Next Article in Journal
Stone Pine (Pinus pinea L.) High-Added-Value Genetics: An Overview
Previous Article in Journal
Unveiling the Roles of LncRNA MOIRAs in Rice Blast Disease Resistance
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Genes
Volume 15
Issue 1
10.3390/genes15010083
genes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Research on Genotype Markers for Plant Height and Assisted Breeding of Key Sorghum Resources in China

by
Yubin Wang
1,2,
Na Lv
3,
Feng Yin
3,
Guoqi Duan
3,
Hao Niu
1,2,
Jianqiang Chu
1,2,
Haisheng Yan
1,2,
Lan Ju
1,2,
Fangfang Fan
1,2,
Xin Lv
1,2 and
Junai Ping
1,2,*
1
Sorghum Research Institute, Shanxi Agricultural University, Jinzhong 030600, China
2
State Key Laboratory of Sustainable Dryland Agriculture (in Preparation), Taiyuan 030031, China
3
College of Agriculture, Shanxi Agricultural University, Taigu 030801, China
*
Author to whom correspondence should be addressed.
Genes 2024, 15(1), 83; https://doi.org/10.3390/genes15010083
Submission received: 4 December 2023 / Revised: 8 January 2024 / Accepted: 8 January 2024 / Published: 9 January 2024
(This article belongs to the Section Plant Genetics and Genomics)
Versions Notes

Abstract

:
Dwarfing and the selection of optimal plant types constitute the primary focus of sorghum breeding. However, the lack of clarity regarding the gene types associated with plant height genes Dw1-Dw4 in the primary breeding materials has led to increased plant heights in improved offspring of the same plant height type, resulting in unsatisfactory morphological traits. This study aimed to elucidate the gene types related to plant height in breeding materials, validate the regulatory mechanisms, and establish a material improvement system. The goal was to achieve molecular-marker-assisted dwarf breeding through the detection of plant height genes and the test cross verification of main Chinese sorghum materials. Using 38 main male sterile lines and 57 main restorer lines of grain sorghum as materials, three plant height genes were detected and classified. Ninety-five F1 generation hybrids of these materials, along with typical materials, were measured at the wax maturity stage. Test cross results demonstrated that the variation in dw1-dw3 genes in the breeding materials significantly influenced the plant height of hybrid offspring. The main male sterile lines in Chinese sorghum predominantly exhibited the “three-dwarf” type of Kafir and its improved lines, characterized by the genotype (Dw1-Dw2-dw3-dw4). On the other hand, restorer lines mainly showcased the improved “two-dwarf” (Dw1-Dw2-dw3-dw4) genotype of the Kaoliang/Caudatum subspecies, along with the “three-dwarf” type of some Kafir and its improved lines. The test materials predominantly contained dw3 genes, with relatively fewer dw1 genes in the restorer lines. The primary restorer materials lacked the dw2 gene, and dw2 significantly influenced plant type. The increased plant height in improved offspring of the same plant height type material was attributed to differences in gene types. Therefore, the enhancement of plant height in breeding materials should prioritize the use of different methods in conjunction with Dw1 and Dw2 classification.

1. Introduction

Sorghum, the fifth most widely cultivated cereal crop globally, is a C4 grass grown for grain, feed, forage, sugar, and biofuel [1]. Breeding for dwarfing traits in sorghum is crucial, with four major dwarfing genes identified as Dw1–Dw4 [2]. In the early stages of hybrid utilization in China, sorghum primarily exhibited a “one-dwarf” hybrid, reaching heights of 2.5–3 m, leading to serious lodging. Recognizing the need for dwarf hybrids (approximately 2 m in height) for efficient production, Niu Tiantang et al. advocated for sorghum dwarf breeding and introduced Chinese sorghum hybrids regulated by the “two-dwarf” genotype [3]. However, with the rapid mechanization of agricultural production, the “two-dwarf” hybrid proved inadequate for mechanized production [4].
Currently, most commercial grain sorghum male sterile lines are “three-dwarf,” indicating the presence of three of the four dwarfing mutations [5]. Due to variations in plant height gene loci among different types of materials, hybrids from dwarf parents often exhibit increased plant height. The unclear location of plant height genes in main breeding materials has become a significant bottleneck in “three-dwarf” sorghum breeding. The classification of plant height genes in sorghum’s main breeding materials holds crucial guidance for enhancing the efficiency of sorghum dwarf breeding and the accuracy of hybrid selection.
In the 1950s, Quinby and Karper identified four loci, Dw1-Dw4, controlling height by modifying internode length in sorghum [6]. With advancements in molecular biology, Dw1, Dw2, and Dw3 genes have been cloned. Dw1, located on chromosome 9 [7], influences internodal cell count, reducing it upon mutation [8,9]. Dw2, located on chromosome 6, when mutated, significantly reduces internode length [4,10,11]. Dw3, situated on chromosome 7 [5], exhibits a direct duplication of 882 bp on the fifth exon, leading to internode shortening, although its mutation stability is questionable [12]. Dw4, the fourth typical plant height locus, is believed to be around 6.6 Mb on chromosome 6, but associated genes remain uncloned [13]. Single genes can reduce plant height by up to 50 cm, and although their effects are additive, the reduction diminishes with each added dwarfing gene [14].
Dwarf varieties effectively mitigate the risk of sorghum lodging and represent the primary sorghum type cultivated in China. A comprehensive understanding of sorghum dwarf breeding requires not only the study of individual genes or materials but also the detection and classification of main breeding materials. This, combined with sorghum breeders’ practice of classifying materials by subspecies, can unveil crucial mechanisms, guiding plant height breeding. This study utilized 38 main male sterile lines and 57 main restorer lines from grain sorghum breeding to detect, classify, and analyze their plant height genes’ regulatory mechanisms through test cross experiments and material subspecies types. The goal was to facilitate plant-height-gene-assisted sorghum dwarf breeding.

2. Materials and Methods

This study employed gene sequencing and phenotypic verification methods for experimentation. The classification method utilized Quinby and Karper’s five-level plant height categorization [14].

2.1. Selection of Materials

The selected materials comprised parent materials and original resources from major sorghum breeding research units in China. A total of 95 sorghum trunk breeding materials were chosen, including 38 male sterile lines and 57 restorer lines (refer to Table 1).

2.2. Plant Height Genetic Detection Methods

Genomic DNA was isolated from sorghum seedlings using the DNA isolation kit (Tiangen Biotech (Beijing, China) Co. LTD). Primers were designed based on the sequences of dwarf genes, dw1, dw2, and dw3. PCR amplification was performed in a 20 μL mixture containing PCR Mix 10 μL, primer (100 μmol·L−1) 0.5 μL, DNA 0.5 μL, and ddH2O 8.25 μL. The amplification protocol included: 94 °C for 2 min; 32 cycles of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 45 (120) s; and 72 °C for 10 min. PCR products of dw1 and dw2 were sent to Nanjing Plai Biotechnology Co Ltd. for sequencing, and subsequent sequence analysis was performed using DNAman v6 software. The PCR products of dw3 were separated in a 1% agarose gel and visualized by ethidium bromide staining (refer to Table 2).

2.3. Phenotypic Verification Methods

The experiment was conducted in the winter of 2020 at the Shibu Farm in Sanya City, Hainan Province, China (109°44′ E, 18°29′ N), which has a tropical maritime monsoon climate. Diallel crosses were designed among typical male sterile lines A2V4A/B, SX44A/B, CS3541A/B, TX623A/B, and TX3197A/B, while test crosses were conducted between male sterile lines A2V4A, SX44A, TX623A, and TX3197A, and restorer lines SX1042, Jingliang 5, SRX0-30, and TX7078.
For the phenotypic analysis of the plant height assay in 2021, the test materials were planted at the Dongbai Experimental Base of the Sorghum Research Institute of Shanxi Agricultural University, Shanxi Province, China (37°35′ N, 112°42′ E). This location has a typical warm temperate semi-humid continental monsoon climate. Field plants were grown in double rows on soil with uniform nutrients. At the wax maturity stage, plant height, spike length, spike stalk length, stem height, and height under the flag leaf were measured (three times) for 95 accessions and all hybrid F1 generations.

2.4. Data Analysis Methods

The experiment was set up in three replications in a randomized complete block design (Jinzhong, Shanxi Province, China) on 5 m2 plots. At the wax maturity stage, after removing all leaves, plant height, spike length, spike stalk length (the length of the stem between the flag leaf ring and the bottom of the panicle), stem height, and height under the flag leaf (stem length—spike stalk length) were measured. Data for all measurements represent the average of three replicates. Mean value, standard deviation, and coefficient of variation were processed using Excel 2007 software.

3. Results

3.1. Detection of Three Plant Height Genes in Main Sorghum Breeding Materials

3.1.1. Detection of dw1 Gene

The amplification length of dw1 is 427 bp. At the position 1350 of the genome, nucleotide A changes to T, resulting in the Dw1 mutation. When nucleotide position 1350 is A, the genotype is dw1dw1. With the change to T, the genotype becomes Dw1Dw1 (refer to Supplementary Figure S1).

3.1.2. Detection of dw2 Gene

The PCR product of dw2 primer is 997 bp. Loss of GA at position 549 of the genome indicates the dw2dw2 genotype. If it is not deleted, the genotype is Dw2Dw2 (refer to Supplementary Figure S2).

3.1.3. Detection of dw3 Gene

The dw3dw3 amplification length is 1263 bp; when dw3dw3 inserts 882 bp, mutating to Dw3, its amplification length becomes 2145 bp (refer to Supplementary Figure S3).

3.1.4. Detection of dw4 Gene

The Dw4 gene has not been cloned yet, but relevant scholars have detected it in broom sorghum [9]. Studies have shown that the Dw4 genes of the grain sorghum Guinea Kafir were all recessive in the early stages of introduction. The genotype of Dw4 in all materials in this experiment was dw4dw4.

3.2. Plant Height Gene Types of Main Breeding Materials

3.2.1. “Three-Dwarf” Type

This type contains three gene types. Dw1 is dominant (Dw1Dw1-dw2dw2-dw3dw3-dw4dw4), including 3 male sterile lines and 1 restorer line, with an average plant height of 110.58 cm. Dw2 is the dominant genotype (dw1dw1-Dw2Dw2-dw3dw3-dw4dw4), and it is the primary type of the “three-dwarf” series, including 29 male sterile lines and 17 restorer lines, with an average plant height of 106.56 cm. Dw3 is dominant (dw1dw1-dw2dw2-Dw3Dw3-dw4dw4), and there is only one accession of this genotype, NJ426, with a plant height of 90.33 cm (refer to Table 3).

3.2.2. “Two-Dwarf” Type

This type contains three gene types. Dw2 and Dw3 are dominant genotypes (dw1dw1-Dw2Dw2-Dw3Dw3-dw4dw4), including three copies, all of which are male sterile lines, with an average plant height of 103.56 cm. Dw1 and Dw3 are the dominant genotype (Dw1Dw1-dw2dw2-Dw3Dw3-dw4dw4), and there is only 1 restorer line, Hegari, with a plant height of 217.00 cm. The dominant genotypes of Dw1 and Dw2 (Dw1Dw1-Dw2Dw2-dw3dw3-dw4dw4) are the main types of the “two-dwarf” gene type, containing a total of 30 materials, including 3 male sterile lines and 27 restorer lines, with an average plant height of 124.00 cm (refer to Table 3).

3.2.3. “One-Dwarf” Type

This type has only one genotype. Dw1, Dw2, and Dw3 are dominant genotypes (Dw1Dw1-Dw2Dw2-Dw3Dw3-dw4dw4). The 10 materials included are all restorer lines, with an average plant height of 179.53 cm. Since all test materials are homozygous, their genotypes are abbreviated from (Dw1Dw1-Dw2Dw2-Dw3Dw3-dw4dw4) to (Dw1-Dw2-Dw3-dw4), the same as below.
These results indicate that as the number of dwarf genes increases, the average plant height of the test materials gradually decreases from “one-dwarf” to “two-dwarf” to “three-dwarf” plant height types (refer to Table 3).

3.3. Plant Height Genotype and Subfamily Analysis of Main Breeding Materials

In 1972, Harlan and de Wet provided a simple classification of cultivated sorghum [15], categorizing them as (1) Bicolor, (2) Guineensia, (3) Caudatum, (4) Kafir, and (5) Durra. Subsequently, NI Vavilov and Chinese breeders Wang Defu et al. classified Chinese sorghum (Kaoliang) as a separate family [16]. Consequently, Chinese sorghum breeders typically categorize breeding materials into five classes: (1) Guineensia, (2) Caudatum, (3) Kafir, (4) Durra, and (5) Chinese sorghum (Kaoliang). In this study, we adopted this classification method for the test materials to provide better guidance for sorghum breeding.
Three of the four materials with dominant Dw1 as the “three-dwarf” genotype belonged to the Durra family. The “three-dwarf” series of materials predominantly featured Dw2 as the dominant genotype. With the exception of SX861, most of the included materials were Kafir or improvements of the Kafir family, with male sterile lines constituting the majority. The “two-dwarf” series of materials were primarily dominated by Dw1 and Dw2 as dominant genotypes. The included material subfamilies were mainly Chinese sorghum and the top group combination (Kaoliang/Caudatum), with the majority being restorer lines. Most of the “one-dwarf” types were Chinese sorghum (Kaoliang) and some improved varieties of Chinese sorghum, all of which were restorer lines, mainly comprising Chinese local varieties (refer to Table 3).

3.4. Analysis of the Distribution and Regulation of Plant Height Genes

Based on the survey, the spike length of the main genotypes showed a small difference ranging between 24.68 and 27.91 cm. The primary factor influencing sorghum plant height is the stem height. The majority of “three-dwarf” types exhibited genotypes where Dw2 or Dw3 is dominant. The average plant heights for these two genotypes were 110.58 and 106.56 cm, with average spike lengths of 25.67 and 27.91 cm, and average spike stalk lengths of 35.25 and 39.20 cm. The average height under the flag leaf was 49.67 and 39.45 cm. The primary genotype of the “two-dwarf” type was the one where Dw1 and Dw2 are both dominant. This genotype had an average plant height of 124.00 cm, average spike length of 31.80 cm, average spike stalk length of 26.38 cm, and average height under the flag leaf of 65.82 cm. The “one-dwarf” genotype was characterized by Dw1, Dw2, and Dw3 all being dominant, with an average plant height of 179.53 cm, average spike length of 33.04 cm, average stalk length of 24.68 cm, and average height under the flag leaf of 121.82 cm. As we move from “three-dwarf” to “two-dwarf” to “one-dwarf” types, the average plant height gradually increases, while the average spike stalk length decreases. Therefore, the reduction of plant height under the flag leaf is the main reason leading to dwarf sorghum materials.
In the “three-dwarf” type, the height under the flag leaf of the dominant genotype Dw3 was significantly higher than that of the dominant genotype Dw2. Therefore, the main regulatory genes for the dwarfing of plant height under the flag leaf in the “three-dwarf” type were dw1 and dw3. This type predominantly included male sterile lines and a small number of restorer lines, mainly from the Kafir subspecies and its improved lines. In the “two-dwarf” type, the primary regulatory gene for plant height under the flag leaf was dw3. This type of sorghum was mainly comprised of restorer lines belonging to the Kaoliang/Caudatum subspecies combination (refer to Table 3).
Among the main breeding materials, the male sterile lines containing dw2 were the “three-dwarf” types SX44B, SX4244B, and A2V4B, and restorer lines included NJ426, 1602N, and the “two-dwarf”-type restorer line Hegari. Three out of the six male sterile lines were of the Durra subspecies, and restorer line NJ426 is also an improved line of the Durra subspecies. Hegari and 1602N belong to the top subspecies (Caudatum) and its improved lines. Within the “three-dwarf” types, the ratio of spike stalk length to stem height in the genotype with (Dw1-dw2-dw3-dw4) was 0.43, lower than the 0.51 in the genotype with (dw1-Dw2-dw3-dw4). The ratio of spike stalk length to stem height in Hegari was 0.27, which is lower than the 0.34 in the dominant gene type of Dw2 and Dw3. It is possible that the male sterile line subspecies Durra and the restorer line Caudatum subspecies contain the dw2 allele, and this gene may regulate the ratio of spike stalk length to stem height (refer to Table 3).

3.5. Verification Analysis of the Main Plant Height Gene

In this study, two genotypes of the “three-dwarf” types were selected for test cross, specifically A2V4A/B and SX44A/B, both characterized by the (Dw1-dw2-dw3-dw4) genotype. Both A2V4A/B and SX44A/B belong to the Durra subspecies and serve as male sterile lines in the main breeding varieties. The genotypes of CS3541A/B, TX623A/B, and TX3197A/B are (dw1-Dw2-dw3-dw4), representing Durra, Kafir/Caudatum, and Kafir subspecies, respectively (refer to Table 4).
All five materials fall into the “three-dwarf” type, with slight differences in plant heights ranging from 126.33 to 115.01 cm. The results indicate that the two-way test cross plant heights of A2V4A and the same genotype SX44A were 132.60 and 130.26 cm, respectively. In contrast, the test cross plant heights of CS3541B, TX623B, and TX3197B with different genotypes were 220.11, 206.67, and 181.00 cm, respectively. The reverse test cross plant heights were 217.00, 200.01, and 175.12 cm, respectively. Notably, when the test cross progeny between A2V4A/SX44A and other materials all contained the dw2 gene, the ratio of spike stalk length to stem height ranged between 0.3 and 0.38. However, the ratio of spike stalk length to stem height of the F1 generation without the dw2 gene was only 0.35 for TX623A × TX3197B, while other F1 generations were ≥0.42, significantly higher than those containing the dw2 gene. Therefore, the ratio of spike stalk length to stem height containing the dw2 gene may be lower (refer to Table 4).

3.6. Validation Analysis of Sorghum Hybrid Combinations

To conduct test cross experiments, four male sterile lines with minor phenotypic differences in plant height and four restorer lines with slight phenotypic variations in plant height were carefully chosen. The primary genotypes of the restorer lines consisted of two “three-dwarf” types (dw1-Dw2-dw3-dw4) and two “two-dwarf” types (Dw1-Dw2-dw3-dw4); namely, TX7078, SX1042, Jinliang 5, and SXR0-30. Their respective plant heights were 112.67, 107.00, 138.00, and 124.67 cm.
The male sterile lines predominantly exhibited two genotypes of the “three-dwarf” types (Dw1-dw2-dw3-dw4) and (dw1-Dw2-dw3-dw4). Notably, A2V4A, SX44A, TX623A, and TX3197A showcased similar plant heights (126.33, 115.12, 128.12, and 115.01 cm, respectively). Test cross results revealed that the four combined genotypes tested with TX7078 and SX1042 as male parents, paired with A2V4A and SX44A, exhibited a genotype of (Dw1dw1-Dw2dw2-dw3dw3-dw4dw4) and an average plant height of 185.24 cm. Conversely, TX7078 and SX1042, in conjunction with TX623A, and the test crosses with TX3197A, demonstrated a genotype of (Dw1Dw1-Dw2dw2-dw3dw3-dw4dw4). Although the genotype of all these crosses was of the “two-dwarf” type, which possesses dominant Dw1 and Dw2 genes, the dw1 loci in the second combination were Dw1 homozygous genotype, resulting in an increased average plant height of 22.37 to 207.61 cm.
Moreover, the average plant height of the “three-dwarf” type with TX623A and TX3197A as female parents was (dw1dw1-Dw2Dw2-dw3dw3-dw4dw4). The combined genotype transformed to (Dw1dw1-Dw2Dw2-dw3dw3-dw4dw4) due to dw1dw1 turning dominant. Dw1dw1 became a “two-dwarf” type, with an average plant height of 194.33 cm, indicating an increase of 67.86 cm. These test cross results underscore that even with breeding materials of the same plant height type, genotype differences can lead to substantial variations in plant height among hybrid offspring. The homozygous plant height gene exerts a significantly stronger influence on regulating plant height than the heterozygous plant height gene (refer to Table 5).

4. Discussion

4.1. Enhancement of Plant Height Genotype Classification in Sorghum Breeding Materials

The inception of the first “green revolution” in agricultural production marked a significant milestone achieved by cultivating new lodging-resistant crop varieties with dwarf plants, substantially augmenting grain yields [17,18]. While China’s dwarf sorghum breeding originated with Jinza 5 [3], the current plant height genotypes of the primary breeding materials remain unclear. This study posits that the predominant sorghum main male sterile lines are primarily of the “three-dwarf” type, with a smaller subset being the “two-dwarf” type (refer to Table 3). Within the “three-dwarf” type, the majority of genotypes exhibit Dw2 dominance (dw1-Dw2-dw3-dw4), while some genotypes showcase Dw1 as dominant (Dw1-dw2-dw3-dw4) (refer to Table 3). Due to these genotypic variations, male sterile lines of the same “three-dwarf” type and similar plant height may produce offspring with increased plant height, potentially belonging to the “two-dwarf” type (refer to Table 4). Our findings reveal that materials with the genotype (Dw1-dw2-dw3-dw4) belong to the Durra subspecies, whereas those with the genotype (Dw1-Dw2-dw3-dw4) are predominantly from the Kafir subspecies and its improved lines. The Durra subspecies may carry the dw2 allele, presenting an opportunity to enhance the genetic diversity of male sterile lines. Given that the majority of male sterile lines encompass dw3 and dw4 genes, it is advisable to classify these materials based on Dw1 and Dw2. The utilization of molecular-assisted detection for Dw1 and Dw2 genes during offspring selection, particularly when working with Durra types, can expedite the selection process. This approach helps prevent issues such as the emergence of excessively tall offspring, thereby optimizing breeding efficiency.
The primary genetic types of restorer lines encompass “two-dwarf” (Dw1-Dw2-dw3-dw4) and “three-dwarf” types (Dw1-Dw2-dw3-dw4), with a minority exhibiting the “three-dwarf” type (Dw1-Dw2-Dw3-dw4) genotype. Originating from different sources, “two-dwarf” type restorer lines are mainly derived from the Kafir subspecies and its improved lines. In contrast, “three-dwarf” type restorer lines predominantly hail from the Kaoliang/Caudatum subspecies. The prevalent origin reflects Chinese breeders’ efforts to enhance Chinese local varieties for brewing sorghum. However, the plant height type of restorer lines is primarily “two-dwarf” (28 accessions), containing minimal dw2 genetic material (refer to Table 3). When crossbred with male sterile lines of the “three-dwarf” type, their F1 progeny may assume the “two-dwarf” type, leading to increased plant height. This study advocates for improving restorer lines in tandem with male sterile lines, gradually transitioning toward the “three-dwarf” type while preserving the excellent traits of Chinese local varieties and enriching the source of improved materials. For instance, Hegari, which contains dw2 in the plant height gene, can be strategically employed, aligning with male sterile lines classified based on Dw1 and Dw2.

4.2. Primary Mechanisms of Gene Regulation in Sorghum Strains

Achieving a delicate balance between reducing stem length to prevent lodging and maintaining yield potential by not excessively reducing biomass has prompted the pursuit of breeding tall dwarfs [18,19,20,21,22]. Quinby and Karper’s identification of four loci, Dw1-Dw4, governing height by modifying internode length has been crucial in this endeavor [6]. Recessive alleles at these loci contribute to reduced internode length [6]. Pleiotropic effects of Dw2 and Dw3 encompass spike length, seed weight, and leaf area for Dw2 [23,24], and seed weight, panicle size, tiller number, and leaf angle for Dw3 [24,25,26]. Previous studies proposed that dw1 and dw3 act synergistically to reduce internode length [9].
Our findings reveal that the current trunk male sterile lines generally exhibit low plant height, all below 120 cm (Table 3). As we transition from “three-dwarf” to “two-dwarf” and “one-dwarf” types, the average plant height gradually increases, while the average spike stalk length decreases. Both “two-dwarf” and “one-dwarf” types are notably shorter than “three-dwarf” types. Therefore, reducing plant height under the flag leaves emerges as the primary criterion for selecting dwarf sorghum materials. In line with prior research, except for the dw4 gene, present in all materials, dw1 and dw3 play regulatory roles in “three-dwarf” types, with dw3 primarily regulating “two-dwarf” types [25]. Notably, Chinese sorghum breeders have predominantly eliminated the dominant Dw3 gene during “two-dwarf” type improvement, focusing on adding the dw1 gene and a small portion of the dw2 gene in “three-dwarf” type enhancement (Table 3).
Research by Graham and Lessman proposed that mutations in plant height genes significantly reduce stem length, spike length, and seed weight without diminishing leaf number [23]. Our study indicates a scarcity of materials containing the dw2 gene in main breeding materials. Josie L. Hilley posited that dw2 mutations lead to a substantial reduction in inter-stem length, a trait selected in sorghum breeding programs [8]. Joel Oliver demonstrated that dw2 mutations do not alter cell proliferation in new internodes in the apical dome but inhibit cell proliferation in extended internodes. This suggests dw2′s role in regulating cell proliferation during elongation, a crucial factor affecting internode length, plant height, light competition, and resource allocation to stem growth (sink strength) [27]. Our study contends that dw1 and dw3 solely shorten internode length without reducing node number, resulting in a larger spike stalk length ratio in dwarf materials. This causes severe leaf occlusion, impacting canopy structure and reducing light transmittance (Table 4).
Olson, S. N. et al. proposed that plant height is a key agronomic trait for regulating sorghum plant type, emphasizing genetic improvement of plant height as the main focus of sorghum dwarf breeding [28]. However, crop source strength depends on canopy photosynthetic characteristics and the canopy’s photosynthetic ability [29]. This could be a key reason for the limited breakthroughs in sorghum dwarf breeding. Josie L. Hilley asserted that Dw2 influences internode length during the vegetative phase and the last 6–7 internodes produced after floral initiation [8]. Materials containing the dw2 gene exhibit a smaller spike stalk length to stem height ratio, resulting in a more balanced plant structure. Therefore, the dw2 gene should be enriched in material improvement efforts.

4.3. Additional Genes Influencing Plant Height in Sorghum

Gai Junyi introduced a genetic analysis method that considers genes with significant effects on quantitative traits as major genes and those with minor effects as polygenes. This approach enables the identification of major and polygenic effects, providing a more accurate and effective analysis of genetic impacts [30]. Sorghum plant height is governed by multiple genes. Existing research on sorghum plant height has primarily focused on dw1, dw2, and dw3 genes, with limited exploration of dw4. Quinby and Karper suggested that variations in plant height within the same genotype result from the presence of a modification complex and minor genes, particularly influencing spike stalk length (the distance between the flag leaf ring and the base of the panicle) and spike length [6]. Even within populations with the same number of dwarf genes, significant height differences exist [6].
Our study demonstrates that as the dominance of plant height genes increases, the average plant height gradually rises, with substantial variations in plant height among materials of the same type. For instance, Hegari in the “two-dwarf” type reaches a height of 217.0 cm, significantly surpassing most other “two-dwarf” materials. Similarly, within the same gene type, such as the three-tall materials with the (Dw1-Dw2-Dw3-dw4) genotype, LN8RN, K35-Y5*1383, JR107, and SCS exhibit plant heights of 128.33, 101.33, 120.67, and 138.00 cm, respectively— noticeably lower than other materials (Table 3). Therefore, this study posits that aside from the Dw4 gene eliminated by breeders in the early stages, other plant height genes exist [8,31].
In this study, the ratio of spike stalk length to stem height in different plant height gene types reveals a correlation between plant structure and plant height genes. Hence, breeders should not only focus on main genes but also explore those regulating spike stalk length and reducing node number to enhance sorghum plant morphology.

5. Conclusions

The primary male sterile lines for sorghum consist mainly of “three-dwarf” types from the Kafir subspecies and its improved lines, characterized by the (Dw1-Dw2-dw3-dw4) genotype. Restorer lines predominantly belong to the “two-dwarf” genotype (Dw1-Dw2-dw3-dw4) of the Kaoliang/Caudatum subspecies, along with some “three-dwarf” types from the Kafir subspecies and its improved lines. The test materials exhibit a higher prevalence of dw3 genes, while restorer lines show relatively fewer dw1 genes. Notably, the primary restorer lines lack the dw2 gene, which influences plant structure. The observed variations in the plant height of improved offspring of the same type result from differences in genotype. Future efforts to enhance plant height in breeding materials should employ a combination of methods, focusing on the classification of Dw1 and Dw2.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/genes15010083/s1, Figure S1: Sequence alignment of Dw1 gene of the tested materials. Sequencing sample ID (”R” is Restorer line number, “B” is Male sterile line number) were listed on the left of the picture, and the sequence of the samples were performed on the right side of the picture. An alternative of “A” to “T” at position 178 of the sequence led the genotype changed from Dw1Dw1 to dw1dw1; Figure S2: Sequence alignment of Dw2 gene of the tested materials. Sequencing sample ID (“R” is Restorer line number, “B” is Male sterile line number) were listed on the left of the picnture, and the sequence of the samples were performed on the right side of the picture. A deletion of “T” at position 11 of the sequence led the genotype changed from Dw2Dw2 to dw2dw2; Figure S3: Genotype characterization of Dw3 gene in tested materials. ID of materials were numbered as “R” and “B”, and the target band size of Dw3Dw3 genotype is 1263 bp, and the target band size of dw3dw3 genotype is 2154 bp. Size marker: DL2000. PCR products were saparated in 1% agarose gel.

Author Contributions

Y.W. and J.P. designed the research; J.P. and Y.W. secured funding for the research, contributed to the design and interpretation of experimental results, and edited the manuscript; G.D., Y.W., N.L., F.Y., J.C., H.N., Y.W., H.Y., F.F. and X.L. conducted the experiments; J.P. and Y.W. analyzed the data and wrote the manuscript; J.P., Y.W., N.L., F.Y., H.N., L.J. and H.Y. analyzed the data and revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This work received support from the Key Research and Development Projects of Shanxi Province (No. 202102140601008), China Agriculture Research System of MOF and MARA (No. CARS-06), State Key Laboratory of Sustainable Dryland Agriculture (in preparation) (No. 202002-4), Shanxi Province Science Foundation for Youths (No. 202103021223138), Shanxi Province Brewing Sorghum Seed Industry Innovation Varieties Joint Public Relations Project (No. YZGG-04-04-03), and the 2023 Doctor to Shanxi Work Award Fund Research Project (No. SXBYKY2023021).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article and Supplementary Materials.

Acknowledgments

We express our gratitude to the China Agriculture Research System for generously providing the sorghum materials.

Conflicts of Interest

The authors declare no conflicts of interest. The funders played no role in the study’s design; the collection, analysis, or interpretation of data; the writing of the manuscript; or the decision to publish the results.

References

  1. Swigoňová, Z.; Lai, J.; Ma, J.; Ramakrishna, W.; Llaca, V.; Bennetzen, J.L.; Messing, J. Close split of sorghum and maize genome progenitors. Genome Res. 2004, 14, 1916–1923. [Google Scholar] [CrossRef]
  2. Quinby, J.R. Sorghum Improvement and the Genetics of Growth; Texas A&M University Press: College Station, TX, USA, 1974. [Google Scholar]
  3. Liang, T.T.; Bi, N. Scientific research road in the sorghum field-Chinese famous sorghum breeder cattle paradise. Seed Technol. 2014, 32, 1–5. [Google Scholar]
  4. Lu, Q.S.; Sun, Y. Genetic Improvement of Hybrid Sorghum. China Agric. Sci. Technol. Press 2005, 21, 37–38. [Google Scholar]
  5. Multani, D.S.; Briggs, S.P.; Chamberlin, M.A.; Blakeslee, J.J.; Murphy, A.S.; Johal, G.S. Loss of an MDR transporter in compact stalks of maize br2 and sorghum dw3 mutants. Science 2003, 302, 81–84. [Google Scholar] [CrossRef]
  6. Karper, E.R.; Quinby, R.J. Sorghum-Its production, utilization and breeding. Econ. Bot. 1947, 1, 355–371. [Google Scholar] [CrossRef]
  7. Josie, H.; Sandra, T.; Sara, O.; Daryl, M.; John, M. Identification of Dw1, a Regulator of Sorghum Stem Internode Length. PLoS ONE 2016, 11, e0151271. [Google Scholar]
  8. Hilley, J.L.; Weers, B.D.; Truong, S.K.; McCormick, R.F.; Mattison, A.J.; McKinley, B.A.; Morishige, D.T.; Mullet, J.E. Sorghum Dw2 Encodes a Protein Kinase Regulator of Stem Internode Length. Sci. Rep. 2017, 7, 4616. [Google Scholar] [CrossRef]
  9. Miki, Y.; Haruka, F.; Ko, H.; Satoko, A.N.; Kozue, O.S.; Akihiro, F.; Masako, T.; Xian, J.S.; Yusuke, I.; Rie, N.; et al. Sorghum Dw1, an agronomically important gene for lodging resistance, encodes a novel protein involved in cell proliferation. Sci. Rep. 2016, 22, 28366. [Google Scholar]
  10. Klein, R.R.; Mullet, J.E.; Jordan, D.R.; Miller, F.R.; Rooney, W.L.; Menz, M.A.; Franks, C.D.; Klein, P.E. The effect of tropical sorghum conversion and inbred development on genome diversity as revealed by high resolution genotyping. Crop Sci. 2008, 48, 12–26. [Google Scholar] [CrossRef]
  11. Morishige, D.T.; Klein, P.E.; Hilley, J.L.; Sahraeian, S.M.E.; Sharma, A.; Mullet, J.E. Digital genotyping of sorghum-A diverse plant species with a large repeat-rich genome. BMC Genom. 2013, 14, 448. [Google Scholar] [CrossRef] [PubMed]
  12. Jiang, F.; Guo, M.; Yang, F.; Duncan, K.; Jackson, D.; Rafalski, A.; Wang, S.; Li, B. Mutations in an AP2 transcription factor-like gene affect internode length and leaf shape in maize. PLoS ONE 2012, 7, e37040. [Google Scholar] [CrossRef] [PubMed]
  13. Morris, G.P.; Ramu, P.; Deshpande, S.P.; Hashc, C.T.; Shahb, T.; Upadhyayab, H.D.; Riera-Lizarazub, O.; Brownd, P.J.; Acharyae, C.B.; Mitchelle, S.E.; et al. Population genomic and genome-wide association studies of agroclimatic traits in sorghum. Proc. Natl. Acad. Sci. USA 2013, 110, 453–458. [Google Scholar] [CrossRef] [PubMed]
  14. Quinby, J.R.; Karper, R.E. Inheritance of height in sorghum. Agron 1954, 46, 212–216. [Google Scholar]
  15. Harlan, J.R.; de Wet, J.M.J. A simplified classfication of cultivated sorghum. Crop Sci. 1972, 2, 172–176. [Google Scholar] [CrossRef]
  16. Vavilov, N.I. Sorghum Production and Utilization; AVI Publishing Company: New York, NY, USA; London, UK, 1951. [Google Scholar]
  17. Sasaki, A.; Ashikari, M.; Ueguchi-Tanaka, M.; Itoh, H.; Nishimura, A.; Swapan, D.; Ishiyama, K.; Saito, T.; Kobayashi, M.; Khush, G.S.; et al. Green revolution: A mutant gibberellin-synthesis gene in rice. Nature 2002, 416, 701–702. [Google Scholar] [CrossRef] [PubMed]
  18. Asano, K.; Yamasaki, M.; Takuno, S.; Miuraa, K.; Katagirid, S.; Itod, T.; Doie, K.; Wuf, J.; Ebanag, K.; Matsumotof, T.; et al. Artificial selection for a green revolution gene during japonica rice domestication. Proc. Natl. Acad. Sci. USA 2011, 108, 11034–11039. [Google Scholar] [CrossRef] [PubMed]
  19. Brooking, I.R.; Kirby, E.J.M. Interrelationships between stem and ear development in winter wheat: The efects of a Norin 10 dwarfing gene, Gai/Rht2. J. Agric. Sci. 1981, 97, 373–381. [Google Scholar] [CrossRef]
  20. Gale, M.D. The identifcation and exploitation of Norin 10 semidwarfng genes. Plant Breed Inst. Ann. Rep. 1976, 16, 21–24. [Google Scholar]
  21. Mathews, K.L.; Chapman, S.C.; Trethowan, R.; Singh, R.P.; Crossa, J.; Pfeifer, W.; Ginkel, M.; De, L.I. Global adaptation of spring bread and durum wheat lines near-isogenic for major reduced height genes. Crop Sci. 2006, 46, 603–613. [Google Scholar] [CrossRef]
  22. Snape, J.W.; Parker, B.B. The efect of the Norin 10 dwarfng gene, Rht2, on yield-biomass relationships in wheat (Triticum aestivum). In Semi-Dwarf Cereal Mutants and Their Use in Crossbreeding II. Research Coordination Meeting, Vienna; International Atomic Energy Agency: Vienna, Austria, 1984; pp. 71–77. [Google Scholar]
  23. Graham, D.; Lessman, K.J. Effect of Height on Yield and Yield Components of Two Isogenic Lines of Sorghum vulgare Pers. Crop Sci. 1966, 6, 372–374. [Google Scholar] [CrossRef]
  24. Pereira, M.G.; Lee, M. Identification of genomic regions affecting plant height in sorghum and maize. Theor. Appl. Genet. 1995, 90, 380–388. [Google Scholar] [CrossRef] [PubMed]
  25. Casady, A.J. Effect of a Single Height (Dw3) Gene of Sorghum on Grain Yield, Grain Yield Components, and Test Weight. Crop Sci. 1965, 5, 385–388. [Google Scholar] [CrossRef]
  26. Truong, S.K.; Mc Cormick, R.F.; Rooney, W.L.; Mullet, J.E. Harnessing genetic variation in leaf angle to increase productivity of sorghum bicolor. Genetics 2015, 201, 1229–1238. [Google Scholar] [CrossRef] [PubMed]
  27. Joel, O.; Ming, Z.F.; Brian, M.; Starla, Z.D.; Federica, B.; Curtis, W.; John, E. The AGCVIII kinase Dw2 modulates cell proliferation, endomembrane trafficking, and MLG/xylan cell wall localization in elongating stem internodes of Sorghum bicolor. Plant J. 2021, 105, 1053–1071. [Google Scholar]
  28. Olson, S.N.; Ritter, K.; Rooney, W.; Kemanian, A.; McCarl, B.A.; Zhang, Y.; Hall, S.; Packer, D.; Mullet, J. High biomass yield energy sorghum: Developing a genetic model for C4 grass bioenergy crops. Biofuels Bioprod. Biorefining 2012, 6, 640–655. [Google Scholar] [CrossRef]
  29. Quijano, A.; Morandi, E.N. Leaf area reduction during the pod set period changes the photomorphogenic light balance and increases the pod number and yield in soybean canopies. Field Crops Res. 2023, 303, 109148. [Google Scholar] [CrossRef]
  30. Gai, J.; Yi, H.; Ji, B. Characteristics, common questions and application prospects of the restrictive, two-stage, multi-site, genome-wide association analysis method (RTM-GWAS). Chin. Agric. Sci. 2020, 53, 1699–1703. [Google Scholar]
  31. Xin, L.; Xian, R.L.; Eyal, F.; Jian, M.Y. Dissecting repulsion linkage in the dwarfing gene Dw3 region for sorghum plant height provides insights into heterosis. Proc. Natl. Acad. Sci. USA 2015, 112, 11823–11828. [Google Scholar]
Table 1. Subspecies classification and source of test materials.
Table 1. Subspecies classification and source of test materials.
TypeNumberNameSubspeciesSourceTypeNumberNameSubspeciesSource
Male sterile line1SX44BDurraChina,SXAU,SRIRestorer line1091644(H)KafirAustralia
2SX4244BDurraChina,SXAU,SRI1191645(H)KafirAustralia
3A2V4BDurraChina,SXAU,SRI1291648KafirAustralia
4CS3541BDurraChina,SXAU,SRI13961547KafirUSA
5961542BDurraChina,SXAU,SRI1491624(H)KafirAustralia
6F4BDurraChina,SXAU,SRI15TX414Kafir/DurraUSA
7TX3197BKafirUSA16NJ426Kafir/DurraChina,SXAU,SRI
8(TXbmr6B/7501B)BKafirChina,SXAU,SRI17SX1042Kaoliang/KafirChina,SXAU,SRI
9N1BKafirChina,SXAU,SRI18HBNR436-2Kaoliang/KafirChina,HBAAS
10N3BKafirChina,SXAU,SRI19Hong yin ziKaoliangChina,Farmer kind
11ZSBKafirChina,SXAU,SRI20QKYKaoliangChina,Farmer kind
12TX414BKafirUSA21chf5933KaoliangChina,CFAI
13TX639BKafirUSA22SCSKaoliangChina,Farmer kind
14TX649BKafirUSA2320131937KaoliangChina,SXAU,SRI
157501BKafirUSA24XL7Kaoliang/CaudatuChina,XZAI
16TX2925BKafirUSA25JL5Kaoliang/CaudatuChina,SXAU,SRI
17J16VII18BKafirChina,JLAAS260-30/DHSKaoliang/CaudatuChina,SXAU,SRI
18J16VII27BKafirChina,JLAAS27SXR0-30Kaoliang/CaudatuChina,SXAU,SRI
19SX605BKafirChina,SXAU,SRI28LNRKaoliang/CaudatumChina,LNAAS
20SX77BKafirChina,SXAU,SRI29XLH*GN2Kaoliang/CaudatumChina,SXAU,SRI
21998BKafirChina,SXAU,SRI300592FKaoliang/CaudatumChina,SXAU,SRI
22TV33BKafirChina,SXAU,SRI31SX861Kaoliang/CaudatumChina,SXAU,SRI
23TX623BKafir/CaudatumUSA321602NKaoliang/CaudatumChina,SXAU,SRI
24(314B/623B)BKafir/CaudatumChina,SXAU,SRI33HC356Kaoliang/CaudatumChina,SXAU,SRI
252055BKafir/DurraChina,JLAAS341383-2Kaoliang/CaudatumChina,SXAU,SRI
26L407BKafir/DurraChina,LNAAS35N133Kaoliang/CaudatumChina,JLAAS
27TAM428BKafir/DurraUSA36J98HKaoliang/CaudatumChina,JLAAS
28N2BKafir/DurraChina,SXAU,SRI37JR108Kaoliang/CaudatumChina,JLAAS
29J4190BKafir/DurraChina,JLAAS38XZ6936RKaoliang/CaudatumChina,SXAU,SRI
30SX3142BKafir/kubanChina,SXAU,SRI399825R-1Kaoliang/CaudatumChina,SXAU,SRI
31SJBKafir/ComplexChina,SXAU,SRI40R111Kaoliang/CaudatumChina,SXAU,SRI
32L45BKafir/ComplexChina,SCAAS,SRI41HM65Kaoliang/CaudatumChina,SXAU,SRI
33[Tx623B.Bmr6/L199B]BKafir/ComplexChina,SXAU,SRI42LNH13Kaoliang/CaudatumChina,SCAAS,SRI
34[L45B/(TX623B/V4B)]BKafir/ComplexChina,SXAU,SRI432381Kaoliang/CaudatumChina,SXAU,SRI
35(SX605B×泸45B)BKafir/ComplexChina,SXAU,SRI44LN8RNKaoliang/CaudatumChina,LNAAS
367050BKafir/ComplexChina,LNAAS45JR105Kaoliang/CaudatumChina,JLAAS
37N4BKafir/ComplexChina,SXAU,SRI46XLH-1Kaoliang/CaudatumChina,HNAAS
38SX111BComplexChina,SXAU,SRI47ZHOUKaoliang/CaudatumChina,LNAAS
TypeNumberNameSubspeciesSource481603NKaoliang/CaudatumChina,SXAU,SRI
Restorer line1HegariCaudatumUSA495564FKaoliang/CaudatumChina,SXAU,SRI
2K35-Y5*1383ComplexChina,SXAU,SRI505577FKaoliang/CaudatumChina,SXAU,SRI
3F-RDurraFrance51JR107Kaoliang/CaudatumChina,JLAAS
4TX7078KafirUSA52zhzy2-07Kaoliang/CaudatumChina,SXAU,SRI
5HTX430KafirUSA53363C/2691Kaoliang/ComplexChina,SXAU,SRI
6TX432KafirUSA549198/TMSKaoliang/ComplexChina,SXAU,SRI
7TX2737KafirUSA55IS7444CUnknownUSA
891633(H)KafirAustralia56XYLgaoliangUnknownHungary
991635(H)KafirAustralia57FeteritaUnknownUSA
The subspecies classification of the materials in Table 1 follows the five simple classification methods of Chinese breeders as mentioned in this paper. The abbreviations used for the material sources are as follows: China, SXAU, SRI (Sorghum Research Institute, Shanxi Agricultural University, China); China, JLAAS (Jilin Provincial Academy of Agricultural Sciences, China); China, LNAAS (Liaoning Provincial Academy of Agricultural Sciences, China); China, HBAAS (Hebei Provincial Academy of Agricultural Sciences, China); China, Farmer kind (Chinese farm sorghum varieties); China, CFAI (Chifeng Municipal Institute of Agricultural Science, China); China, XZAI (Xinzhou Agricultural Science Research Institute, China); China, SCAAS, SRI (Sorghum Research Institute, Sichuan Provincial Academy of Agricultural Sciences, China); China, HNAAS (Hunan Provincial Academy of Agricultural Sciences, China).
Table 2. PCR primer amplification sequence.
Table 2. PCR primer amplification sequence.
Primer NamePrimer Sequence
Dw1-FTGGCGGTCCAACGTCTAAT
Dw1-RCCTGAAGTATGGCGTGTCT
Dw2-FCAGTTCAAATCAACGAGGAG
Dw2-RTCCGTCGTGAAATGAGAATA
Dw3-FCGTCATCGTCCAGAACTCGG
Dw3-RGACCCTTGCTCCACCACCTT
The PCR primer amplification sequence source for Table 2 was obtained from the NCBI.
Table 3. Plant height gene types and measurement data of the test materials.
Table 3. Plant height gene types and measurement data of the test materials.
Plant Height TypeGenotypeMaterial TypeNumberNameSubspeciesPlant Height (cm)Stem Height (cm)Spike Stalk Length (cm)Spike Length (cm)Height under Flag Leaf (cm)Spike Stalk Length/Stem Height
Three-dwarf typeDw1Dw1
dw2dw2
dw3dw3
dw4dw4		Male sterile line1SX44BDurra115.0088.6739.0026.3349.670.44
2SX4244BDurra86.0061.6734.0024.3327.670.55
3A2V4BDurra126.33101.3337.3325.0064.000.37
Restorer line41602NKaoliang/Caudatum115.0088.0030.6727.0057.330.35
Avg110.5884.9235.2525.6749.670.43
SD17.2416.673.691.2215.790.09
COV0.160.200.100.050.320.21
dw1dw1Male sterile line52055BKafir/Durra70.3352.0030.3318.3321.670.58
Dw2Dw26L407BKafir/Durra103.0076.0041.6727.0034.330.55
dw3dw37TAM428BKafir/Durra98.3368.3330.0030.0038.330.44
dw1dw1
Dw2Dw2
dw3dw3
dw4dw4		8SJBKafir/Complex126.33100.3344.6726.0055.670.45
9L45BKafir/Complex144.33107.6744.6736.6763.000.41
10N2BKafir/Durra107.0072.3339.0034.6733.330.54
11[Tx623B.Bmr6/L199B]BKafir/Complex93.3364.6735.1728.6729.500.54
12TX3197BKafir115.0094.0044.0021.0050.000.47
13[L45B/(TX623B/V4B)]BKafir/Complex117.0079.0039.8338.0039.170.50
14(SX605B×L45B)BKafir/Complex132.33106.0037.3326.3368.670.35
15(TXbmr6B/7501B)BKafir108.6780.6742.0028.0038.670.52
16N1BKafir103.0069.0039.0034.0030.000.57
17N3BKafir116.3384.0050.1732.3333.830.60
18J4190BKafir/Durra84.0056.3333.0027.6723.330.59
19ZSBKafir127.67103.6748.3324.0055.330.47
20TX414BKafir87.0064.0034.0023.0030.000.53
21TX639BKafir132.50108.3349.0024.1759.330.45
22TX649BKafir124.0084.6741.3339.3343.330.49
23TX623BKafir/Caudatum128.0096.0052.0032.0044.000.54
247501BKafir104.3384.0043.5020.3340.500.52
257050BKafir/Complex128.5095.5037.0033.0058.500.39
26TX2925BKafir113.0087.6743.6725.3344.000.50
27J16VII18BKafir108.3371.0033.6737.3337.330.47
28J16VII27BKafir102.6773.3336.0029.3337.330.49
29SX605BKafir128.0094.0039.6734.0054.330.42
30SX77BKafir104.0070.3344.3333.6726.000.63
31CS3541BDurra111.3382.3350.6729.0031.670.62
32SX3142BKafir/kuban89.6765.6726.3324.0039.330.40
33(314B/623B)BKafir/Caudatum112.6788.0039.6724.6748.330.45
Restorer line34LNRKaoliang/Caudatum131.67108.6720.6723.0088.000.19
35XLH*GN2Kaoliang/Caudatum104.0078.6729.0025.3349.670.37
360592FKaoliang/Caudatum92.1763.1737.1029.0026.070.59
37TX7078Kafir112.6789.6746.6723.0043.000.52
38HTX430Kafir108.0074.0044.2534.0029.750.60
39TX432Kafir91.0067.0044.0024.0023.000.66
40TX414Kafir/Durra87.3366.6736.6720.6730.000.55
41TX2737Kafir69.8346.0026.6723.8319.330.58
4291633(H)Kafir97.6774.3337.8323.3336.500.51
4391635(H)Kafir91.0069.0039.0022.0030.000.57
4491644(H)Kafir103.5074.5046.0029.0028.500.62
4591645(H)Kafir105.6777.6743.3328.0034.330.56
4691648Kafir94.3370.3342.3324.0028.000.60
47SX1042Kaoliang/Kafir107.0074.3338.6732.6735.670.52
48961547Kafir95.0073.3342.3321.6731.000.58
4991624(H)Kafir92.5063.0739.1729.4323.900.62
50SX861Kaoliang/Caudatum97.6768.6719.3329.0049.330.28
Avg106.5678.6539.2027.9139.450.51
SD16.4715.147.345.2213.880.10
COV0.150.190.190.190.350.19
dw1dw1,dw2dw2
Dw3Dw3,dw4dw4		Restorer line51NJ426Kafir/Durra90.3362.6739.0027.6723.670.62
Two-dwarf typedw1dwd1,Dw2Dw2
Dw3Dw3,dw4dw4		Male sterile line 52SX111BComplex97.3374.6737.5022.6737.170.50
53998BKafir117.6791.6749.1726.0042.500.54
54961542BDurra95.6769.0047.0026.6722.000.68
Avg103.5678.4544.5625.1133.890.57
SD12.2511.806.212.1410.640.09
COV0.120.150.140.090.310.16
Dw1Dw1,dw2dw2
Dw3Dw3,dw4dw4		Restorer line55HegariCaudatum217.00195.0053.0022.00142.000.27
Dw1Dw1
Dw2Dw2
dw3dw3
dw4dw4		Male sterile line 56TV33BKafir78.0066.0028.6712.0037.330.43
57N4BKafir/Complex143.67102.6743.6741.0059.000.43
58F4BDurra153.50126.0032.5027.5093.500.26
Restorer line59HC356Kaoliang/Caudatum157.00129.0033.3328.0095.670.26
601383-2Kaoliang/Caudatum133.67108.0021.0025.6787.000.19
61zhzy2-07Kaoliang/Caudatum116.0095.0023.0021.0072.000.24
62N133Kaoliang/Caudatum118.0099.0026.5019.0072.500.27
63363C/2691Kaoliang/Caudatum136.33117.6727.6718.6790.000.24
64J98HKaoliang/Caudatum126.0091.3328.3334.6763.000.31
65F-RDurra104.0080.3342.6723.6737.670.53
66JR108Kaoliang/Caudatum130.6799.3339.3331.3360.000.40
67X6936RKaoliang/Caudatum95.0066.0040.0029.0026.000.61
689198/TMSKaoliang/Caudatum110.0074.0033.6736.0040.330.46
69IS7444CUnknown129.00111.6751.6017.3360.070.46
70HBNR436-2Kaoliang/Kafir105.5073.5026.5032.0047.000.36
719825R-1Kaoliang/Caudatum93.6766.6731.3327.0035.330.47
72R111Kaoliang/Caudatum137.50113.0026.0024.5087.000.23
73XYLgaoliangUnknown137.67110.3332.3327.3378.000.29
74HM65Kaoliang/Caudatum161.33136.3337.0025.0099.330.27
75LNH13Kaoliang/Caudatum133.33103.6724.0029.6779.670.23
762381Kaoliang/Caudatum134.00110.0026.5024.0083.500.24
77XL7Kaoliang/Caudatum142.33118.6734.3323.6784.330.29
78Jing liang 5Kaoliang/Caudatum138.00109.7326.8328.2782.900.24
79SXR0-30Kaoliang/Caudatum124.67101.3333.3323.3368.000.33
80ZHOUKaoliang/Caudatum111.0085.6728.6725.3357.000.33
81JR105Kaoliang/Caudatum124.6793.6737.0031.0056.670.40
821603NKaoliang/Caudatum113.6785.3327.0028.3358.330.32
830-30/DHSKaoliang/Caudatum136.67112.0035.0024.6777.000.31
845564FKaoliang/Caudatum94.3369.0026.6725.3342.330.39
855577FKaoliang/Caudatum100.6773.6729.6727.0044.000.40
Avg124.0097.6231.8026.3865.820.34
SD20.2819.976.845.7420.550.10
COV0.160.200.210.220.310.30
One-dwarf typeDw1Dw1
Dw2Dw2
Dw3Dw3
dw4dw4		Restorer line86LN8RNKaoliang/Caudatum128.33106.3328.6722.0077.670.27
87XLH-1Kaoliang/Caudatum179.00153.6735.0025.33118.670.23
88Hong yin ziKaoliang247.33228.0048.3319.33179.670.21
89FeteritaUnknown215.00188.5031.8326.50156.670.17
90QKYKaoliang291.00270.6735.0020.33235.670.13
91K35-Y5*1383Complex101.3378.0021.6723.3356.330.28
92JR107Kaoliang/Caudatum120.6787.3335.5033.3351.830.41
93chf5933Kaoliang153.67121.0035.3332.6785.670.29
94SCSKaoliang138.00109.7326.8328.2782.900.24
9520131937Kaoliang221.00205.3332.2715.67173.070.16
Avg179.53154.8633.0424.68121.820.24
SD62.0065.367.015.7161.570.08
COV0.350.420.210.230.510.34
Table 3 is categorized based on the plant height genotype of the material, and the provided measurements represent the averages of three replicates. In the table, “Avg” denotes the average of the data, “SD” represents the standard deviation, and “COV” indicates the coefficient of variation. All data values have been retained up to two decimal places.
Table 4. Sorghum sterile line material diallel hybrid F1 strain height results.
Table 4. Sorghum sterile line material diallel hybrid F1 strain height results.
Male Sterile Line A/B and GenotypeA2V4BSX44BCS3541BTX623BTX3197B
(Durra)(Durra)(Durra)(Kafir/Caudatum)(Kafir)
Dw1-dw2-dw3-dw4Dw1-dw2-dw3-dw4dw1-Dw2-dw3-dw4dw1-Dw2-dw3-dw4dw1-Dw2-dw3-dw4
A2V4A (Durra)F1 genotype Dw1Dw1-dw2dw2-dw3dw3-dw4dw4Dw1dw1-Dw2dw2-dw3dw3-dw4dw4Dw1dw1-Dw2dw2-dw3dw3-dw4dw4Dw1dw1-Dw2dw2-dw3dw3-dw4dw4
Dw1-dw2-dw3-dw4Plant height (cm)126.33132.60220.11206.67181.00
Stem height (cm)101.33108.25189.33178.01147.67
Spike stalk length (cm)37.3338.5472.3352.6750.33
Spike stalk length/stem height0.370.360.380.300.34
SX44A (Durra)F1 genotypeDw1Dw1-dw2dw2-dw3dw3-dw4dw4 Dw1dw1-Dw2dw2-dw3dw3-dw4dw4Dw1dw1-Dw2dw2-dw3dw3-dw4dw4Dw1dw1-Dw2dw2-dw3dw3-dw4dw4
Dw1-dw2-dw3-dw4Plant height (cm)130.26115.12175.22177.21187.55
Stem height (cm)102.5390.21149.52151.25161.32
Spike stalk length (cm)37.2532.1450.1252.2657.35
Spike stalk length/stem height0.360.360.340.350.36
CS3541A (Durra)F1 genotypeDw1dw1-Dw2dw2-dw3dw3-dw4dw4Dw1dw1-Dw2dw2-dw3dw3-dw4dw4 dw1dw1-Dw2DW2-dw3dw3-dw4dw4dw1dw1-Dw2DW2-dw3dw3-dw4dw4
dw1-Dw2-dw3-dw4Plant height (cm)217.00177.32111.33164.33106.33
Stem height (cm)176.67150.2382.33133.0083.67
Spike stalk length (cm)67.0052.1250.6766.0143.67
Spike stalk length/stem height0.380.350.620.500.52
TX623A (Kafir/Caudatum)F1 genotypeDw1dw1-Dw2dw2-dw3dw3-dw4dw4Dw1dw1-Dw2dw2-dw3dw3-dw4dw4dw1dw1-Dw2DW2-dw3dw3-dw4dw4 dw1dw1-Dw2DW2-dw3dw3-dw4dw4
dw1-Dw2-dw3-dw4Plant height (cm)200.01182.21154.67128.12140.33
Stem height (cm)167.67150.23124.6796.01114.33
Spike stalk length (cm)54.6749.5267.6752.0040.01
Spike stalk length/stem height0.330.330.540.540.35
TX3197A (Kafir)F1 genotypeDw1dw1-Dw2dw2-dw3dw3-dw4dw4Dw1dw1-Dw2dw2-dw3dw3-dw4dw4dw1dw1-Dw2DW2-dw3dw3-dw4dw4dw1dw1-Dw2DW2-dw3dw3-dw4dw4
dw1-Dw2-dw3-dw4Plant height (cm)175.12168.41107.67143.67115.01
Stem height (cm)147.67140.1283.67115.0194.00
Spike stalk length (cm)46.3344.2140.1048.0044.00
Spike stalk length/stem height0.310.320.480.420.47
The values presented in Table 4 represent the average plant height measurements from three replicates of the hybrid F1 generation.
Table 5. Plant height genotypes in sterile and recovered lines tested in F1 generation.
Table 5. Plant height genotypes in sterile and recovered lines tested in F1 generation.
Hybridized Combination GenotypeHybridized CombinationAverage (cm)
Dw1dw1-Dw2dw2-dw3dw3-dw4dw4Hybridized combinationA2V4A × TX7078A2V4A × SX1042SX44A × TX7078SX44A × SX1042
Plant height (cm)192.33193.5172.58182.53185.24
Dw1Dw1-Dw2dw2-dw3dw3-dw4dw4Hybridized combinationA2V4A × Jing liang 5A2V4A × SXR0-30SX44A × Jing liang 5SX44A × SXR0-30
Plant height (cm)232.4220.67202.15175.21207.61
dw1dw1-Dw2Dw2-dw3dw3-dw4dw4Hybridized combinationTX623A × TX7078TX623A × SX1042TX3197A × TX7078TX3197A × SX1042
Plant height (cm)133.33135.22110127.33126.47
Dw1dw1-Dw2Dw2-dw3dw3-dw4dw4Hybridized combinationTX623A × Jing liang 5TX623A × SXR0-30TX3197A × Jing liang 5TX3197A × SXR0-30
Plant height (cm)203.67194.33195.33184194.33
Table 5 shows the mean values and genotypes of plant height measurements in F1 generation crosses. The term “average” represents the mean value of the plant height data for each respective genotype.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, Y.; Lv, N.; Yin, F.; Duan, G.; Niu, H.; Chu, J.; Yan, H.; Ju, L.; Fan, F.; Lv, X.; et al. Research on Genotype Markers for Plant Height and Assisted Breeding of Key Sorghum Resources in China. Genes 2024, 15, 83. https://doi.org/10.3390/genes15010083

AMA Style

Wang Y, Lv N, Yin F, Duan G, Niu H, Chu J, Yan H, Ju L, Fan F, Lv X, et al. Research on Genotype Markers for Plant Height and Assisted Breeding of Key Sorghum Resources in China. Genes. 2024; 15(1):83. https://doi.org/10.3390/genes15010083

Chicago/Turabian Style

Wang, Yubin, Na Lv, Feng Yin, Guoqi Duan, Hao Niu, Jianqiang Chu, Haisheng Yan, Lan Ju, Fangfang Fan, Xin Lv, and et al. 2024. "Research on Genotype Markers for Plant Height and Assisted Breeding of Key Sorghum Resources in China" Genes 15, no. 1: 83. https://doi.org/10.3390/genes15010083

APA Style

Wang, Y., Lv, N., Yin, F., Duan, G., Niu, H., Chu, J., Yan, H., Ju, L., Fan, F., Lv, X., & Ping, J. (2024). Research on Genotype Markers for Plant Height and Assisted Breeding of Key Sorghum Resources in China. Genes, 15(1), 83. https://doi.org/10.3390/genes15010083

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop