Next Article in Journal
Analysis of Soil Fungal and Bacterial Communities in Tianchi Volcano Crater, Northeast China
Next Article in Special Issue
Roles of Close Homologues SigB and SigD in Heat and High Light Acclimation of the Cyanobacterium Synechocystis sp. PCC 6803
Previous Article in Journal
Epigenetic Characteristics of Human Subtelomeres Vary in Cells Utilizing the Alternative Lengthening of Telomeres (ALT) Pathway
Previous Article in Special Issue
Fast Diffusion of the Unassembled PetC1-GFP Protein in the Cyanobacterial Thylakoid Membrane
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Life
Volume 11
Issue 4
10.3390/life11040279
life-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Slr0320 Is Crucial for Optimal Function of Photosystem II during High Light Acclimation in Synechocystis sp. PCC 6803

by
Hao Zhang
1,
Haitao Ge
2,
Ye Zhang
1,
Yingchun Wang
2 and
Pengpeng Zhang
1,*
1
Biotechnology Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, China
2
Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China
*
Author to whom correspondence should be addressed.
Life 2021, 11(4), 279; https://doi.org/10.3390/life11040279
Submission received: 3 March 2021 / Revised: 20 March 2021 / Accepted: 24 March 2021 / Published: 26 March 2021
(This article belongs to the Special Issue Cellular and Molecular Strategies in Cyanobacterial Survival, Volume II)
Browse Figures
Versions Notes

Abstract

:
Upon exposure of photosynthetic organisms to high light (HL), several HL acclimation responses are triggered. Herein, we identified a novel gene, slr0320, critical for HL acclimation in Synechocystis sp. PCC 6803. The growth rate of the Δslr0320 mutant was similar to wild type (WT) under normal light (NL) but severely declined under HL. Net photosynthesis of the mutant was lower under HL, but maximum photosystem II (PSII) activity was higher under NL and HL. Immunodetection revealed the accumulation and assembly of PSII were similar between WT and the mutant. Chlorophyll fluorescence traces showed the stable fluorescence of the mutant under light was much higher. Kinetics of single flash-induced chlorophyll fluorescence increase and decay revealed the slower electron transfer from QA to QB in the mutant. These data indicate that, in the Δslr0320 mutant, the number of functional PSIIs was comparable to WT even under HL but the electron transfer between QA and QB was inefficient. Quantitative proteomics and real-time PCR revealed that expression profiles of psbL, psbH and psbI were significantly altered in the Δslr0320 mutant. Thus, Slr0320 protein plays critical roles in optimizing PSII activity during HL acclimation and is essential for PSII electron transfer from QA to QB.

1. Introduction

Light is an essential environmental factor for all photosynthetic organisms, including higher plants, algae and cyanobacteria. Photosynthetic organisms perform photosynthesis by converting absorbed sunlight energy into chemical energy. Photosystem II (PSII), as the first enzyme of photochemistry, plays essential roles in photosynthesis. The PSII is a multi-subunit protein complex embedded in the thylakoid membrane, catalyzing water oxidation, plastoquinone reduction and oxygen release [1,2,3]. The reaction center (RC) of PSII consists of heterodimeric D1 and D2 proteins that are flanked by chlorophyll-binding proteins CP43 and CP47. Upon absorbing light, light-driven charge separation occurs between the P680 and pheophytin in the RC [4,5]. The charge-separated electron could in turn transfer to two quinone acceptors, QA and QB. The oxygen evolution complex (OEC), harboring a manganese cluster as well as PsbO, PsbU and PsbV in cyanobacteria, is located at the lumen side of PSII and catalyzes the water-splitting, releasing oxygen. In addition to the subunits mentioned above, PSII contains 13 subunits with molecular weights less than 10 kDa, known as low molecular weight (LMW) subunits (PsbE, PsbF, PsbH, PsbI, PsbJ, PsbK, PsbL, PsbM, PsbN, PsbT, PsbX, PsbY, PsbZ) in Synechocystis sp. PCC 6803 (hereafter Synechocystis). These LMW subunits are thought to play important roles in PSII biogenesis, structure, assembly and electron transfer [6,7,8].
Light is necessary for photosynthesis, but it can cause damages and become dangerous as well. Given that the light environment for photosynthetic organisms is constantly changing, the situation becomes more complicated. The D1 protein of PSII is the main target of the light-induced damages and these unavoidable damages are positively correlated to light intensities [9,10]. When the light intensities increase and the imbalance between the PSII photodamage and PSII repair occurs, the photoinhibition become apparent [11]. Synechocystis has developed several high light (HL) acclimation strategies to alleviate photoinhibition, such as the upregulation of D1 encoding genes [12,13,14], highly efficient proteolytic degradation of damaged D1 [15,16,17], elevated levels of specific carotenoids and translation elongation factors [18,19], and specific flavodirron proteins [20]. Owning to deeper investigations of Synechocystis gene functions, more and more hypothetical and known genes have been identified as being involved in the HL acclimation and protection of PSII, such as slr0151 [21] and five small CAB-like proteins (ScpA-E), of which ScpB-E are also known as high light-induced proteins (HliA-D) [22,23].
This process is not completely clear, although many efforts and some progresses have been made in discovery of novel genes involved in HL acclimation. To investigate new genes involved in HL acclimation, a random transposon-insertional mutant library of Synechocystis was screened. A novel gene, slr0320, was identified as being involved in HL acclimation and optimal function of PSII. The possible mechanism of the slr0320 involved in HL acclimation was discussed.

2. Materials and Methods

2.1. Culture Conditions

The culture conditions were set according to Zhang et al. [24]. The Synechocystis sp. PCC 6803 glucose-tolerant strain (used as wild type, WT) [25], the Δslr0320 mutant and complementary strain PpetJ::slr0320 were grown either in liquid or on solid BG-11 medium buffered with 20 mM HEPES-NaOH (pH 7.5) at 30 °C. The solid BG-11 medium was supplemented with 1.5% agar. The liquid cultures were aerated by gentle shanking at 120 rpm. The cells were illuminated under continuous white LED light (4100 K) with photon flux density of either 50 μmol photons m−2 s−1 (normal light, NL) or 220 μmol photons m−2 s−1 (high light, HL). All mutant strains were maintained in the presence of appropriate antibiotics.

2.2. Mutant Construction and Screening

The Synechocystis mutant library was constructed according to Ozaki et al. [26]. The liquid wild type cells were transformed with the transposon mutagenesis library, which contains a chloramphenicol-resistant (CmR) cassette. Following transformation, CmR mutants showing slower growth rates under HL but normal growth rates under NL on solid plates were selected. Genomic DNA extracted from selected mutants were digested by HhaI and, after self-ligation, used as templates for PCR with primers (P4) complementary to two ends of the chloramphenicol-resistant cassette (Table 1). The exact genome positions of insertions of transposons with CmR were determined by sequencing PCR products.
Due to disruptions by a frameshift, spkA (sll1574–sll1575) is considered as a neutral site in Synechocystis [27]. The complementary strain PpetJ::slr0320 was constructed according to Eisenhut et al. [28]. The wild type copy of slr0320 gene driven by a petJ promoter was integrated into the spkA site of genome in the Δslr0320 mutant.

2.3. RNA Isolation and Quantification

Total RNAs were isolated by Trizol method based on Zhang et al. [29]. After removal of genomic DNA by TURBO DNA-free Kit (Invitrogen, Carlsbad, CA, USA), the first strand cDNA was synthesized from 2.5 μg total RNA using a Revert aid First Strand cDNA Synthesis Kit (Thermo Scientific, Carlsbad, CA, USA). Quantitative Real-Time PCR (qRT-PCR) was performed on an ABI (Applied Biosystems Inc., Foster City, CA, USA) QuantStudio 6 Flex system. The primers for analysis were psbH (ssl2598), psbI (sml0001), psbM (sml0003), psbK (sml0005), psbX (sml0002), psbZ (sll1281), psbJ (smr0008), psbN (smr0009) and psbT (smr0001) transcripts, including the reference gene rnpB (slr0249), as listed in Table 1. Due to some of target genes being too short, the primers were designed to generate a similar length (~100 bp) of amplicons. The relative changes in gene expressions were calculated by the 2−ΔΔCt method [30].

2.4. Protein Isolation, Electrophoresis, and Immunodetection

The total cell extract as well as membrane and soluble fractions were isolated according to Zhang et al. [31]. Cells from liquid cultures were harvested at 5000 rpm, 4 °C for 5 min and washed with washing buffer (50 mM HEPES-NaOH pH 7.5, 30 mM CaCl2). The harvested cells were then resuspended in resuspension buffer (50 mM HEPES-NaOH pH 7.5, 30 mM CaCl2, 800 mM sorbitol and 1 mM 6-aminohexanoic acid) and broken in the presence of glass beads (150–212 μm, Sigma, St. Louis, MO, USA) by manually vortexing eight times at maximal speed for 1 min at 4 °C with 1 min cooling on ice between cycles. After removal of glass beads and cell debris at 2000× g for 5 min at 4 °C, the total cell extract was obtained. The total cell extract, which contains membrane and soluble fractions, could be further separated by centrifugation at 30,000× g for 30 min at 4 °C. After centrifugation, the membrane was pelleted down. Additionally, the soluble fraction remained in supernatant. The pelleted membrane was resuspended in storage buffer (50 m HEPES-NaOH pH 7.5, 30 mM CaCl2, 600 mM sucrose and 1 M betaine), and directly used for further analysis or frozen by liquid nitrogen in aliquots.
Protein samples were separated and immunodetected according to Zhang et al. [24]. Membrane samples for BN-PAGE (blue native-polyacrylamide gel electrophoresis) were performed as follows. The membrane samples were washed with washing buffer (50 mM Bis-Tris pH 7.0, 330 mM sorbitol) supplemented with 1 mM AEBSF (Thermo Scientific, Carlsbad, CA, USA) which is a protease inhibitor and pelleted by centrifugation at 30,000× g for 10 min at 4 °C. The pellets were then suspended in the buffer containing 25 mM Bis-Tris pH 7.0, 1 mM AEBSF, 20% glycerol (w/v) and 10 mM MgCl2 with chlorophyll concentration at 1 μg/μL. The protein samples were further solubilized by gently adding an equal volume of 3% n-dodecyl-β-D-maltoside to the same buffer, followed by 20 min incubation on ice. Insoluble material was removed by centrifugation at 30,000× g for 15 min at 4 °C. The collected supernatant was mixed with 1/10 volume sample buffer containing 5% Serva blue G (w/v), 100 mM Bis-Tris, pH 7.0, 30% sucrose (w/v), and 0.5 M 6-aminohexanoic acid and loaded onto 5 to 12.5% acrylamide gradient gel. Electrophoresis for BN-PAGE was performed at 4 °C by increasing voltage gradually from 50 up to 200 V during the 5.5 h run. Protein samples for SDS-PAGE (sodium dodecyl sulfate- polyacrylamide gel electrophoresis) were solubilized in Laemmli SDS sample buffer [32] containing 5% β-mercaptoethanol and 6 M urea at room temperature for 1h and then separated by 12% SDS-PAGE with 6 M urea.
After electrophoresis, the proteins were electrotransferred to a polyvinylidene fluoride (PVDF) membrane (Immobilon-P, Millipore, Burlington, MA, USA) by a semidry apparatus and immunodetected with specific antibodies. NdhK and NdhH antibodies were kind gifts from Weimin Ma from Shanghai Normal University and Hualing Mi from Institute of Plant Physiology and Ecology, Chinese Academy of Sciences, respectively. FNR (ferredoxin: NADP+ oxidoreductase) antibody was from Ghada Ajlani from Centre National de la Recherche. The D1, D2, CP43, CP47, PsbO, PsaA, RbcL, PetC and AtpB antibodies were purchased from Agrisera (Vennes, Sweden).

2.5. Oxygen Evolution Measurements

The steady-state oxygen evolution rate was measured by a Clark-type oxygen electrode (Hansatech) at saturating white light intensity (2500 μmol photons m−2 s−1) according to Zhang et al. [33]. The cells of WT, Δslr0320 and PpetJ::slr0320 strains grown in liquid BG-11 medium under NL and HL were harvested and resuspended in fresh BG-11 medium to chlorophyll concentration of 5 µg/mL. Net photosynthesis was measured in the presence of 10 mM NaHCO3. PSII activities were measured in the presence of 0.5 mM DCBQ (2,6-dichloro-p-benzoquinone) and 1 mM K3Fe(CN)6.

2.6. Chlorophyll Fluorescence Measurement

The chlorophyll fluorescence traces were measured by a Joliot-type spectrophotometer, Jts-10 (Biologics). Cells with chlorophyll concentration of 5 µg/mL were dark-adapted for 15 min, illuminated with either 45 μmol photons m−2 s−1 or 320 μmol photons m−2 s−1 orange actinic light (630 nm), followed by recovery in darkness. Saturating pulses (7900 μmol photons m−2 s−1, 200 ms duration) were applied to measure maximum fluorescence Fm and Fm’.
Flash-induced fluorescence increase and the subsequent decay of chlorophyll fluorescence yield were performed on a fluorometer FL 3500 (PSI Instruments) according to Zhang et al. [20]. The cells of WT, Δslr0320 and PpetJ::slr0320 strains, grown under NL and HL, were harvested and resuspended to chlorophyll concentration of 5 µg/mL. After 10 min dark adaption, cells were excited with a single, short saturation flash-light. According to Cser et al. [34], a fitting function with three components was applied:
F(t) − F0 = A1 × exp(−t/T1) + A2 × exp(−t/T2) + A3/(1 + t/T3)
Equation (1) was used for deconvolution of the measured curves, where F(t) is the variable fluorescence yield at time t, F0 is the basic fluorescence level before the flash, A1 to A3 are the amplitudes, and T1 to T3 are the time constants. The Joliot model [35] was used to correct the nonlinear correlation between fluorescence yield and the redox state of QA with a value of 0.5 for the energy transfer parameter between the PSII units [20,36].

2.7. Quantitative Proteomics Analysis

The protein preparation was performed according to Ge et al. [37]. The harvested cells were broken by a bead beater. The total cell extract was precipitation with ice-cold 10% trichloroacetic acid in acetone at −20 °C, washed with acetone, and resolubilized with 4% sodium dodecyl sulfate (SDS) in 0.1 M Tris-HCl, pH 7.6. The BCA protein assay kit (Thermo Scientific, Rockford, IL, USA) was used to determine the protein concentration. The filter-aided sample preparation (FASP) method [38] was used to digest total proteins to tryptic peptides. Briefly, DTT (dithiothreitol) (100 mm) and iodoacetamide (55 mm) were used for reduction and alkylation of the sample proteins and then the reduced proteins were transferred into the Microcon YM-30 centrifugal filter unites to exchange the denaturing buffer with triethylammonium bicarbonate (TEAB, 0.1 M) buffer. Proteins were then digested with trypsin (Promega, Madison, WI, USA) at 37 °C overnight, and the tryptic peptides were labeled with TMT reagents (Thermo Scientific, Rockford, IL, USA) by incubation at room temperature in dark for 2 h. The labeling process was stopped with 5% hydroxylamine and the equal amounts of each labeled samples were mixed together for next prefractionation with reversed phase (RP) high performance liquid chromatography (HPLC). After RP and HPLC, 4 fractions were collected and dried by a SpeedVac concentrator and stored at −20 °C for LC–MS/MS analysis. The LC–MS/MS analysis was performed using an Orbitrap Lumos mass spectrometer (Thermo Scientific, Rockford, IL Waltham, MA, USA) coupled online to an Easy-nLC 1000 in the data-dependent mode. The database search for the raw MS files was performed using the software MaxQuant (version 1.6.1, Max Planck Institute of Biochemistry, Martinsried, Germany) [39]. The Synechocystis proteome sequence database which contains 3672 entries was downloaded from CyanoBase. Bioinformatics and statistical analyses were performed using the software Perseus (version 1.5.4.1, Max Planck Institute of Biochemistry, Martinsried, Germany) [40], Origin2018 (version b9.5.1.195, OriginLab Corp., Northampton, MA, USA).

3. Results

3.1. Identification of slr0320 under High Light

To identify genes involved in high light acclimation, a Synechocystis transposon-insertion mutant library was screened by comparison of the growth under high light (HL, 220 μmol photons m−2 s−1) and normal light (NL, 50 μmol photons m−2 s−1). By screening approximately 1000 mutants, 90 mutants were identified as photosensitive. Among identified mutants, a mutant showing significantly retarded growth under HL but normal growth under NL was selected for further analysis.
PCR sequencing data showed that the transposon insertion occurred at position 709 of slr0320 (the A of the start codon ATG was set as position 1). The slr0320 gene is 1596 bp in length and consists of two conserved domains: a B12-binding domain from position 373 to 528 and a radical S-adenosyl methionine (SAM) domain from position 724 to 1209 (Figure 1a).
To confirm the phenotype of the mutant was caused by the defect in slr0320 gene, a complementary strain, PpetJ::slr0320, was constructed. The WT, Δslr0320 and PpetJ::slr0320 strains were grown on BG-11 agar plate under HL and NL. Under NL conditions, there were no apparent differences among WT, the Δslr0320 mutant and the complementary strain PpetJ::slr0320. However, under HL condition, the Δslr0320 mutant was grown much slower than WT and the PpetJ::slr0320 strain (Figure 1b). The growth phenotypes of the cells grown in liquid cultures were similar to that grown on agar plate. Under NL, growth rates of WT, Δslr0320 and the PpetJ::slr0320 strain were similar. Under HL, growth rates of WT and the PpetJ::slr0320 strain were similar and increased, but the growth rate of the Δslr0320 mutant was significantly inhibited (Student’s t test, p < 0.05) (Figure 1c).
To clarify the reason for the retarded growth rate of the Δslr0320 mutant, the steady-state oxygen evolution rates of net photosynthesis and PSII activity were monitored. When cells were grown under NL, there was no significant difference of maximal net photosynthesis among WT, Δslr0320 and PpetJ::slr0320 strains (Student’s t test, p < 0.05). However, about 23% decline in the Δslr0320 mutant was observed when cells were grown under HL. It should be noted that the net photosynthesis rate of the Δslr0320 mutant grown under HL was similar to that under NL, while the rates of WT and PpetJ::slr0320 strains were significantly increased in HL grown cells (Student’s t test, p < 0.05), from 311 to 435 μmol O2 mg−1 chlorophyll h−1 and 330 to 444 μmol O2 mg−1 chlorophyll h−1, respectively. However, when supplemented with artificial quinone acceptor 2,6-dichloro-p-benzoquinone (DCBQ), the PSII activity of the Δslr0320 mutant was even slightly higher than WT and the PpetJ::slr0320 strain under both HL and NL (Table 2).

3.2. Accumulation of Major Thylakoid Proteins and PSII Complexes in WT, Δslr0320 and PpetJ::slr0320 Strains

The lower oxygen evolution of net photosynthesis of the Δslr0320 mutant suggested some modifications of photosynthetic machinery in the mutant. Therefore, the photosynthetic protein contents on the thylakoid membrane in WT, Δslr0320 and PpetJ::slr0320 strains were analyzed. Western blots of representatives of the major thylakoid membrane protein complexes from the thylakoids isolated from WT, Δslr0320 and PpetJ::slr0320 strains grown under NL and HL revealed that the differences in amounts of the thylakoid proteins tested were tiny (fold change > 1.4 and Student’s t test p < 0.05), if any—probably a slight increase in PSII proteins and decrease in PSI in the Δslr0320 mutant under HL, a slight decline of cytochrome b6f in the Δslr0320 mutant under both NL and HL and almost unaltered NDH-1M complex (Figure 2a).
In addition to the slightly increase in PSII proteins, it is worth noting that the amount of native PSII complexes in the Δslr0320 mutant showed similar behaviors under both NL and HL. The BN-PAGE followed by immunodetection against D1 showed that the amounts of PSII dimers, monomers, and CP43-less monomer (CP47-RC), which is the PSII assembly intermediate containing the CP47 subunit, in the Δslr0320 mutant were no less than in WT both under NL and HL (Figure 2b).

3.3. Chlorophyll Fluorescence in WT, Δslr0320 and PpetJ::slr0320 Strains

To monitor photosynthetic electron transfer, chlorophyll fluorescence of WT, Δslr0320 and PpetJ::slr0320 cells grown under NL and HL was monitored. When cells were grown under NL, the dark-adapted initial fluorescence, Fo, was slightly higher in the Δslr0320 mutant. Additionally, the light-adapted fluorescence, Fs, remained higher than WT and the complementary strain PpetJ::slr0320, either illuminated with 45 or 320 µmol photons m−2 s−1 actinic light. When cells were grown under HL, the Fo of the Δslr0320 mutant was comparable to WT and the PpetJ::slr0320 strain, while the Fs became higher than WT and the PpetJ::slr0320 strain under 45 µmol photons m−2 s−1 actinic light and the difference became a little more apparent when the actinic light was increased to 320 µmol photons m−2 s−1. Under both NL and HL, the variable fluorescence Fv in the Δslr0320 mutant was higher than that of WT and the PpetJ::slr0320 strain (Figure 3a,b).
To monitor QA− reoxidation, a single flash induced an increase in chlorophyll fluorescence and the following decay was measured. The fluorescence decay consists of three components, reflecting three pathways of QA− reoxidation. The fast phase and middle phase reveal reoxidation by bounded PQ (plastoquinone) and free PQ, respectively. The slow phase is caused by charge recombination [36]. The chlorophyll fluorescence decay showed that electron transport processes at the acceptor side of PSII was modified in the Δslr0320 mutant (Figure 3c). Kinetics analysis demonstrated that apparent slower fluorescence decay in the Δslr0320 mutant than WT and the complementation strain PpetJ::slr0320 was mainly due to the decrease in the fast phase amplitude and the higher time constants of the fast phase and middle phase (Table 3). In addition, the slow phase in the Δslr0320 mutant had smaller time constant and higher amplitude than WT and the PpetJ::slr0320 strains. The phenomenon became more evident when the cells were grown under HL (Figure 3c and Table 3).

3.4. Quantitative Proteomics of WT and the Δslr0320 Mutant

To elucidate how Slr0320 operates in HL acclimation, quantitative proteomics was performed on WT and the Δslr0320 mutant grown under NL and HL. For cells grown under NL, 1988 proteins were shared by WT and the Δslr0320 mutant. When cells were grown under HL, the number of identified proteins was 1891. Combining these four samples, the number of overlapped proteins was 1785 (Figure 4a and Table S1). Hierarchical clustering analysis of the 1785 proteins using z-scored report ion intensities showed that three biological replicates of WT and the Δslr0320 mutant, each grown under NL and HL, were clustered (Figure 4b). Principal component analysis also revealed that each sample containing three biological replicates was successfully separated from others (Figure 4c). These two analyses confirmed the high reproducibility of the 1785 overlapped proteins. Grouping these proteins according to the functional categories annotated by the CyanoBase [41] showed that coverages of 1785 proteins for all functional categories were almost more than 50% except for the “other categories”, “unknow” and “hypothetical” (Figure 4d). Taken together, the high reproducibility and coverage ensured the proteome data were suitable for further analysis.
Before uncovering roles of slr0320 in HL acclimation, proteins involved in HL acclimation of Synechocystis were roughly investigated. The cutoffs of a fold change of 1.4 and p < 0.05 (Student’s t test) were applied to filter expressed proteins with significant differences and high confidence. Compared to Synechocystis grown under NL, 551 proteins were downregulated and 389 proteins were upregulated in WT grown under HL (Figure 5a and Table S2). A Fisher’s exact test was performed to enrich downregulated proteins in gene ontology (GO), KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways and the functional groups annotated by CyanoBase (Figure 5c and Table S5). The result indicated that most of photosynthesis-related proteins were enriched. The majorities of PSI and phycobilisome were downregulated. Among all identified PSI subunits, PsaC (Ssl0563), PsaF (Sll0819), PsaK (Sll0629), PsaM (Smr0005) and Ycf3 (Slr0823) were significantly downregulated. Except for CpcB (Sll1577), CpcC2 (Sll1579), ApcE (Slr0335) and ApcF (Slr1459), the identified phycobilisome subunits were significantly downregulated. Unlike PSI and phycobilisome, subunits of PSII showed different behaviors. CP43 (Sll0851), PsbE (Ssr3451), Psb27 (Slr1645) and Psb28-2 (Slr1739) were significantly downregulated, whereas PsbP (Sll1418), PsbL (Smr0007), PsbY (Sml0007), PsbV (Sll0258) and Psb28 (Sll1398) were significantly upregulated (Figure 5a). Most of these changes were similar to previous transcriptomic data of Synechocystis [12,13,14]. Likewisely, most translational behaviors of identified genes in our assay were positively correlated with those in HL-treated Synechococcus sp. PCC 7002 [42]. Furthermore, our immune-detection also confirmed selective proteins (Figure 5b). Previous reports showed that some factors involved in PSII photorepair, such as FtsH2 (Slr0228) [16], EF-Tu (Sll1099) [19], Psb28 and Psb27 [43], would increase with elevated light intensity to cope with photoinhibition. Our proteomics also identified their significant upregulations in WT grown under HL (Figure 5a). Thus, our proteomic data could be considered as highly confident. Additionally and unexpectedly, the Slr0320 was almost unaltered (Figure 5a).
The cutoffs mentioned above were applied to filter proteins of WT and the Δslr0320 mutant grown under NL and HL as well. Compared to WT under NL, 26 and 18 proteins were significantly down- and upregulated in the Δslr0320 mutant under NL, respectively (Figure 6a and Table S3). Enrichment of those significantly upregulated proteins by Fisher’s exact test revealed that Slr0320 had effects on PSII (Figure 6b and Table S6). One of the low molecular weight subunits of PSII [44], PsbL, was significantly upregulated (Figure 6a). Compared to WT under HL, there are 54 downregulated proteins and 28 upregulated proteins in the Δslr0320 mutant under HL (Figure 6a and Table S4). Intriguingly, the significantly upregulated effect on PSII in the Δslr0320 mutant grown under NL disappeared when grown under HL. For all identified PSII subunits, none was significantly differentially expressed (Figure 6a and Table S4). Likewisely, these proteomic data were further confirmed by our immune detections (Figure 5b).

3.5. Expression of Low Molecular Weight Subunits of PSII in WT, Δslr0320 and PpetJ::slr0320 Strains

Besides PsbLthat the only significantly upregulated PSII subunit in the Δslr0320 mutant was a low molecular weight (LMW) subunit, it is worth analyzing the expression of other LMW subunits. Of 13 LMW PSII subunits, our proteomic study identified four of them: PsbE, PsbF (Smr0006), PsbY (Sml0007) and PsbL. Except PsbL, the other three did not show significant changes in expression between WT and the Δslr0320 mutant (Figure 6a and Tables S3 and S4). Many attempts to separate and immuno-detect these LMW subunits by SDS-PAGE and Western blot failed, probably due to their nature of low protein mass. Therefore, transcriptional levels of the remaining nine LMW proteins detected by quantitative real-time PCR (qRT-PCR) were analyzed (Figure 7).
As shown in Figure 7, the expression patterns of psbH (ssl2598) (Figure 7a) and psbI (sml0001) (Figure 7b) in the Δslr0320 mutant were highly sensitive to HL. The transcripts of these two genes were slightly upregulated in the Δslr0320 mutant under NL, but markedly downregulated by more than five times compared to WT under HL. Compared to WT and the PpetJ::slr0320 strain grown under HL, the psbM (sml0003) (Figure 7c) and psbK (sml0005) (Figure 7f) genes in the Δslr0320 mutant grown under HL were only slightly downregulated—i.e., by less than four times. Unlike the downregulations of psbH, psbI, psbK and psbM in the Δslr0320 mutant grown under HL, the psbN (smr0009) (Figure 7d), psbJ (smr0008) (Figure 7e), psbT (smr0001) (Figure 7g), psbX (sml0002) (Figure 7h) and psbZ (sll1281) (Figure 7i) were upregulated in the Δslr0320 mutant compared to WT and PpetJ::slr0320 strains grown under HL.

4. Discussion

4.1. Slr0320 Is Crucial for Cyanobacteria during HL Acclimation

Slr0320 protein is conserved among sequenced cyanobacteria. Although Slr0320 was nonresponsive to HL in Synechocystis WT (Figure 5a), inactivation of slr0320 led to a significant defect in the photosynthetic growth under HL (Figure 1b,c). The growth difference between WT and the Δslr0320 mutant under NL was not significant (Student’s t test, p < 0.05), suggesting a more important role of Slr0320 under the HL condition. The fact that reconstitution of the slr0320 gene at a neutral site of the genome in the Δslr0320 mutant restored the growth of the insertional mutant under HL further confirmed the growth phenotype by inactivation of slr0320 (Figure 1b,c). That the net photosynthesis rate measured in the presence of bicarbonate was significantly decreased (Student’s t test, p < 0.05) in the Δslr0320 mutant grown under HL (Table 2) may explain the retarded growth. The standard condition commonly used in most laboratories for growing Synechocystis is under 50 µmol photons m−2 s−1, whereas here we used NL conditions. Elevation of light intensity moderately to a sub-saturating condition increased the growth rate of WT due to more light energy. This HL condition, however, decreased the growth rate of the Δslr0320 mutant (Figure 1b,c). These data suggest that moderately high light could not be used as additional light substrate for photosynthesis but was harmful to the cells when Slr0320 was missing. This phenomenon promoted us to figure out how Slr0320 affects photosynthesis during HL acclimation.

4.2. Slr0320 Is Involved in Optimal Function of PSII

Despite poor growth of the Δslr0320 mutant under HL (Figure 1b,c), the accumulation of major photosynthetic proteins of thylakoid membranes had little change among three strains (Figure 2a). Similar to the protein amounts, impacts of the interruption of slr0320 on the activities of PSI and the Calvin–Benson cycle may not dramatically change. The measurements of P700 oxidation-reduction detected by absorbance changes in WT and the Δslr0320 mutant showed that, illuminated by saturated far-red light (725 nm, 1400 μmol photons m−2 s−1), which solely activates PSI and in the presence of methyl viologen which accepts electrons directly from acceptor side of PSI [45], the oxidation and subsequent reduction traces of the Δslr0320 mutant were very similar to those of WT grown under NL and HL (Figure S1), indicating that the electron transfer within PSI was normal in the Δslr0320 mutant. Previous reports showed that the activity of the Calvin–Benson cycle was positively correlated to protein amounts of RuBisCo, SBPase, aldolase and transketolase in plants and Synechocystis [46,47]. Our proteomic data show that these proteins were not significantly differentially regulated in the mutant (Tables S3 and S4), suggesting the activity of the Calvin–Benson cycle in the Δslr0320 mutant could be similar to WT. In addition to the similar PSII accumulation (Figure 2a), the assembly of PSII complexes in the Δslr0320 mutant was not affected either (Figure 2b). The HL acclimation responses of Synechocystis cause efficient PSII photorepair. Previous reports revealed that this process involves FtsH proteases [48], EF-Tu, EF-G [19], Slr1051 [21], CrtO [18], Psb28 and Psb27 [43] and the efficiency of PSII photorepair under increasing light intensity is strongly associated with the amounts of these proteins. Our proteomics of WT grown under NL and HL revealed that these proteins were significantly differentially regulated under HL, further supporting that the efficient PSII photorepair is closely associated with their amounts (Figure 5a). Our proteomic data of the Δslr0320 mutant grown under NL and HL show that the amounts of these PSII photorepair related proteins were not significantly changed in the Δslr0320 mutant (Figure 6a and Tables S3 and S4), indicating the photorepair and assembly of PSII complex under HL were unlikely the major reasons for the HL phenotype of the Δslr0320 mutant. Chlorophyll fluorescence traces showed that the Δslr0320 mutant had much higher stable fluorescence Fs than that of the WT but almost normal Fo (Figure 3a,b), suggesting higher portion of closed PSII centers under light in the mutant. These data suggest a defect in electron transfer processes at the acceptor side of PSII in the Δslr0320 mutant. To confirm this, flash-induced chlorophyll fluorescence measurements were performed (Figure 3c). Illuminations of Synechocystis by a single turn over flash could result in an increase in the chlorophyll fluorescence yield simultaneously [36]. The subsequent decay of fluorescence yield in the dark reflects three electron transfer pathways of QA− reoxidation. First, the fast electron transfer from QA− to QB is accomplished by a plastoquinone molecule already bound to the QB pocket at the moment of the flash. Second, the middle phase resembles the QA− oxidized by free PQ from the PQ pool in the thylakoid membrane diffusing to the QB pocket. Third, the slow phase resembles the QA− reoxidized by the S2 state of water-oxidizing complex. The fluorescence decay was much slower in the Δslr0320 mutant, especially when the cells were grown under HL (Figure 3c and Table 3), indicating that, in the absence of Slr0320 protein, the QA− reoxidation process is slowed down. The major reasons for the slow QA− reoxidation were smaller amplitude of fast phase and bigger time constant of fast phase and middle phase. These data suggest that the acceptor side of PSII was modified in the Δslr0320 mutant. Further oxygen evolution measurements in the presence of DCBQ (Table 2) suggest that, when enough quinone acceptor was provided, the PSII in the Δslr0320 mutant were as functional as those in the WT. Therefore, we assumed that there was probably a defect in the quinone-binding of PSII due to the lack of Slr0320. Despite this, we identified effects of the interruption of slr0320 on the PSII acceptor side and the activities of PSI and the Calvin–Benson cycle were unchanged, so it would be unwise to exclude the possibility that Slr0320 still has an impact on other photosynthetic components downstream of PSII, such as cytochrome b6f. When the downstream of photosynthetic electron transport is inhibited, the PQ pool could stay reduced and thus the Fs increases [49], as shown in Figure 3a,b. The proteomics data and Western blots (Figure 5b and Figure 6a; Tables S3 and S4) showed that the expression of subunits of the cytochrome b6f complex was not altered in the Δslr0320 mutant under both NL and HL, suggesting that it may not the major reason for the obvious phenotype.
It has been reported that some low molecular weight (LMW) subunits of PSII may affect assembly and quinone-binding [6,8]. Indeed, one of those LMW subunits, PsbL, was found to be significantly upregulated in the Δslr0320 mutant from our proteomic data (Figure 6a and Table S3). Previous reports have demonstrated that PsbL is a key factor for stabilization of PSII complexes and, by potential indirect interaction with D1 protein, influences PSII structure and the QA activity [43,49,50]. A detailed investigation on tobacco PsbL revealed that additional PsbL protein could optimize the binding of plastoquinone with the PSII complex and subsequent electron transfer in vitro [50]. Given that PsbL is highly conserved between Synechocystis and plants [8], the role of PsbL could be similar in Synechocystis. The enhanced expression of PsbL in the Δslr0320 mutant under NL may function in optimizing the binding of PQ to PSII and further partially restore the PSII electron transfer. This could be the reason that the impaired electron transfer from QA to QB in the Δslr0320 mutant was less evident under NL than HL (Figure 3c and Table 3). Among 13 LMW subunits of Synechocystis, PsbE, PsbF, PsbL and PsbY were also detected but no significant difference was shown between WT and the Δslr0320 mutant by proteomic analysis under HL (Figure 6a and Tables S3 and S4). Due to failure in the proteomic identification and difficulties in protein-level detection, we applied qRT-PCR to examine the expression of remaining nine LMW subunits. The data showed that psbH and psbI were downregulated by more than five times and could possibly have effects on their protein levels in the Δslr0320 mutant under HL (Figure 7). Though psbM and psbK were downregulated as well, we thought their transcriptional downregulations might be minor. Due to the retarded photoautotrophic growth rates, highly sensitive to high light and slower electron transfer within PSII in psbH and psbI inactivation mutants, these two genes were considered to regulate electron transfer from QA to QB [51,52,53,54,55,56]. Furthermore, multiple reports of the crystal structure of PSII suggested that these two genes products were highly related to the acceptor-side structure within PSII [1,2,3]. Therefore, we thought that the much more evident impaired electron transfer from QA to QB caused by the interruption of slr0320 under HL was possibly due to decreases in psbH and psbI.
The B12-binding and the radical SAM domains of Slr0320 resemble the class B radical SAM methyltransferases. Previous reports have demonstrated that the radical SAM methyltransferases use SAM and other cofactors, such as B12 (cobalamin), to catalyze methylations. Members of the radical SAM methyltransferases were more than 113,000 and identified to methylate a wide variety of natural products, playing very important roles [57,58,59,60]. RlmE from various microorganisms, such as Escherichia coli [61,62] and Saccharomyces cerevisiae [63,64], and RlmN from Escherichia coli [65] revealed that the radical SAM methyltransferases were responsible for tRNA methylation and the subsequent ribosome assembly. The Fom3 from Streptomyces wedmorensis was identified to catalyze methylations in the biosynthesis of antibiotic fosfomycin [66]. In addition to the substrates mentioned above, many reports have shown that some members of this superfamily from various microorganisms, such as MenA and MenG from Escherichia coli and Streptomyces coelicolor, MenK from Adlercreutzia equolifaciens, Collinsella tanakaei and Ferrimonas marina, were involved in the methylation of menaquinone and composition of the PQ pool, and this adenosylmethionine-dependent methylation had important roles on the biosynthesis and function of quinone [67,68,69,70]. Considering that the impaired electron transfer from QA to QB (Figure 3c) might be due to the poor binding of PQ to PSII in the Δslr0320 mutant, it cannot be excluded that the Slr0320 is a member of the radical SAM methyltransferases, catalyzing the methylation of quinone, and the interruption of slr0320 may result in defects of methylation of quinone, affecting its binding to PSII and impairing electron transfer between QA and QB. Yet, more proofs still need to be discovered.
Combining all the data above, a conclusion is made. Other than PSII photorepair and assembly, Slr0320 is involved in the electron transfer within PSII during HL acclimation of Synechocystis. The interruption of slr0320 leads to an impaired electron transfer from QA to QB within PSII. This impaired electron transfer could be partially restored by upregulation of PsbL under NL, possibly enhancing the binding of plastoquinone and consequently maintaining the mutant to grow similar to WT. However, the impaired electron transfer was further inhibited under HL, probably due to downregulations of psbH and psbI and defects in the structure of the acceptor side. Based on the conserved domains, there is a hint that Slr0320 might be involved in methylation of plastoquinone, further affecting the binding to PSII, and electron transfer from QA to QB cannot be excluded; more proofs are needed.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/life11040279/s1, Figure S1: P700 oxidation-reduction in WT and the Δslr0320 mutant grown under NL and HL; Figure S2: The mutant segregation by genomic PCR; Table S1: Reported ion intensities of quantitative proteomics; Table S2: Names of significantly differential expressed proteins involved in HL acclimation of Synechocystis; Table S3: Names of significantly differential expressed proteins of WT and Δslr0320 grown under NL; Table S4: Names of significantly differential expressed proteins of WT and Δslr0320 grown under HL; Table S5: All Fisher’s exact test results of significantly differential expressed proteins involved in HL acclimation of Synechocystis; Table S6: All Fisher’s exact test results of significantly differential expressed proteins of WT and Δslr0320 grown under NL.

Author Contributions

P.Z. designed and supervised this work; P.Z. and Y.W. designed the quantitative proteomics which were performed by H.G.; H.Z. and H.G. analyzed the quantitative proteomics; H.Z. performed other experiments with some assistances of Y.Z.; H.Z. and P.Z. analyzed the data and wrote the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Elite Youth program of Chinese Academy of Agricultural Sciences.

Data Availability Statement

The reported ion intensities of quantitative proteomics presented in this study are available in Table S1.

Acknowledgments

We are grateful to Chinese Academy of Agricultural Sciences for the financial support by Elite Youth program of Chinese Academy of Agricultural Sciences. We thank Weimin Ma from Shanghai Normal University for NdhK antibody, Hualing Mi from Institute of Plant Physiology and Ecology, Chinese Academy of Sciences, for NdhH antibody and Ghada Ajlani from Centre National de la Recherche for FNR antibody.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

References

  1. Shen, J. The Structure of Photosystem II and the Mechanism of Water Oxidation in Photosynthesis. Annu. Rev. Plant Biol. 2015, 66, 23–48. [Google Scholar] [CrossRef] [Green Version]
  2. Umena, Y.; Kawakami, K.; Shen, J.-R.; Kamiya, N. Crystal structure of oxygen-evolving photosystem II at a resolution of 1.9 Å. Nature 2011, 473, 55–60. [Google Scholar] [CrossRef]
  3. Ferreira, K.N.; Iverson, T.M.; Maghlaoui, K.; Barber, J.; Iwata, S. Architecture of the photosynthetic oxygen-evolving center. Science 2004, 303, 1831–1838. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Cardona, T.; Sedoud, A.; Cox, N.; Rutherford, A.W. Charge separation in Photosystem II: A comparative and evolutionary overview. Biochim. Biophys. Acta Bioenerg. 2012, 1817, 26–43. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Vass, I.; Cser, K.; Cheregi, O. Molecular mechanisms of light stress of photosynthesis. Ann. N. Y. Acad. Sci. 2007, 1113, 114–122. [Google Scholar] [CrossRef] [PubMed]
  6. Shi, L.; Hall, M.; Funk, C.; Schröder, W.P. Photosystem II, a growing complex: Updates on newly discovered components and low molecular mass proteins. Biochim. Biophys. Acta Bioenerg. 2012, 1817, 13–25. [Google Scholar] [CrossRef] [Green Version]
  7. Muramatsu, M.; Hihara, Y. Acclimation to high-light conditions in cyanobacteria: From gene expression to physiological responses. J. Plant. Res. 2012, 125, 11–39. [Google Scholar] [CrossRef] [PubMed]
  8. Shi, L.; Schröder, W.P. The low molecular mass subunits of the photosynthetic supracomplex, photosystem II. Biochim. Biophys. Acta Bioenerg. 2004, 1608, 75–96. [Google Scholar] [CrossRef] [Green Version]
  9. Tyystjärvi, E.; Aro, E.-M. The rate constant of photoinhibition, measured in lincomycin-treated leaves, is directly proportional to light intensity. Proc. Natl. Acad. Sci. USA 1996, 93, 2213–2218. [Google Scholar] [CrossRef] [Green Version]
  10. Aro, E.-M.; Virgin, I.; Andersson, B. Photoinhibition of Photosystem II. Inactivation, protein damage and turnover. Biochim. Biophys. Acta Bioenerg. 1993, 1143, 113–134. [Google Scholar] [CrossRef]
  11. Vass, I. Molecular mechanisms of photodamage in the Photosystem II complex. Biochim. Biophys. Acta Bioenerg. 2012, 1817, 209–217. [Google Scholar] [CrossRef] [Green Version]
  12. Ogawa, K.; Yoshikawa, K.; Matsuda, F.; Toya, Y.; Shimizu, H. Transcriptome analysis of the cyanobacterium Synechocystis sp. PCC 6803 and mechanisms of photoinhibition tolerance under extreme high light conditions. J. Biosci. Bioeng. 2018, 126, 596–602. [Google Scholar] [CrossRef]
  13. Singh, A.K.; Elvitigala, T.; Bhattacharyya-Pakrasi, M.; Aurora, R.; Ghosh, B.; Pakrasi, H.B. Integration of carbon and nitrogen metabolism with energy production is crucial to light acclimation in the cyanobacterium Synechocystis. Plant Physiol. 2008, 148, 467–478. [Google Scholar] [CrossRef] [Green Version]
  14. Hihara, Y.; Kamei, A.; Kanehisa, M.; Kaplan, A.; Ikeuchi, M. DNA microarray analysis of cyanobacterial gene expression during acclimation to high light. Plant Cell 2001, 13, 793–806. [Google Scholar] [CrossRef] [Green Version]
  15. Komenda, J.; Tichý, M.; Prášil, O.; Knoppová, J.; Kuviková, S.; de Vries, R.; Nixon, P.J. The exposed N-terminal tail of the D1 subunit is required for rapid D1 degradation during photosystem II repair in Synechocystis sp. PCC 6803. Plant Cell 2007, 19, 2839–2854. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Komenda, J.; Barker, M.; Kuvikova, S.; de Vries, R.; Mullineaux, C.W.; Tichý, M.; Nixon, P.J. The FtsH protease Slr0228 is important for quality control of photosystem II in the thylakoid membrane of Synechocystis sp. PCC 6803. J. Biol. Chem. 2006, 281, 1145–1151. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  17. Silva, P.; Thompson, E.; Bailey, S.; Kruse, O.; Mullineaux, C.W.; Robinson, C.; Mann, N.H.; Nixon, P.J. FtsH is involved in the early stages of repair of photosystem II in Synechocystis sp PCC 6803. Plant Cell 2003, 15, 2152. [Google Scholar] [CrossRef] [Green Version]
  18. Izuhara, T.; Kaihatsu, I.; Jimbo, H.; Takaichi, S.; Nishiyama, Y. Elevated levels of specific carotenoids during acclimation to strong light protect the repair of photosystem II in Synechocystis sp. PCC 6803. Front. Plant Sci. 2020, 11, 1030. [Google Scholar] [CrossRef] [PubMed]
  19. Jimbo, H.; Izuhara, T.; Hihara, Y.; Hisabori, T.; Nishiyama, Y. Light-inducible expression of translation factor EF-Tu during acclimation to strong light enhances the repair of photosystem II. Proc. Natl. Acad. Sci. USA 2019, 116, 21268–21273. [Google Scholar] [CrossRef] [Green Version]
  20. Zhang, P.; Eisenhut, M.; Brandt, A.-M.; Carmel, D.; Silén, H.M.; Vass, I.; Allahverdiyeva, Y.; Salminen, T.A.; Aro, E.-M. Operon flv4-flv2 provides cyanobacterial photosystem II with flexibility of electron transfer. Plant. Cell 2012, 24, 1952–1971. [Google Scholar] [CrossRef] [Green Version]
  21. Yang, H.; Liao, L.; Bo, T.; Zhao, L.; Sun, X.; Lu, X.; Norling, B.; Huang, F. Slr0151 in Synechocystis sp. PCC 6803 is required for efficient repair of photosystem II under high-light condition. J. Integr. Plant Biol. 2014, 56, 1136–1150. [Google Scholar] [CrossRef] [PubMed]
  22. Hernandez-Prieto, M.A.; Tibiletti, T.; Abasova, L.; Kirilovsky, D.; Vass, I.; Funk, C. The small CAB-like proteins of the cyanobacterium Synechocystis sp. PCC 6803: Their involvement in chlorophyll biogenesis for Photosystem II. Biochim. Biophys. Acta Bioenerg. 2011, 1807, 1143–1151. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. He, Q.; Dolganov, N.; Björkman, O.; Grossman, A.R. The high light-inducible polypeptides in Synechocystis PCC6803. Expression and function in high light. J. Biol. Chem. 2001, 276, 306–314. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Zhang, P.; Battchikova, N.; Jansen, T.; Appel, J.; Ogawa, T.; Aro, E.-M. Expression and functional roles of the two distinct NDH-1 complexes and the carbon acquisition complex NdhD3/NdhF3/CupA/Sll1735 in Synechocystis sp PCC 6803. Plant Cell 2004, 16, 3326–3340. [Google Scholar] [CrossRef] [Green Version]
  25. Williams, J.G.K. Construction of specific mutations in photosystem II photosynthetic reaction center by genetic engineering methods in Synechocystis 6803. In Cyanobacteria; Academic Press: Cambridge, MA, USA, 1988; Volume 167, pp. 766–778. [Google Scholar]
  26. Ozaki, H.; Ikeuchi, M.; Ogawa, T.; Fukuzawa, H.; Sonoike, K. Large-scale analysis of chlorophyll fluorescence kinetics in Synechocystis sp. PCC 6803: Identification of the factors involved in the modulation of photosystem stoichiometry. Plant Cell Physiol. 2007, 48, 451–458. [Google Scholar] [CrossRef] [Green Version]
  27. Kamei, A.; Yuasa, T.; Orikawa, K.; Geng, X.X.; Ikeuchi, M. A eukaryotic-type protein kinase, SpkA, is required for normal motility of the unicellular cyanobacterium Synechocystis sp. strain PCC 6803. J. Bacteriol. 2001, 183, 1505–1510. [Google Scholar] [CrossRef] [Green Version]
  28. Eisenhut, M.; Georg, J.; Klähn, S.; Sakurai, I.; Mustila, H.; Zhang, P.; Hess, W.R.; Aro, E.-M. The antisense RNA As1_flv4 in the Cyanobacterium Synechocystis sp. PCC 6803 prevents premature expression of the flv4-2 operon upon shift in inorganic carbon supply. J. Biol. Chem. 2012, 287, 33153–33162. [Google Scholar] [CrossRef] [Green Version]
  29. Zhang, P.; Sicora, C.I.; Vorontsova, N.; Allahverdiyeva, Y.; Battchikova, N.; Nixon, P.J.; Aro, E.-M. FtsH protease is required for induction of inorganic carbon acquisition complexes in Synechocystis sp. PCC 6803. Mol. Microbiol. 2007, 65, 728–740. [Google Scholar] [CrossRef]
  30. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  31. Zhang, P.; Allahverdiyeva, Y.; Eisenhut, M.; Aro, E.-M. Flavodiiron proteins in oxygenic photosynthetic organisms: Photoprotection of photosystem II by Flv2 and Flv4 in Synechocystis sp. PCC 6803. PLoS ONE 2009, 4, e5331. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  32. Laemmli, U.K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970, 227, 680–685. [Google Scholar] [CrossRef] [PubMed]
  33. Zhang, P.; Frankel, L.K.; Bricker, T.M. Integration of apo-α-phycocyanin into phycobilisomes and its association with FNRL in the absence of the phycocyanin α-subunit lyase (CpcF) in Synechocystis sp. PCC 6803. PLoS ONE 2014, 9, e105952. [Google Scholar] [CrossRef] [Green Version]
  34. Cser, K.; Deak, Z.; Telfer, A.; Barber, J.; Vass, I. Energetics of photosystem II charge recombination in Acaryochloris marina studied by thermoluminescence and flash-induced chlorophyll fluorescence measurements. Photosynth. Res. 2008, 98, 131–140. [Google Scholar] [CrossRef]
  35. Joliot, A.; Joliot, P. Etude cinétique de la réaction photochimique libérant l’oxygéne au cours de la photosynthése. C. R. Acad. Sci. 1964, 258, 4622–4625. [Google Scholar]
  36. Vass, I.; Kirilovsky, D.; Etienne, A.-L. UV-B radiation-induced donor- and acceptor-side modifications of photosystem II in the cyanobacterium Synechocystis sp. PCC 6803. Biochemistry 1999, 38, 12786–12794. [Google Scholar] [CrossRef] [PubMed]
  37. Ge, H.; Fang, L.; Huang, X.; Wang, J.; Chen, W.; Liu, Y.; Zhang, Y.; Wang, X.; Xu, W.; He, Q.; et al. Translating divergent environmental stresses into a common proteome response through the Histidine Kinase 33 (Hik33) in a model cyanobacterium. Mol. Cell. Proteom. 2017, 16, 1258–1274. [Google Scholar] [CrossRef] [Green Version]
  38. Wiśniewski, J.R.; Zougman, A.; Mann, M. Combination of FASP and StageTip-based fractionation allows in-depth analysis of the hippocampal membrane proteome. J. Proteome Res. 2009, 8, 5674–5678. [Google Scholar] [CrossRef] [PubMed]
  39. Cox, J.; Mann, M. MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nat. Biotechnol. 2008, 26, 1367–1372. [Google Scholar] [CrossRef]
  40. Cox, J.; Mann, M. 1D and 2D annotation enrichment: A statistical method integrating quantitative proteomics with complementary high-throughput data. BMC Bioinform. 2012, 13, S12. [Google Scholar] [CrossRef] [Green Version]
  41. Xiong, Q.; Feng, J.; Li, S.; Zhang, G.; Qiao, Z.; Chen, Z.; Wu, Y.; Lin, Y.; Li, T.; Ge, F.; et al. Integrated transcriptomic and proteomic analysis of the global response of Synechococcus to high light stress. Mol. Cell. Proteom. 2015, 14, 1038–1053. [Google Scholar] [CrossRef] [Green Version]
  42. Bečková, M.; Gardian, Z.; Yu, J.; Konik, P.; Nixon, P.J.; Komenda, J. Association of Psb28 and Psb27 proteins with PSII-PSI supercomplexes upon exposure of Synechocystis sp. PCC 6803 to high light. Mol. Plant 2017, 10, 62–72. [Google Scholar] [CrossRef] [Green Version]
  43. Luo, H.; Jackson, S.A.; Fagerlund, R.; Summerfield, T.C.; Eaton-Rye, J.J. The importance of the hydrophilic region of PsbL for the plastoquinone electron acceptor complex of Photosystem II. Biochim. Biophys. Acta Bioenerg. 2014, 1837, 1435–1446. [Google Scholar] [CrossRef] [Green Version]
  44. Bernát, G.; Appel, J.; Ogawa, T.; Rögner, M. Distinct roles of multiple NDH-1 complexes in the cyanobacterial electron transport network as revealed by kinetic analysis of P700+ reduction in various ndh-deficient mutants of Synechocystis sp. strain PCC6803. J. Bacteriol. 2011, 193, 292–295. [Google Scholar] [CrossRef] [Green Version]
  45. Liang, F.; Lindblad, P. Effects of overexpressing photosynthetic carbon flux control enzymes in the cyanobacterium Synechocystis PCC 6803. Metab. Eng. 2016, 38, 56–64. [Google Scholar] [CrossRef] [PubMed]
  46. Raines, C.A. The Calvin cycle revisited. Photosynth. Res. 2003, 75, 1–10. [Google Scholar] [CrossRef]
  47. Nixon, P.J.; Barker, M.; Boehm, M.; de Vries, R.; Komenda, J. FtsH-mediated repair of the photosystem II complex in response to light stress. J. Exp. Bot. 2004, 56, 357–363. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  48. Shimakawa, G.; Shaku, K.; Nishi, A.; Hayashi, R.; Yamamoto, H.; Sakamoto, K.; Makino, A.; Miyake, C. FLAVODIIRON2 and FLAVODIIRON4 proteins mediate an oxygen-dependent alternative electron flow in Synechocystis sp. PCC 6803 under CO2-limited conditions. Plant Physiol. 2015, 167, 472–480. [Google Scholar] [CrossRef] [Green Version]
  49. Luo, H.; Eaton-Rye, J.J. Directed mutagenesis of the transmembrane domain of the PsbL subunit of photosystem II in Synechocystis sp. PCC 6803. Photosynth. Res. 2008, 98, 337–347. [Google Scholar] [CrossRef] [PubMed]
  50. Anbudurai, P.R.; Pakrasi, H. Mutational analysis of the PsbL protein of photosystem II in the cyanobacterium Synechocystis sp. PCC 6803. Z. Naturforschung C 1993, 48, 267–274. [Google Scholar] [CrossRef]
  51. Ozawa, S.; Kobayashi, T.; Sugiyama, R.; Hoshida, H.; Shiina, T.; Toyoshima, Y. Role of PSII-L protein (psbL gene product) on the electron transfer in photosystem II complex. 1. Over-production of wild-type and mutant versions of PSII-L protein and reconstitution into the PSII core complex. Plant Mol. Biol. 1997, 34, 151–161. [Google Scholar] [CrossRef] [PubMed]
  52. Dobáková, M.; Tichý, M.; Komenda, J. Role of the PsbI protein in photosystem II assembly and repair in the cyanobacterium Synechocystis sp. PCC 6803. Plant Physiol. 2007, 145, 1681. [Google Scholar] [CrossRef] [Green Version]
  53. Schwenkert, S.; Umate, P.; Bosco, C.D.; Volz, S.; Mlçochová, L.; Zoryan, M.; Eichacker, L.A.; Ohad, I.; Herrmann, R.G.; Meurer, J. PsbI affects the stability, function, and phosphorylation patterns of photosystem II assemblies in tobacco. J. Biol. Chem. 2006, 281, 34227–34238. [Google Scholar] [CrossRef] [Green Version]
  54. Gómez, S.M.; Nishio, J.N.; Faull, K.F.; Whitelegge, J.P. The chloroplast grana proteome defined by intact mass measurements from liquid chromatography mass spectrometry. Mol. Cell. Proteom. 2002, 1, 46–59. [Google Scholar] [CrossRef] [Green Version]
  55. Komenda, J.; Barber, J. Comparison of psbO and psbH deletion mutants of Synechocystis PCC 6803 indicates that degradation of D1 protein is regulated by the QB site and dependent on protein synthesis. Biochemistry 1995, 34, 9625–9631. [Google Scholar] [CrossRef]
  56. Ikeuchi, M.; Shukla, V.K.; Pakrasi, H.B.; Inoue, Y. Directed inactivation of the psbl gene does not affect photosystem II in the cyanobacterium Synechocystis sp. PCC 6803. Mol. Gen. Genet. 1995, 249, 622–628. [Google Scholar] [CrossRef]
  57. Mayes, S.R.; Dubbs, J.M.; Vass, I.; Hideg, E.; Nagy, L.; Barber, J. Further characterization of the psbH locus of Synechocystis sp. PCC 6803: Inactivation of psbH impairs QA to QB electron transport in photosystem 2. Biochemistry 1993, 32, 1454–1465. [Google Scholar] [CrossRef]
  58. Zhou, S.; Alkhalaf, L.M.; de los Santos, E.L.C.; Challis, G.L. Mechanistic insights into class B radical-S-adenosylmethionine methylases: Ubiquitous tailoring enzymes in natural product biosynthesis. Curr. Opin. Chem. Biol. 2016, 35, 73–79. [Google Scholar] [CrossRef]
  59. Bauerle, M.R.; Schwalm, E.L.; Booker, S.J. Mechanistic diversity of Radical S-Adenosylmethionine (SAM)-dependent methylation. J. Biol. Chem. 2015, 290, 3995–4002. [Google Scholar] [CrossRef] [Green Version]
  60. Zhang, Q.; van der Donk, W.A.; Liu, W. Radical-mediated enzymatic methylation: A tale of two SAMS. Acc. Chem. Res. 2012, 45, 555–564. [Google Scholar] [CrossRef]
  61. Sofia, H.; Chen, G.; Hetzler, B.G.; Reyes-Spindola, J.F.; Miller, N.E. Radical SAM, a novel protein superfamily linking unresolved steps in familiar biosynthetic pathways with radical mechanisms: Functional characterization using new analysis and information visualization methods. Nucleic Acids Res. 2001, 29, 1097–1106. [Google Scholar] [CrossRef] [Green Version]
  62. Ishiguro, K.; Arai, T.; Suzuki, T. Depletion of S-adenosylmethionine impacts on ribosome biogenesis through hypomodification of a single rRNA methylation. Nucleic Acids Res. 2019, 47, 4226–4239. [Google Scholar] [CrossRef]
  63. Stojkovic, V.; Fujimori, D.G. Radical SAM-Mediated Methylation of Ribosomal RNA. Methods Enzymol. 2015, 560, 355–376. [Google Scholar] [CrossRef] [Green Version]
  64. Lapeyre, B.; Purushothaman, S.K. Spb1p-directed formation of Gm2922 in the ribosome catalytic center occurs at a late processing stage. Mol. Cell 2004, 16, 663–669. [Google Scholar] [CrossRef]
  65. Pintard, L.; Bujnicki, J.M.; Lapeyre, B.; Bonnerot, C. MRM2 encodes a novel yeast mitochondrial 21S rRNA methyltransferase. EMBO J. 2002, 21, 1139–1147. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  66. Benítez-Páez, A.; Villarroya, M.; Armengod, M.E. The Escherichia coli RlmN methyltransferase is a dual-specificity enzyme that modifies both rRNA and tRNA and controls translational accuracy. RNA 2012, 18, 1783–1795. [Google Scholar] [CrossRef] [Green Version]
  67. Allen, K.D.; Wang, S.C. Initial characterization of Fom3 from Streptomyces wedmorensis: The methyltransferase in fosfomycin biosynthesis. Arch. Biochem. Biophys. 2014, 543, 67–73. [Google Scholar] [CrossRef] [Green Version]
  68. Wilkens, D.; Meusinger, R.; Hein, S.; Simon, J. Sequence analysis and specificity of distinct types of menaquinone methyltransferases indicate the widespread potential of methylmenaquinone production in bacteria and archaea. Environ. Microbiol. 2020. [Google Scholar] [CrossRef]
  69. Hein, S.; von Irmer, J.; Gallei, M.; Meusinger, R.; Simon, J. Two dedicated class C radical S-adenosylmethionine methyltransferases concertedly catalyse the synthesis of 7,8-dimethylmenaquinone. Biochim. Biophys. Acta Bioenerg. 2018, 1859, 300–308. [Google Scholar] [CrossRef]
  70. Hiratsuka, T.; Furihata, K.; Ishikawa, J.; Yamashita, H.; Itoh, N.; Seto, H.; Dairi, T. An alternative menaquinone biosynthetic pathway operating in microorganisms. Science 2008, 321, 1670. [Google Scholar] [CrossRef]
Life 11 00279 g001 550
Figure 1. Gene structure of slr0320 and growth of wild type (WT), Δslr0320 and PpetJ::slr0320 strains. (a) Organization of slr0320 in Synechocystis. The insertion position of a transposon including a chloramphenicol-resistant cassette (CmR, green) flanked by two insertion sequences (Tn, orange) is indicated; two conserved domains of slr0320 were indicated under the slr0320 coding region (red); (b) growth of WT, Δslr0320 and PpetJ::slr0320 strains on agar plates under normal light (NL) and high light (HL). The cells grown under NL were harvested and resuspended in fresh BG-11 medium. Then, they were diluted to 0.5, 0.05, 0.005 at OD750 and 10 μL liquid cells were placed on the agar plate. The pictures were taken after 6 days; (c) growth curves of WT, Δslr0320 and PpetJ::slr0320 strains in liquid medium under NL and HL. The initial OD750 was 0.05. Student’s t test was applied. Red asterisks mark significant differences for the Δslr0320 mutant vs. WT and PpetJ::slr0320 strains, with a significance level of p < 0.05. The results are plotted as the means from three independent experiments ± SD.
Figure 1. Gene structure of slr0320 and growth of wild type (WT), Δslr0320 and PpetJ::slr0320 strains. (a) Organization of slr0320 in Synechocystis. The insertion position of a transposon including a chloramphenicol-resistant cassette (CmR, green) flanked by two insertion sequences (Tn, orange) is indicated; two conserved domains of slr0320 were indicated under the slr0320 coding region (red); (b) growth of WT, Δslr0320 and PpetJ::slr0320 strains on agar plates under normal light (NL) and high light (HL). The cells grown under NL were harvested and resuspended in fresh BG-11 medium. Then, they were diluted to 0.5, 0.05, 0.005 at OD750 and 10 μL liquid cells were placed on the agar plate. The pictures were taken after 6 days; (c) growth curves of WT, Δslr0320 and PpetJ::slr0320 strains in liquid medium under NL and HL. The initial OD750 was 0.05. Student’s t test was applied. Red asterisks mark significant differences for the Δslr0320 mutant vs. WT and PpetJ::slr0320 strains, with a significance level of p < 0.05. The results are plotted as the means from three independent experiments ± SD.
Life 11 00279 g001
Life 11 00279 g002 550
Figure 2. Major thylakoid proteins under NL and HL. (a) Thylakoid membrane proteins (5 μg) were separated by SDS-PAGE and immuno-detected by specific antibodies against D1, CP43, PsaA, PetC, NdhH, NdhK and AtpB. The gray scale levels of bands from immunoblots were semiquantified. The protein levels semiquantified by band density below were normalized with AtpB and each WT under NL was set as 1; (b) photosystem II (PSII) complexes from thylakoid membrane fraction were separated by BN-PAGE and immunoblotted with D1 protein specific antibody.
Figure 2. Major thylakoid proteins under NL and HL. (a) Thylakoid membrane proteins (5 μg) were separated by SDS-PAGE and immuno-detected by specific antibodies against D1, CP43, PsaA, PetC, NdhH, NdhK and AtpB. The gray scale levels of bands from immunoblots were semiquantified. The protein levels semiquantified by band density below were normalized with AtpB and each WT under NL was set as 1; (b) photosystem II (PSII) complexes from thylakoid membrane fraction were separated by BN-PAGE and immunoblotted with D1 protein specific antibody.
Life 11 00279 g002
Life 11 00279 g003a 550Life 11 00279 g003b 550
Figure 3. Chlorophyll fluorescence of WT, Δslr0320 and PpetJ::slr0320 strains. (a) Chlorophyll fluorescence traces of the cells grown under NL during dark and light adaptations; (b) Chlorophyll fluorescence traces of the cells grown under HL during dark and light adaptations; (c) single flash-induced chlorophyll fluorescence curves. The results are plotted as the means from three independent experiments ± SD.
Figure 3. Chlorophyll fluorescence of WT, Δslr0320 and PpetJ::slr0320 strains. (a) Chlorophyll fluorescence traces of the cells grown under NL during dark and light adaptations; (b) Chlorophyll fluorescence traces of the cells grown under HL during dark and light adaptations; (c) single flash-induced chlorophyll fluorescence curves. The results are plotted as the means from three independent experiments ± SD.
Life 11 00279 g003aLife 11 00279 g003b
Life 11 00279 g004 550
Figure 4. Overview of quantitative identification of proteomes of WT and the Δslr0320 mutant. (a) Venn diagram showing overlapped proteins. Cells grown under NL are indicated as WT-NL and Δslr0320-NL; cells grown under HL are indicated as WT-HL and Δslr0320-HL; (b) hierarchy clustering analysis and heatmap of z-scored report ion intensities. The extents of differential expression are color-coded and shown by the scale bar on the bottom of heatmap. Each sample contained three biological replicates indicated as R1, R2 and R3; (c) principal component analysis of all samples. Black dots are WT grown under HL; green dots are WT grown under NL; red dots are Δslr0320 cells grown under HL and blues dots are Δslr0320 cells grown under NL; (d) bar graph showing the coverage of protein identification for all functional categories annotated by the CyanoBase. The numbers to the right of bars are indicated as protein numbers identified in this report/protein numbers in CyanoBase.
Figure 4. Overview of quantitative identification of proteomes of WT and the Δslr0320 mutant. (a) Venn diagram showing overlapped proteins. Cells grown under NL are indicated as WT-NL and Δslr0320-NL; cells grown under HL are indicated as WT-HL and Δslr0320-HL; (b) hierarchy clustering analysis and heatmap of z-scored report ion intensities. The extents of differential expression are color-coded and shown by the scale bar on the bottom of heatmap. Each sample contained three biological replicates indicated as R1, R2 and R3; (c) principal component analysis of all samples. Black dots are WT grown under HL; green dots are WT grown under NL; red dots are Δslr0320 cells grown under HL and blues dots are Δslr0320 cells grown under NL; (d) bar graph showing the coverage of protein identification for all functional categories annotated by the CyanoBase. The numbers to the right of bars are indicated as protein numbers identified in this report/protein numbers in CyanoBase.
Life 11 00279 g004
Life 11 00279 g005 550
Figure 5. Expressions of proteins in Synechocystis WT cells grown under NL and HL. (a) Volcano plots showing differentially expressed proteins in Synechocystis WT cells grown under NL and HL; (b) confirmation of proteome by Western blots of selected proteins. The immunodetections against D1, D2, CP43, CP47, PsbO, PsaA, FNR, RbcL, PetC, NdhH, NdhK and AtpB are on the left panel; the visualization of the whole cell lysate by silver-staining is shown by the right panel; (c) bubble plot showing enrichment of significantly downregulated proteins by Fisher’s exact test. The bubble size indicates the number in each term; bubble color indicates the p value as shown in the scale bar above the plot.
Figure 5. Expressions of proteins in Synechocystis WT cells grown under NL and HL. (a) Volcano plots showing differentially expressed proteins in Synechocystis WT cells grown under NL and HL; (b) confirmation of proteome by Western blots of selected proteins. The immunodetections against D1, D2, CP43, CP47, PsbO, PsaA, FNR, RbcL, PetC, NdhH, NdhK and AtpB are on the left panel; the visualization of the whole cell lysate by silver-staining is shown by the right panel; (c) bubble plot showing enrichment of significantly downregulated proteins by Fisher’s exact test. The bubble size indicates the number in each term; bubble color indicates the p value as shown in the scale bar above the plot.
Life 11 00279 g005
Life 11 00279 g006 550
Figure 6. Expressions of proteins in WT and the Δslr0320 mutant grown under NL and HL. (a) Volcano plots showing differentially expressed proteins in WT and the Δslr0320 mutant grown under NL and HL; (b) bubble plot showing enrichment of significantly upregulated proteins in the Δslr0320 mutant grown under NL by fisher’s exact test. The bubble size indicates the number in each term; bubble color indicates the p value as shown in the scale bar above the plot.
Figure 6. Expressions of proteins in WT and the Δslr0320 mutant grown under NL and HL. (a) Volcano plots showing differentially expressed proteins in WT and the Δslr0320 mutant grown under NL and HL; (b) bubble plot showing enrichment of significantly upregulated proteins in the Δslr0320 mutant grown under NL by fisher’s exact test. The bubble size indicates the number in each term; bubble color indicates the p value as shown in the scale bar above the plot.
Life 11 00279 g006
Life 11 00279 g007 550
Figure 7. Transcript accumulation of genes encoding 9 low molecular weight (LMW) subunits of PSII in WT and the Δslr0320 mutant. (a) transcription accumulation of psbH in WT and the Δslr0320 mutant grown under NL and HL; (b) transcription accumulation of psbI in WT and the Δslr0320 mutant grown under NL and HL; (c) transcription accumulation of psbM in WT and the Δslr0320 mutant grown under NL and HL; (d) transcription accumulation of psbN in WT and the Δslr0320 mutant grown under NL and HL; (e) transcription accumulation of psbJ in WT and the Δslr0320 mutant grown under NL and HL; (f) transcription accumulation of psbK in WT and the Δslr0320 mutant grown under NL and HL; (g) transcription accumulation of psbT in WT and the Δslr0320 mutant grown under NL and HL; (h) transcription accumulation of psbX in WT and the Δslr0320 mutant grown under NL and HL; (i) transcription accumulation of psbZ in WT and the Δslr0320 mutant grown under NL and HL. The abundances of the transcripts were calculated relative to the reference gene rnpB. The transcripts of WT grown under NL were set as 1. The transcripts of WT grown under HL and mutant grown both under HL and NL were calculated relative to the WT grown under NL. Numbers above bars indicate the mean of relative transcription levels. The results are shown as the means from three independent experiments ± SD.
Figure 7. Transcript accumulation of genes encoding 9 low molecular weight (LMW) subunits of PSII in WT and the Δslr0320 mutant. (a) transcription accumulation of psbH in WT and the Δslr0320 mutant grown under NL and HL; (b) transcription accumulation of psbI in WT and the Δslr0320 mutant grown under NL and HL; (c) transcription accumulation of psbM in WT and the Δslr0320 mutant grown under NL and HL; (d) transcription accumulation of psbN in WT and the Δslr0320 mutant grown under NL and HL; (e) transcription accumulation of psbJ in WT and the Δslr0320 mutant grown under NL and HL; (f) transcription accumulation of psbK in WT and the Δslr0320 mutant grown under NL and HL; (g) transcription accumulation of psbT in WT and the Δslr0320 mutant grown under NL and HL; (h) transcription accumulation of psbX in WT and the Δslr0320 mutant grown under NL and HL; (i) transcription accumulation of psbZ in WT and the Δslr0320 mutant grown under NL and HL. The abundances of the transcripts were calculated relative to the reference gene rnpB. The transcripts of WT grown under NL were set as 1. The transcripts of WT grown under HL and mutant grown both under HL and NL were calculated relative to the WT grown under NL. Numbers above bars indicate the mean of relative transcription levels. The results are shown as the means from three independent experiments ± SD.
Life 11 00279 g007
Table
Table 1. Primers used in this assay.
Table 1. Primers used in this assay.
Forward Sequence (5′–3′)Reverse Sequence (5′–3′)
P4CGACGGGCAATTTGCACTTCAGCGTATTAGCTTACGACGCTACACCC
psbH (ssl2598)GATATCCTCAGACCCCTCAACCAGAAAAAGAGCCATAAATACCC
psbI (sml0001)CCCTTAAAATCGCCGTTTCAAAGTCTTTGCGGCCAG
psbM (sml0003)ACAATCTCGGCTTTATAGCAAGCCCGGTTTGAATAAACAGGATC
psbK (sml0005)GGAAACAATTTATTTGCTCGCAAAAGAAGAGGGGAATGACCG
psbX (sml0002)TGACCCCTTCTTTAGCAAACTCTGATGAAAATTAACCCGACG
psbZ (sll1281)TCAGCGACTGTCGAGGATGCCAACGCAATCTGAAAA
psbJ (smr0008)ATGTTCGCAGAAGGCAGAATCACCAGCATAGGCTCCGTAGAA
psbN (smr0009)TCCGCAACAGTTCTTAGCATGTCATCGAAGGGATCACCCA
psbT (smr0001)ATGGAAAGTGTTGCTTACATTCTGCTATTTTTCGATGCGGGGG
rnpB (slr0249)TTTAGAAAACAGCAACCAGTGGCAGGAAAAAGACCAACCT
Table
Table 2. Steady-state oxygen evolution of WT, Δslr0320 and PpetJ::slr0320 strains grown under NL and HL in the presence of NaHCO3 and DCBQ.
Table 2. Steady-state oxygen evolution of WT, Δslr0320 and PpetJ::slr0320 strains grown under NL and HL in the presence of NaHCO3 and DCBQ.
Strains and Growth ConditionsOxygen Evolution
(μmol O2 mg−1 Chlorophyll h−1)
H2O to CO2
(NaHCO3)		H2O to Quinone
(DCBQ)
Normal light
WT311 ± 8467 ± 16
Δslr0320358 ± 12512 ± 13
PpetJ::slr0320330 ± 13478 ± 17
High light
WT435 ± 14a538 ± 12
Δslr0320335 ± 16607 ± 15
PpetJ::slr0320444 ± 10b508 ± 9
Student’s t test was applied. The superscript “a” marks significant differences for WT grown under HL vs. grown under NL in the presence of NaHCO3; the superscript “b” marks significant differences for the complementary PpetJ::slr0320 grown under HL vs. grown under NL in the presence of NaHCO3, both with a significance level of p < 0.05 The results are shown as the means from three independent experiments ± SD.
Table
Table 3. Kinetics of the flash-induced chlorophyll fluorescence of WT, Δslr0320 and PpetJ::slr0320 strains under NL and HL.
Table 3. Kinetics of the flash-induced chlorophyll fluorescence of WT, Δslr0320 and PpetJ::slr0320 strains under NL and HL.
Strains and Growth ConditionsFast PhaseMiddle PhaseSlow Phase
T1 (ms)A1 (%)T2 (ms)A2 (%)T3 (s)A3 (%)
Normal light
WT619.65 ± 21.7060 ± 1.05.8 ± 0.6223 ± 0.96.1 ± 1.118 ± 1.1
Δslr0320880.02 ± 22.0151 ± 1.513.1 ± 0.7727 ± 0.44.0 ± 0.523 ± 1.3
PpetJ::slr0320624.24 ± 24.6260 ± 1.97.5 ± 0.9621 ± 1.05.0 ± 0.619 ± 1.3
High light
WT709.52 ± 62.4953 ± 2.96.0 ± 1.3325.83 ± 2.04.4 ± 0.221 ± 2.4
Δslr03201366.25 ± 131.5825 ± 3.615.9 ± 2.0934.82 ± 0.61.9 ± 0.340 ± 3.2
PpetJ::slr0320779.81 ± 60.9054 ± 2.58.6 ± 1.4722.36 ± 2.34.2 ± 0.423 ± 1.8
The results are shown as the means from three independent experiments ± SD.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Zhang, H.; Ge, H.; Zhang, Y.; Wang, Y.; Zhang, P. Slr0320 Is Crucial for Optimal Function of Photosystem II during High Light Acclimation in Synechocystis sp. PCC 6803. Life 2021, 11, 279. https://doi.org/10.3390/life11040279

AMA Style

Zhang H, Ge H, Zhang Y, Wang Y, Zhang P. Slr0320 Is Crucial for Optimal Function of Photosystem II during High Light Acclimation in Synechocystis sp. PCC 6803. Life. 2021; 11(4):279. https://doi.org/10.3390/life11040279

Chicago/Turabian Style

Zhang, Hao, Haitao Ge, Ye Zhang, Yingchun Wang, and Pengpeng Zhang. 2021. "Slr0320 Is Crucial for Optimal Function of Photosystem II during High Light Acclimation in Synechocystis sp. PCC 6803" Life 11, no. 4: 279. https://doi.org/10.3390/life11040279

APA Style

Zhang, H., Ge, H., Zhang, Y., Wang, Y., & Zhang, P. (2021). Slr0320 Is Crucial for Optimal Function of Photosystem II during High Light Acclimation in Synechocystis sp. PCC 6803. Life, 11(4), 279. https://doi.org/10.3390/life11040279

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop