Piceatannol Upregulates SIRT1 Expression in Skeletal Muscle Cells and in Human Whole Blood: In Vitro Assay and a Randomized, Double-Blind, Placebo-Controlled, Parallel-Group Comparison Trial
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture and Sample Preparation
2.2. RNA Isolation, cDNA Synthesis, and Quantitative Real-time PCR
2.3. Western Blotting for Quantification of SIRT1 Protein
2.4. Quantification of Mitochondrial DNA
2.5. Detection of Fatty Acid Accumulation
2.6. Clinical Trial Design
2.7. Participants
2.8. Test Food
2.9. Experimental Protocol
2.10. Measurement of SIRT1 mRNA Levels from Blood Samples
2.11. Statistical analysis
3. Results
3.1. PIC Upregulated the mRNA and Protein Expression of Sirt1
3.2. PIC Enhanced Mitochondrial Biogenesis and Boosted Antioxidant Marker Expression
3.3. PIC Upregulated the Expression of Genes Involved in Fatty Acid Utilization and Suppressed Fatty Acid Accumulation
3.4. PIC Upregulated SIRT1 Expression in Human Whole Blood
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- WHO. Healthy Life Expectancy (HALE) at Birth. Available online: https://www.who.int/data/gho/indicator-metadata-registry/imr-details/66 (accessed on 15 March 2024).
- WHO. Life expectancy and Healthy life expectancy—Data by country. Glob. Heal. Obs. 2020. Available online: https://www.who.int/data/gho (accessed on 15 March 2024).
- Schmeisser, K.; Mansfeld, J.; Kuhlow, D.; Weimer, S.; Priebe, S.; Heiland, I.; Birringer, M.; Groth, M.; Segref, A.; Kanfi, Y.; et al. Role of sirtuins in lifespan regulation is linked to methylation of nicotinamide. Nat. Chem. Biol. 2013, 9, 693–700. [Google Scholar] [CrossRef] [PubMed]
- Michan, S.; Sinclair, D. Sirtuins in mammals: Insights into their biological function. Biochem. J. 2007, 404, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Cohen, H.Y.; Miller, C.; Bitterman, K.J.; Wall, N.R.; Hekking, B.; Kessler, B.; Howitz, K.T.; Gorospe, M.; de Cabo, R.; Sinclair, D.A. Calorie restriction promotes mammalian cell survival by inducing the SIRT1 deacetylase. Science 2004, 305, 390–392. [Google Scholar] [CrossRef] [PubMed]
- Chang, H.C.; Guarente, L. SIRT1 and other sirtuins in metabolism. Trends Endocrinol. Metab. 2014, 25, 138–145. [Google Scholar] [CrossRef] [PubMed]
- Lin, S.J.; Defossez, P.A.; Guarente, L. Requirement of NAD and SIR2 for life-span extension by calorie restriction in Saccharomyces cerevisiae. Science 2000, 289, 2126–2128. [Google Scholar] [CrossRef] [PubMed]
- Rogina, B.; Helfand, S.L. Sir2 mediates longevity in the fly through a pathway related to calorie restriction. Proc. Natl. Acad. Sci. USA 2004, 101, 15998–16003. [Google Scholar] [CrossRef] [PubMed]
- Tissenbaum, H.A.; Guarente, L. Increased dosage of a sir-2 gene extends lifespan in Caenorhabditis elegans. Nature 2001, 410, 227–230. [Google Scholar] [CrossRef] [PubMed]
- Satoh, A.; Brace, C.S.; Rensing, N.; Cliften, P.; Wozniak, D.F.; Herzog, E.D.; Yamada, K.A.; Imai, S. Sirt1 extends life span and delays aging in mice through the regulation of Nk2 homeobox 1 in the DMH and LH. Cell Metab. 2013, 18, 416–430. [Google Scholar] [CrossRef] [PubMed]
- Minor, R.K.; Baur, J.A.; Gomes, A.P.; Ward, T.M.; Csiszar, A.; Mercken, E.M.; Abdelmohsen, K.; Shin, Y.K.; Canto, C.; Scheibye-Knudsen, M.; et al. SRT1720 improves survival and healthspan of obese mice. Sci. Rep. 2011, 1, 70. [Google Scholar] [CrossRef]
- Satoh, A.; Stein, L.; Imai, S. The role of mammalian sirtuins in the regulation of metabolism, aging, and longevity. Handb. Exp. Pharmacol. 2011, 206, 125–162. [Google Scholar] [CrossRef]
- Rodgers, J.T.; Lerin, C.; Haas, W.; Gygi, S.P.; Spiegelman, B.M.; Puigserver, P. Nutrient control of glucose homeostasis through a complex of PGC-1alpha and SIRT1. Nature 2005, 434, 113–118. [Google Scholar] [CrossRef] [PubMed]
- Picard, F.; Kurtev, M.; Chung, N.; Topark-Ngarm, A.; Senawong, T.; Machado De Oliveira, R.; Leid, M.; McBurney, M.W.; Guarente, L. Sirt1 promotes fat mobilization in white adipocytes by repressing PPAR-gamma. Nature 2004, 429, 771–776. [Google Scholar] [CrossRef] [PubMed]
- Bordone, L.; Motta, M.C.; Picard, F.; Robinson, A.; Jhala, U.S.; Apfeld, J.; McDonagh, T.; Lemieux, M.; McBurney, M.; Szilvasi, A.; et al. Sirt1 regulates insulin secretion by repressing UCP2 in pancreatic beta cells. PLoS Biol. 2006, 4, e31. [Google Scholar] [CrossRef] [PubMed]
- Moynihan, K.A.; Grimm, A.A.; Plueger, M.M.; Bernal-Mizrachi, E.; Ford, E.; Cras-Méneur, C.; Permutt, M.A.; Imai, S. Increased dosage of mammalian Sir2 in pancreatic beta cells enhances glucose-stimulated insulin secretion in mice. Cell Metab. 2005, 2, 105–117. [Google Scholar] [CrossRef] [PubMed]
- Sun, C.; Zhang, F.; Ge, X.; Yan, T.; Chen, X.; Shi, X.; Zhai, Q. SIRT1 improves insulin sensitivity under insulin-resistant conditions by repressing PTP1B. Cell Metab. 2007, 6, 307–319. [Google Scholar] [CrossRef] [PubMed]
- Cao, Y.; Jiang, X.; Ma, H.; Wang, Y.; Xue, P.; Liu, Y. SIRT1 and insulin resistance. J. Diabetes Complications 2016, 30, 178–183. [Google Scholar] [CrossRef] [PubMed]
- Hegedűs, C.; Muresan, M.; Badale, A.; Bombicz, M.; Varga, B.; Szilágyi, A.; Sinka, D.; Bácskay, I.; Popoviciu, M.; Magyar, I.; et al. SIRT1 activation by equisetum arvense L. (Horsetail) modulates insulin sensitivity in streptozotocin induced diabetic rats. Molecules 2020, 25, 2541. [Google Scholar] [CrossRef] [PubMed]
- Pedersen, S.B.; Ølholm, J.; Paulsen, S.K.; Bennetzen, M.F.; Richelsen, B. Low Sirt1 expression, which is upregulated by fasting, in human adipose tissue from obese women. Int. J. Obes. 2008, 32, 1250–1255. [Google Scholar] [CrossRef] [PubMed]
- de Kreutzenberg, S.V.; Ceolotto, G.; Papparella, I.; Bortoluzzi, A.; Semplicini, A.; Dalla Man, C.; Cobelli, C.; Fadini, G.P.; Avogaro, A. Downregulation of the longevity-associated protein sirtuin 1 in insulin resistance and metabolic syndrome: Potential biochemical mechanisms. Diabetes 2010, 59, 1006–1015. [Google Scholar] [CrossRef]
- Houtkooper, R.H.; Pirinen, E.; Auwerx, J. Sirtuins as regulators of metabolism and healthspan. Nat. Rev. Mol. Cell Biol. 2012, 13, 225–238. [Google Scholar] [CrossRef]
- Baur, J.A.; Ungvari, Z.; Minor, R.K.; Le Couteur, D.G.; de Cabo, R. Are sirtuins viable targets for improving healthspan and lifespan? Nat. Rev. Drug Discov. 2012, 11, 443–461. [Google Scholar] [CrossRef] [PubMed]
- Yoshino, M.; Yoshino, J.; Kayser, B.D.; Patti, G.J.; Franczyk, M.P.; Mills, K.F.; Sindelar, M.; Pietka, T.; Patterson, B.W.; Imai, S.I.; et al. Nicotinamide mononucleotide increases muscle insulin sensitivity in prediabetic women. Science 2021, 372, 1224–1229. [Google Scholar] [CrossRef] [PubMed]
- Pardo, P.S.; Boriek, A.M. The physiological roles of Sirt1 in skeletal muscle. Aging 2011, 3, 430–437. [Google Scholar] [CrossRef] [PubMed]
- Williams, C.B.; Gurd, B.J. Skeletal muscle SIRT1 and the genetics of metabolic health: Therapeutic activation by pharmaceuticals and exercise. Appl. Clin. Genet 2012, 5, 81–91. [Google Scholar] [CrossRef] [PubMed]
- Tonkin, J.; Villarroya, F.; Puri, P.L.; Vinciguerra, M. SIRT1 signaling as potential modulator of skeletal muscle diseases. Curr. Opin. Pharmacol. 2012, 12, 372–376. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.H.; Ma, X.J.; Wu, L.N.; Zhao, Y.Y.; Zhang, P.Y.; Zhang, Y.H.; Shao, M.W.; Liu, F.; Li, F.; Qin, G.J. SIRT1 attenuates high glucose-induced insulin resistance via reducing mitochondrial dysfunction in skeletal muscle cells. Exp. Biol. Med. 2015, 240, 557–565. [Google Scholar] [CrossRef] [PubMed]
- Feige, J.N.; Lagouge, M.; Canto, C.; Strehle, A.; Houten, S.M.; Milne, J.C.; Lambert, P.D.; Mataki, C.; Elliott, P.J.; Auwerx, J. Specific SIRT1 activation mimics low energy levels and protects against diet-induced metabolic disorders by enhancing fat oxidation. Cell Metab. 2008, 8, 347–358. [Google Scholar] [CrossRef] [PubMed]
- Matsui, Y.; Sugiyama, K.; Kamei, M.; Takahashi, T.; Suzuki, T.; Katagata, Y.; Ito, T. Extract of passion fruit (Passiflora edulis) seed containing high amounts of piceatannol inhibits melanogenesis and promotes collagen synthesis. J. Agric. Food Chem. 2010, 58, 11112–11118. [Google Scholar] [CrossRef] [PubMed]
- Kawakami, S.; Morinaga, M.; Tsukamoto-Sen, S.; Mori, S.; Matsui, Y.; Kawama, T. Constituent characteristics and functional properties of passion fruit seed extract. Life 2021, 12, 38. [Google Scholar] [CrossRef]
- Nonaka, S.; Kawakami, S.; Maruki-Uchida, H.; Mori, S.; Morita, M. Piceatannol markedly upregulates heme oxygenase-1 expression and alleviates oxidative stress in skeletal muscle cells. Biochem. Biophys. Rep. 2019, 18, 100643. [Google Scholar] [CrossRef]
- Ashikawa, K.; Majumdar, S.; Banerjee, S.; Bharti, A.C.; Shishodia, S.; Aggarwal, B.B. Piceatannol inhibits TNF-induced NF-kappaB activation and NF-kappaB-mediated gene expression through suppression of IkappaBalpha kinase and p65 phosphorylation. J. Immunol. 2002, 169, 6490–6497. [Google Scholar] [CrossRef] [PubMed]
- Park, I.S.; Han, Y.; Jo, H.; Lee, K.W.; Song, Y.S. Piceatannol is superior to resveratrol at suppressing adipogenesis in human visceral adipose-derived stem cells. Plants 2021, 10, 366. [Google Scholar] [CrossRef] [PubMed]
- Sie, Y.Y.; Chen, L.C.; Li, C.W.; Wang, C.C.; Li, C.J.; Liu, D.Z.; Lee, M.H.; Chen, L.G.; Hou, W.C. Extracts and scirpusin B from recycled seeds and rinds of passion fruits (Passiflora edulis var. Tainung No. 1) exhibit improved functions in scopolamine-induced impaired-memory ICR mice. Antioxidants 2023, 12, 2058. [Google Scholar] [CrossRef]
- Yamamoto, M.S.Y.; Mori, S.; Morita, M.; Yano, S.; Maeda, K. Effects of oral intake of piceatannol on skin moisture—A randamized, double-blind, placebo-controlled parallel-group, comparison study. Jpn. Pharmacol. Ther. 2018, 46, 1191–1199. [Google Scholar]
- Yoshihara, M.; Kawakami, S.; Mori, S.; Nishimura, E.; Matsui, Y.; Yano, S. Effects of oral intake of piceatannol on skin viscoelastiicity -A randomized, double-blind, placebo-controlled, parallel-group comparison study. Jpn. Pharmacol. Ther. 2023, 51, 1187–1193. [Google Scholar]
- Tanzil, A.; Kawakami, S.; Mori, S.; Morita, M.; Yano, S. Effects of oral intake of piceatannol on fat burning―A randomized, double—Blind, placebo—Controlled crossover comparison study. Jpn. Pharmacol. Ther. 2020, 48, 1235–1240. [Google Scholar]
- Matsui, N.; Maruki-Uchida, H.; Yamamoto, T.; Ito, R.; Ebihara, S.; Morita, M. Effects of oral intake of piceatannol on fat burning during moderate-intensity exercise ―A randomized, double—Blind, placebo—Controlled crossover comparison study. Jpn. Pharmacol. Ther. 2021, 49, 731–738. [Google Scholar]
- Minakawa, M.; Miura, Y.; Yagasaki, K. Piceatannol, a resveratrol derivative, promotes glucose uptake through glucose transporter 4 translocation to plasma membrane in L6 myocytes and suppresses blood glucose levels in type 2 diabetic model db/db mice. Biochem. Biophys. Res. Commun. 2012, 422, 469–475. [Google Scholar] [CrossRef] [PubMed]
- Burns, J.; Yokota, T.; Ashihara, H.; Lean, M.E.; Crozier, A. Plant foods and herbal sources of resveratrol. J. Agric. Food Chem. 2002, 50, 3337–3340. [Google Scholar] [CrossRef]
- Rimando, A.M.; Kalt, W.; Magee, J.B.; Dewey, J.; Ballington, J.R. Resveratrol, pterostilbene, and piceatannol in vaccinium berries. J. Agric. Food Chem. 2004, 52, 4713–4719. [Google Scholar] [CrossRef]
- Hurst, W.J.; Glinski, J.A.; Miller, K.B.; Apgar, J.; Davey, M.H.; Stuart, D.A. Survey of the trans-resveratrol and trans-piceid content of cocoa-containing and chocolate products. J. Agric. Food Chem. 2008, 56, 8374–8378. [Google Scholar] [CrossRef]
- Baur, J.A.; Pearson, K.J.; Price, N.L.; Jamieson, H.A.; Lerin, C.; Kalra, A.; Prabhu, V.V.; Allard, J.S.; Lopez-Lluch, G.; Lewis, K.; et al. Resveratrol improves health and survival of mice on a high-calorie diet. Nature 2006, 444, 337–342. [Google Scholar] [CrossRef] [PubMed]
- Hoseini, A.; Namazi, G.; Farrokhian, A.; Reiner, Ž.; Aghadavod, E.; Bahmani, F.; Asemi, Z. The effects of resveratrol on metabolic status in patients with type 2 diabetes mellitus and coronary heart disease. Food Funct. 2019, 10, 6042–6051. [Google Scholar] [CrossRef] [PubMed]
- Piotrowska, H.; Kucinska, M.; Murias, M. Biological activity of piceatannol: Leaving the shadow of resveratrol. Mutat. Res. 2012, 750, 60–82. [Google Scholar] [CrossRef]
- Kawakami, S.; Kinoshita, Y.; Maruki-Uchida, H.; Yanae, K.; Sai, M.; Ito, T. Piceatannol and its metabolite, isorhapontigenin, induce SIRT1 expression in THP-1 human monocytic cell line. Nutrients 2014, 6, 4794–4804. [Google Scholar] [CrossRef] [PubMed]
- Gerhart-Hines, Z.; Rodgers, J.T.; Bare, O.; Lerin, C.; Kim, S.H.; Mostoslavsky, R.; Alt, F.W.; Wu, Z.; Puigserver, P. Metabolic control of muscle mitochondrial function and fatty acid oxidation through SIRT1/PGC-1alpha. EMBO J. 2007, 26, 1913–1923. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.J.; Kang, M.G.; Cha, H.Y.; Kim, Y.M.; Lim, Y.; Yang, S.J. Effects of piceatannol and resveratrol on sirtuins and hepatic inflammation in high-fat diet-fed mice. J. Med. Food 2019, 22, 833–840. [Google Scholar] [CrossRef]
- Wang, K.J.; Zhang, W.Q.; Liu, J.J.; Cui, Y.; Cui, J.Z. Piceatannol protects against cerebral ischemia/reperfusion-induced apoptosis and oxidative stress via the Sirt1/FoxO1 signaling pathway. Mol. Med. Rep. 2020, 22, 5399–5411. [Google Scholar] [CrossRef] [PubMed]
- Lin, J.; Handschin, C.; Spiegelman, B.M. Metabolic control through the PGC-1 family of transcription coactivators. Cell Metab. 2005, 1, 361–370. [Google Scholar] [CrossRef]
- Finck, B.N.; Kelly, D.P. PGC-1 coactivators: Inducible regulators of energy metabolism in health and disease. J. Clin. Investig. 2006, 116, 615–622. [Google Scholar] [CrossRef]
- Purushotham, A.; Schug, T.T.; Xu, Q.; Surapureddi, S.; Guo, X.; Li, X. Hepatocyte-specific deletion of SIRT1 alters fatty acid metabolism and results in hepatic steatosis and inflammation. Cell Metab. 2009, 9, 327–338. [Google Scholar] [CrossRef]
- Hosoda, R.; Hamada, H.; Uesugi, D.; Iwahara, N.; Nojima, I.; Horio, Y.; Kuno, A. Different antioxidative and antiapoptotic effects of piceatannol and resveratrol. J. Pharmacol. Exp. Ther. 2021, 376, 385–396. [Google Scholar] [CrossRef] [PubMed]
- Tsvetkov, P.; Adler, J.; Strobelt, R.; Adamovich, Y.; Asher, G.; Reuven, N.; Shaul, Y. NQO1 binds and supports SIRT1 function. Front. Pharmacol. 2021, 12, 671929. [Google Scholar] [CrossRef] [PubMed]
- Setoguchi, Y.; Oritani, Y.; Ito, R.; Inagaki, H.; Maruki-Uchida, H.; Ichiyanagi, T.; Ito, T. Absorption and metabolism of piceatannol in rats. J. Agric. Food Chem. 2014, 62, 2541–2548. [Google Scholar] [CrossRef]
- Rivas-Chacón, L.D.M.; Yanes-Díaz, J.; de Lucas, B.; Riestra-Ayora, J.I.; Madrid-García, R.; Sanz-Fernández, R.; Sánchez-Rodríguez, C. Cocoa Polyphenol Extract Inhibits Cellular Senescence via Modulation of SIRT1 and SIRT3 in Auditory Cells. Nutrients 2023, 15, 544. [Google Scholar] [CrossRef] [PubMed]
- Peng, J.; Yang, Z.; Li, H.; Hao, B.; Cui, D.; Shang, R.; Lv, Y.; Liu, Y.; Pu, W.; Zhang, H.; et al. Quercetin Reprograms Immunometabolism of Macrophages via the SIRT1/PGC-1α Signaling Pathway to Ameliorate Lipopolysaccharide-Induced Oxidative Damage. Int. J. Mol. Sci. 2023, 24, 5542. [Google Scholar] [CrossRef]
- Pfluger, P.T.; Herranz, D.; Velasco-Miguel, S.; Serrano, M.; Tschöp, M.H. Sirt1 protects against high-fat diet-induced metabolic damage. Proc. Natl. Acad. Sci. USA 2008, 105, 9793–9798. [Google Scholar] [CrossRef]
- Kitada, M.; Kume, S.; Takeda-Watanabe, A.; Tsuda, S.; Kanasaki, K.; Koya, D. Calorie restriction in overweight males ameliorates obesity-related metabolic alterations and cellular adaptations through anti-aging effects, possibly including AMPK and SIRT1 activation. Biochim. Biophys. Acta 2013, 1830, 4820–4827. [Google Scholar] [CrossRef] [PubMed]
- Matsushima, K.; Mori, S.; Setoguchi, Y.; Morinaga, M.; Inagaki, H.; Matsui, Y.; Kawama, T.; Ebihara, S. Comparative study on absorption of piceatannol by taking Passion Fruit Seed Extract and Passion Fruit. Jpn. Pharmacol. Ther. 2021, 49, 2149–2154. [Google Scholar]
- Stefanowicz, M.; Nikołajuk, A.; Matulewicz, N.; Karczewska-Kupczewska, M. Adipose tissue, but not skeletal muscle, sirtuin 1 expression is decreased in obesity and related to insulin sensitivity. Endocrine 2018, 60, 263–271. [Google Scholar] [CrossRef]
- Gong, H.; Pang, J.; Han, Y.; Dai, Y.; Dai, D.; Cai, J.; Zhang, T.M. Age-dependent tissue expression patterns of Sirt1 in senescence-accelerated mice. Mol. Med. Rep. 2014, 10, 3296–3302. [Google Scholar] [CrossRef] [PubMed]
- Sasaki, Y.; Ikeda, Y.; Miyauchi, T.; Uchikado, Y.; Akasaki, Y.; Ohishi, M. Estrogen-SIRT1 axis plays a pivotal role in protecting arteries against menopause-induced senescence and atherosclerosis. J. Atheroscler. Thromb. 2020, 27, 47–59. [Google Scholar] [CrossRef] [PubMed]
- Karolczak, K.; Watala, C. Estradiol as the trigger of sirtuin-1-dependent cell signaling with a potential utility in anti-aging therapies. Int. J. Mol. Sci. 2023, 24, 13753. [Google Scholar] [CrossRef] [PubMed]
- Arisawa, K.; Matsuoka, A.; Ozawa, N.; Ishikawa, T.; Ichi, I.; Fujiwara, Y. GPER/PKA-dependent enhancement of hormone-sensitive lipase phosphorylation in 3T3-L1 adipocytes by piceatannol. Nutrients 2023, 16, 38. [Google Scholar] [CrossRef] [PubMed]
- Jakubowicz, D.; Wainstein, J.; Landau, Z.; Raz, I.; Ahren, B.; Chapnik, N.; Ganz, T.; Menaged, M.; Barnea, M.; Bar-Dayan, Y.; et al. Influences of breakfast on clock gene expression and postprandial glycemia in healthy individuals and individuals with diabetes: A randomized clinical trial. Diabetes Care 2017, 40, 1573–1579. [Google Scholar] [CrossRef] [PubMed]
- Tasselli, L.; Zheng, W.; Chua, K.F. SIRT6: Novel Mechanisms and Links to Aging and Disease. Trends Endocrinol. Metab. 2017, 28, 168–185. [Google Scholar] [CrossRef]
- Lee, N.; Kim, D.K.; Kim, E.S.; Park, S.J.; Kwon, J.H.; Shin, J.; Park, S.M.; Moon, Y.H.; Wang, H.J.; Gho, Y.S.; et al. Comparative interactomes of SIRT6 and SIRT7: Implication of functional links to aging. Proteomics 2014, 14, 1610–1622. [Google Scholar] [CrossRef]
Gene | Forward Sequence (5′-3′) | Reverse Sequence (5′-3′) |
---|---|---|
Gapdh | TCCAGTATGACTCCACTC | ATTTCTCGTGGTTCACAC |
Sirt1 | TCGTGGAGACATTTTTAATCAGG | GCTTCATGATGGCAAGTGG |
Ho-1 | AGGCTAAGACCGCCTTCCT | TGTGTTCCTCTGTCAGCATCA |
Nqo-1 | AGAGAGTGCTCGTAGCAGGAT | GTGGTGATAGAAAGCAAGGTCTT |
Pdk4 | CACATGCTCTTCGAACTCTTCAAG | TGATTGTAAGGTCTTCTTTTCCCAAG |
Fat/cd36 | GATGACGTGGCAAAGAACAG | TCCTCGGGGTCCTGAGTTAT |
Sirt3 | GCCTGCAAGGTTCCTACTCC | TCGAGGACTCAGAACGAACG |
Idh3α | AGGACTGATTGGAGGTCTTGG | ATCACAGCACTAAGCAGGAGG |
Tfam | CACCCAGATGCAAAACTTTCAG | CTGCTCTTTATACTTGCTCACAG |
Nrf1 | CCACGTTGGATGAGTACACG | CTGAGCCTGGGTCATTTTGT |
Tfb2 | TTTTGGCAAGTGGCCTGTGA | CCCCGTGCTTTTGACTTTTCTA |
Esrrα | AAGACAGCAGCCCCACTGAA | ACACCCAGCCCAGCACCT |
Gene | Forward Sequence (5′-3′) | Reverse Sequence (5′-3′) |
---|---|---|
Genome DNA (LPL) | GGATGGACGGTAAGAGTGATTC | ATCCAAGGGTAGCAGACAGGT |
Mitochondrial Gene (NDH-I) | CCCATTCGCGTTATTCTT | AAGTTGATCGTAACGGAAGC |
Test Food | Placebo Food | |
---|---|---|
Protein (g) | 0 | 0 |
Fat (g) | 0 | 0 |
Carbohydrate (g) | 39 | 36 |
NaCl (g) | 1.2 | 1.1 |
Piceatannol (mg) | 100 | 0 |
Gene | Forward Sequence (5′-3′) | Reverse Sequence (5′-3′) | Probe (5′-3′) |
---|---|---|---|
GAPDH | CCATCTTCCAGGAGCGAGAT | GGGCAGAGATGATGACCCTT | AGTCCACTGGCGTCTTCACCACCAT |
SIRT1 | ACTGGAGCTGGGGTGTCTG | CATCGCTTGAGGATCTGGAAGA | CTACAGCAAGGCGAGCATAAATACCATCCC |
PIC Group (n = 138) | Placebo Group (n = 143) | p-Value | |
---|---|---|---|
Age (years) | 44.9 ± 13.8 | 44.8 ± 13.1 | 0.981 |
Sex | 69 male/69 female | 72 male/71 female | |
Height (cm) | 164.6 ± 8.6 | 163.8 ± 8.6 | 0.441 |
Body weight (kg) | 74.9 ± 16.6 | 72.9 ± 15.0 | 0.295 |
Body mass index (kg/m2) | 27.5 ± 5.1 | 27.1 ± 4.7 | 0.436 |
0 Week | 1 Week | p-Value | 2 Week | p-Value | |||||
---|---|---|---|---|---|---|---|---|---|
AVE | SE | AVE | SE | AVE | SE | ||||
Placebo | n = 143 | 0.989 | 0.019 | 0.977 | 0.019 | 0.027 | 0.950 | 0.018 | 0.299 |
PIC | n = 138 | 0.962 | 0.018 | 0.997 | 0.020 | 0.951 | 0.018 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tanaka, K.; Kawakami, S.; Mori, S.; Yamaguchi, T.; Saito, E.; Setoguchi, Y.; Matsui, Y.; Nishimura, E.; Ebihara, S.; Kawama, T. Piceatannol Upregulates SIRT1 Expression in Skeletal Muscle Cells and in Human Whole Blood: In Vitro Assay and a Randomized, Double-Blind, Placebo-Controlled, Parallel-Group Comparison Trial. Life 2024, 14, 589. https://doi.org/10.3390/life14050589
Tanaka K, Kawakami S, Mori S, Yamaguchi T, Saito E, Setoguchi Y, Matsui Y, Nishimura E, Ebihara S, Kawama T. Piceatannol Upregulates SIRT1 Expression in Skeletal Muscle Cells and in Human Whole Blood: In Vitro Assay and a Randomized, Double-Blind, Placebo-Controlled, Parallel-Group Comparison Trial. Life. 2024; 14(5):589. https://doi.org/10.3390/life14050589
Chicago/Turabian StyleTanaka, Kenta, Shinpei Kawakami, Sadao Mori, Takumi Yamaguchi, Eriko Saito, Yuko Setoguchi, Yuko Matsui, Eisaku Nishimura, Shukuko Ebihara, and Toshihiro Kawama. 2024. "Piceatannol Upregulates SIRT1 Expression in Skeletal Muscle Cells and in Human Whole Blood: In Vitro Assay and a Randomized, Double-Blind, Placebo-Controlled, Parallel-Group Comparison Trial" Life 14, no. 5: 589. https://doi.org/10.3390/life14050589
APA StyleTanaka, K., Kawakami, S., Mori, S., Yamaguchi, T., Saito, E., Setoguchi, Y., Matsui, Y., Nishimura, E., Ebihara, S., & Kawama, T. (2024). Piceatannol Upregulates SIRT1 Expression in Skeletal Muscle Cells and in Human Whole Blood: In Vitro Assay and a Randomized, Double-Blind, Placebo-Controlled, Parallel-Group Comparison Trial. Life, 14(5), 589. https://doi.org/10.3390/life14050589