y.; McMillin, J.B.; Lewis, A.; Moore, M.; Zhu, W.G.; Williams, R.S.; Kellems, R.E. Electrical stimulation of neonatal cardiac myocytes activates the NFAT3 and GATA4 pathways and up-regulates the adenylosuccinate synthetase 1 gene. J. Biol. Chem. 2000, 275, 1855–1863. [Google Scholar] [CrossRef] [Green Version]
- Xia, Y.; Buja, L.M.; McMillin, J.B. Activation of the cytochrome c gene by electrical stimulation in neonatal rat cardiac myocytes. Role of NRF-1 and c-Jun. J. Biol. Chem. 1998, 273, 12593–12598. [Google Scholar] [CrossRef] [Green Version]
- Stoppel, W.L.; Kaplan, D.L.; Black, L.D. 3rd. Electrical and mechanical stimulation of cardiac cells and tissue constructs. Adv. Drug Deliv. Rev. 2016, 96, 135–155. [Google Scholar] [CrossRef] [Green Version]
- Yu, B.; Kim, H.W.; Gong, M.; Wang, J.; Millard, R.W.; Wang, Y.; Ashraf, M.; Xu, M. Exosomes secreted from GATA-4 overexpressing mesenchymal stem cells serve as a reservoir of anti-apoptotic microRNAs for cardioprotection. Int. J. Cardiol. 2015, 182, 349–360. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hao, C.; Lu, Z.; Zhao, Y.; Chen, Z.; Shen, C.; Ma, G.; Chen, L. Overexpression of GATA4 enhances the antiapoptotic effect of exosomes secreted from cardiac colony-forming unit fibroblasts via miRNA221-mediated targeting of the PTEN/PI3K/AKT signaling pathway. Stem Cell Res. Ther. 2020, 11, 251. [Google Scholar] [CrossRef]
- Wang, F.; Wang, X.; Liu, Y.; Zhang, Z. Effects of Exercise-Induced ROS on the Pathophysiological Functions of Skeletal Muscle. Oxidative Med. Cell. Longev. 2021, 2021, 3846122. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.; Piao, C.; Ma, H.; Xu, J.; Wang, Y.; Liu, T.; Liu, G.; Wang, H. Exosomes from adipose-derived mesenchymal stem cells alleviate liver ischaemia reperfusion injury subsequent to hepatectomy in rats by regulating mitochondrial dynamics and biogenesis. J. Cell. Mol. Med. 2021, 25, 10152–10163. [Google Scholar] [CrossRef] [PubMed]
- Srirussamee, K.; Xue, R.; Mobini, S.; Cassidy, N.J.; Cartmell, S.H. Changes in the extracellular microenvironment and osteogenic responses of mesenchymal stem/stromal cells induced by in vitro direct electrical stimulation. J. Tissue Eng. 2021, 12, 2041731420974147. [Google Scholar] [CrossRef]
- Klymenko, O.; Brecklinghaus, T.; Dille, M.; Springer, C.; de Wendt, C.; Altenhofen, D.; Binsch, C.; Knebel, B.; Scheller, J.; Hardt, C.; et al. Histone deacetylase 5 regulates interleukin 6 secretion and insulin action in skeletal muscle. Mol. Metab. 2020, 42, 101062. [Google Scholar] [CrossRef]
- Fan, C.; Zhang, E.; Joshi, J.; Yang, J.; Zhang, J.; Zhu, W. Utilization of Human Induced Pluripotent Stem Cells for Cardiac Repair. Front. Cell Dev. Biol. 2020, 8, 36. [Google Scholar] [CrossRef]
- Barile, L.; Moccetti, T.; Marbán, E.; Vassalli, G. Roles of exosomes in cardioprotection. Eur. Heart J. 2017, 38, 1372–1379. [Google Scholar] [CrossRef] [Green Version]
- Zou, W.; Lai, M.; Jiang, Y.; Mao, L.; Zhou, W.; Zhang, S.; Lai, P.; Guo, B.; Wei, T.; Nie, C.; et al. Exosome Release Delays Senescence by Disposing of Obsolete Biomolecules. Adv. Sci. (Weinh) 2023, e2204826. [Google Scholar] [CrossRef]
- Mistry, Y.; Poolman, T.; Williams, B.; Herbert, K.E. A role for mitochondrial oxidants in stress-induced premature senescence of human vascular smooth muscle cells. Redox Biol. 2013, 1, 411–417. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Meraviglia, V.; Azzimato, V.; Colussi, C.; Florio, M.C.; Binda, A.; Panariti, A.; Qanud, K.; Suffredini, S.; Gennaccaro, L.; Miragoli, M.; et al. Acetylation mediates Cx43 reduction caused by electrical stimulation. J. Mol. Cell. Cardiol. 2015, 87, 54–64. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wahl, C.M.; Schmidt, C.; Hecker, M.; Ullrich, N.D. Distress-Mediated Remodeling of Cardiac Connexin-43 in a Novel Cell Model for Arrhythmogenic Heart Diseases. Int. J. Mol. Sci. 2022, 23, 10174. [Google Scholar] [CrossRef] [PubMed]
Gene | Sequence (5′-3′) |
---|---|
β-Actin FWD (mouse) | AGAGCATAGCCCTCGTAGAT |
β-Actin REV (mouse) | GCTGTGCTGTCCCTGTATG |
nSMase2 FWD (mouse) | CTACATCGATTCTCCCACCAAC |
nSMase2 REV (mouse) | CACAGAGGCTGTCCTCTTAATG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, H.; Shen, Y.; Kim, I.-m.; Liu, Y.; Cai, J.; Berman, A.E.; Nilsson, K.R.; Weintraub, N.L.; Tang, Y. Electrical Stimulation Increases the Secretion of Cardioprotective Extracellular Vesicles from Cardiac Mesenchymal Stem Cells. Cells 2023, 12, 875. https://doi.org/10.3390/cells12060875
Zhang H, Shen Y, Kim I-m, Liu Y, Cai J, Berman AE, Nilsson KR, Weintraub NL, Tang Y. Electrical Stimulation Increases the Secretion of Cardioprotective Extracellular Vesicles from Cardiac Mesenchymal Stem Cells. Cells. 2023; 12(6):875. https://doi.org/10.3390/cells12060875
Chicago/Turabian StyleZhang, Haitao, Yan Shen, Il-man Kim, Yutao Liu, Jingwen Cai, Adam E. Berman, Kent R. Nilsson, Neal L. Weintraub, and Yaoliang Tang. 2023. "Electrical Stimulation Increases the Secretion of Cardioprotective Extracellular Vesicles from Cardiac Mesenchymal Stem Cells" Cells 12, no. 6: 875. https://doi.org/10.3390/cells12060875
APA StyleZhang, H., Shen, Y., Kim, I.-m., Liu, Y., Cai, J., Berman, A. E., Nilsson, K. R., Weintraub, N. L., & Tang, Y. (2023). Electrical Stimulation Increases the Secretion of Cardioprotective Extracellular Vesicles from Cardiac Mesenchymal Stem Cells. Cells, 12(6), 875. https://doi.org/10.3390/cells12060875