Design of InnoPrimers-Duplex Real-Time PCR for Detection and Treatment Response Prediction of EBV-Associated Nasopharyngeal Carcinoma Circulating Genetic Biomarker
Abstract
:1. Introduction
2. Materials and Methods
2.1. Archive NPC Biopsy Tissue and FNA Samples
2.2. Reference Microorganisms’ Genomic DNA
2.3. Study Subjects
2.4. Whole Blood and Tissue Samples
2.5. Extraction of Genomic DNA
2.6. Design of PCR Primers and TaqMan Probe
2.7. Design of Non-Extendable Blocking Oligonucleotide
2.8. Designing of Synthetic DNA
2.9. Optimization of qPCR Master Mix
2.10. Optimization of Thermal Cycling Condition
2.11. Analytical Sensitivity Analysis
2.12. Analytical Specificity Analysis
2.13. Diagnostic Evaluation
2.14. Treatment Response Prediction of NPC Patients
2.15. Data Analysis and Interpretation of Results
3. Results
3.1. NPC Patients’ Characteristics
3.2. Design and Evaluation of Primers, Non-Extendable Blocking Oligonucleotide and Probes
3.3. Optimization of qPCR Parameters
3.4. The InnoPrimers-Duplex qPCR Parameters and Thermal Cycling Condition
3.5. Analytical Sensitivity and Specificity of the Developed InnoPrimers-Duplex qPCR Assay
3.6. Diagnostic Sensitivity and Specificity of the Developed InnoPrimers-Duplex qPCR Assay
3.7. Detection of 30 bp Deletion NPC Genetic Biomarker in Healthy, Non-NPC Cancer and NPC Samples
3.8. Treatment Response Prediction of the Developed InnoPrimers-Duplex qPCR
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Brennan, B. Nasopharyngeal carcinoma. Orphanet. J. Rare Dis. 2006, 1, 23. Available online: https://www.ncbi.nlm.nih.gov/pubmed/16800883 (accessed on 1 April 2021). [CrossRef] [Green Version]
- Tabuchi, K.; Nakayama, M.; Nishimura, B.; Hayashi, K.; Hara, A. Early detection of nasopharyngeal carcinoma. Int. J. Otolaryngol. 2011, 2011. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lao, T.D.; Le, T.A.H. Epidemiology, incidence and mortality of Nasopharynx Cancer in Southeast Asia: An update report. Adv. Life Sci. 2020, 7, 86–90. [Google Scholar]
- Chang, E.T.; Adami, H.-O. The enigmatic epidemiology of nasopharyngeal carcinoma. Cancer Epidemiol. Prev. Biomark. 2006, 15, 1765–1777. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hildesheim, A.; Levine, P.H. Etiology of nasopharyngeal carcinoma: A review. Epidemiol. Rev. 1993, 15, 466–485. Available online: https://www.ncbi.nlm.nih.gov/pubmed/8174667 (accessed on 1 April 2021). [CrossRef] [PubMed]
- Jeannel, D.; Bouvier, G.; Hubert, A. Nasopharyngeal carcinoma: An epidemiological approach to carcinogenesis. Cancer Surv. 1999, 33, 125–155. [Google Scholar]
- Feng, B.J.; Jalbout, M.; Ayoub, W.B.; Khyatti, M.; Dahmoul, S.; Ayad, M.; Maachi, F.; Bedadra, W.; Abdoun, M.; Mesli, S.; et al. Dietary risk factors for nasopharyngeal carcinoma in Maghrebian countries. Int. J. Cancer 2007, 121, 1550–1555. Available online: https://www.ncbi.nlm.nih.gov/pubmed/17582611 (accessed on 1 April 2021). [CrossRef]
- Pathmanathan, R.; Prasad, U.; Chandrika, G.; Sadler, R.; Flynn, K.; Raab-Traub, N. Undifferentiated, nonkeratinizing, and squamous cell carcinoma of the nasopharynx. Variants of Epstein-Barr virus-infected neoplasia. Am. J. Pathol. 1995, 146, 1355–1367. Available online: https://www.ncbi.nlm.nih.gov/pubmed/7778675 (accessed on 15 April 2021).
- Wei, K.R.; Xu, Y.; Liu, J.; Zhang, W.J.; Liang, Z.H. Histopathological classification of nasopharyngeal carcinoma. Asian Pac. J. Cancer Prev. 2011, 12, 1141–1147. Available online: https://www.ncbi.nlm.nih.gov/pubmed/21875256 (accessed on 1 May 2021).
- Lu, J.J.; Lee, A.; Cooper, J. Nasopharyngeal cancer Multidisciplinary Management; Springer: Berlin, Germany, 2010. [Google Scholar] [CrossRef]
- Lou, P.-J.; Hsu, W.-L.; Chien, Y.-C.; Chen, C.-J. Screening and early diagnosis of nasopharyngeal carcinoma. In Nasopharyngeal Cancer; Springer: Berlin/Heidelberg, Germany, 2010; pp. 53–64. [Google Scholar]
- Abdulamir, A.S.; Hafidh, R.R.; Abdulmuhaimen, N.; Abubakar, F.; Abbas, K.A. The distinctive profile of risk factors of nasopharyngeal carcinoma in comparison with other head and neck cancer types. BMC Public Health 2008, 8, 400. Available online: https://www.ncbi.nlm.nih.gov/pubmed/19055849 (accessed on 15 May 2021). [CrossRef] [Green Version]
- Abdullah, B.; Alias, A.; Hassan, S. Challenges in the management of nasopharyngeal carcinoma: A review. Malays J. Med. Sci. 2009, 16, 50–54. Available online: https://www.ncbi.nlm.nih.gov/pubmed/22135512 (accessed on 23 April 2021). [PubMed]
- Chua, M.L.K.; Wee, J.T.S.; Hui, E.P.; Chan, A.T.C. Nasopharyngeal carcinoma. Lancet 2016, 387, 1012–1024. Available online: https://www.ncbi.nlm.nih.gov/pubmed/26321262 (accessed on 1 April 2021). [CrossRef]
- Ho, C.S. Beating ‘Guangdong cancer’: A review and update on nasopharyngeal cancer. Hong Kong Med. J. 2017, 23, 497–502. Available online: https://www.ncbi.nlm.nih.gov/pubmed/28862144 (accessed on 20 May 2021). [CrossRef] [Green Version]
- De Paschale, M.; Clerici, P. Serological diagnosis of Epstein-Barr virus infection: Problems and solutions. World J. Virol. 2012, 1, 31. [Google Scholar] [CrossRef]
- Abusalah, M.A.H.; Gan, S.H.; Al-Hatamleh, M.A.; Irekeola, A.A.; Shueb, R.H.; Yean, C.Y. Recent Advances in Diagnostic Approaches for Epstein–Barr Virus. Pathogens 2020, 9, 226. [Google Scholar] [CrossRef] [Green Version]
- Wong, T.S.; Chang, H.W.; Tang, K.C.; Wei, W.I.; Kwong, D.L.; Sham, J.S.; Yuen, A.P.; Kwong, Y.L. High frequency of promoter hypermethylation of the death-associated protein-kinase gene in nasopharyngeal carcinoma and its detection in the peripheral blood of patients. Clin. Cancer Res. 2002, 8, 433–437. Available online: https://www.ncbi.nlm.nih.gov/pubmed/11839660 (accessed on 23 May 2021).
- Chan, A.T.; Lo, Y.D.; Zee, B.; Chan, L.Y.; Ma, B.B.; Leung, S.-F.; Mo, F.; Lai, M.; Ho, S.; Huang, D.P. Plasma Epstein-Barr virus DNA and residual disease after radiotherapy for undifferentiated nasopharyngeal carcinoma. J. Natl. Cancer Inst. 2002, 94, 1614–1619. [Google Scholar] [CrossRef]
- Han, B.L.; Xu, X.Y.; Zhang, C.Z.; Wu, J.J.; Han, C.F.; Wang, H.; Wang, X.; Wang, G.S.; Yang, S.J.; Xie, Y. Systematic review on Epstein-Barr virus (EBV) DNA in diagnosis of nasopharyngeal carcinoma in Asian populations. Asian Pac. J. Cancer Prev. 2012, 13, 2577–2581. Available online: https://www.ncbi.nlm.nih.gov/pubmed/22938423 (accessed on 27 May 2021). [CrossRef] [Green Version]
- Lee, T.H.; Montalvo, L.; Chrebtow, V.; Busch, M.P. Quantitation of genomic DNA in plasma and serum samples: Higher concentrations of genomic DNA found in serum than in plasma. Transfusion 2001, 41, 276–282. Available online: https://www.ncbi.nlm.nih.gov/pubmed/11239235 (accessed on 27 May 2021). [CrossRef] [PubMed]
- Fung, S.Y.; Lam, J.W.; Chan, K.C. Clinical utility of circulating Epstein-Barr virus DNA analysis for the management of nasopharyngeal carcinoma. Chin. Clin. Oncol. 2016, 5, 18. Available online: https://www.ncbi.nlm.nih.gov/pubmed/27121878 (accessed on 23 May 2021). [CrossRef] [PubMed]
- Fanaian, N.K.; Cohen, C.; Waldrop, S.; Wang, J.; Shehata, B.M. Epstein-Barr virus (EBV)-encoded RNA: Automated in-situ hybridization (ISH) compared with manual ISH and immunohistochemistry for detection of EBV in pediatric lymphoproliferative disorders. Pediatric Dev. Pathol. 2009, 12, 195–199. [Google Scholar] [CrossRef] [PubMed]
- Kimura, H.; Kwong, Y.L. EBV Viral Loads in Diagnosis, Monitoring, and Response Assessment. Front Oncol. 2019, 9, 62. Available online: https://www.ncbi.nlm.nih.gov/pubmed/30809508 (accessed on 22 May 2021). [CrossRef] [PubMed] [Green Version]
- Gartner, B.; Preiksaitis, J.K. EBV viral load detection in clinical virology. J. Clin. Virol. 2010, 48, 82–90. Available online: https://www.ncbi.nlm.nih.gov/pubmed/20395167 (accessed on 22 May 2021). [CrossRef] [PubMed]
- Mazurek, A.M.; Wygoda, A.; Rutkowski, T.; Olbryt, M.; Pietrowska, M.; Celejewska, A.; Składowski, K.; Widłak, P. Prognostic significance of Epstein-Barr virus viral load in patients with T1-T2 nasopharyngeal cancer. J. Med. Virol. 2020, 92, 348–355. [Google Scholar] [CrossRef] [PubMed]
- Hau, P.M.; Lung, H.L.; Wu, M.; Tsang, C.M.; Wong, K.L.; Mak, N.K.; Lo, K.W. Targeting Epstein-Barr Virus in Nasopharyngeal Carcinoma. Front Oncol. 2020, 10, 600. Available online: https://www.ncbi.nlm.nih.gov/pubmed/32528868 (accessed on 25 May 2021). [CrossRef] [PubMed]
- Jain, A.; Chia, W.K.; Toh, H.C. Immunotherapy for nasopharyngeal cancer-a review. Chin. Clin. Oncol. 2016, 5, 22. Available online: https://www.ncbi.nlm.nih.gov/pubmed/27121882 (accessed on 1 June 2021). [CrossRef] [PubMed]
- Sivachandran, N.; Sarkari, F.; Frappier, L. Epstein-Barr nuclear antigen 1 contributes to nasopharyngeal carcinoma through disruption of PML nuclear bodies. PLoS Pathog. 2008, 4, e1000170. Available online: https://www.ncbi.nlm.nih.gov/pubmed/18833293 (accessed on 1 June 2021). [CrossRef] [PubMed] [Green Version]
- Saha, A.; Robertson, E.S. Mechanisms of B-Cell Oncogenesis Induced by Epstein-Barr Virus. J. Virol. 2019, 93. Available online: https://www.ncbi.nlm.nih.gov/pubmed/30971472 (accessed on 4 June 2021). [CrossRef] [Green Version]
- Humme, S.; Reisbach, G.; Feederle, R.; Delecluse, H.-J.; Bousset, K.; Hammerschmidt, W.; Schepers, A. The EBV nuclear antigen 1 (EBNA1) enhances B cell immortalization several thousandfold. Proc. Natl. Acad. Sci. USA 2003, 100, 10989–10994. [Google Scholar] [CrossRef] [Green Version]
- Hariwiyanto, B.; Sastrowiyoto, S.; Mubarika, S.; Salugu, M. LMP1 and LMP2 may be prognostic factors for outcome of therapy in nasopharyngeal cancers in Indonesia. Asian Pac. J. Cancer Prev. 2010, 11, 763–766. Available online: https://www.ncbi.nlm.nih.gov/pubmed/21039050 (accessed on 10 June 2021).
- D’Addario, M.; Chauvin, P. Ethnic differences in the expression of Epstein-Barr virus latent membrane protein-1 mutations in nasopharyngeal carcinoma. Mutat. Res. 2000, 457, 69–78. Available online: https://www.ncbi.nlm.nih.gov/pubmed/11106799 (accessed on 11 June 2021). [CrossRef]
- Peh, S.-C.; Kim, L.-H.; Mun, K.-S.; Tan, E.-L.; Sam, C.-K.; Poppema, S. Epstein-Barr virus (EBV) subtypes and variants in malignant tissue from Malaysian patients. J. Clin. Exp. Hematop. 2003, 43, 61–69. [Google Scholar] [CrossRef] [Green Version]
- da Costa, V.G.; Marques-Silva, A.C.; Moreli, M.L. The Epstein-Barr virus latent membrane protein-1 (LMP1) 30-bp deletion and XhoI-polymorphism in nasopharyngeal carcinoma: A meta-analysis of observational studies. Syst. Rev. 2015, 4, 46. Available online: https://www.ncbi.nlm.nih.gov/pubmed/25927427 (accessed on 11 June 2021). [CrossRef] [Green Version]
- See, H.S.; Yap, Y.Y.; Yip, W.K.; Seow, H.F. Epstein-Barr virus latent membrane protein-1 (LMP-1) 30-bp deletion and Xho I-loss is associated with type III nasopharyngeal carcinoma in Malaysia. World J. Surg. Oncol. 2008, 6, 18. Available online: https://www.ncbi.nlm.nih.gov/pubmed/18275617 (accessed on 13 June 2021). [CrossRef] [PubMed] [Green Version]
- Young, L.S.; Rickinson, A.B. Epstein-Barr virus: 40 years on. Nat. Rev. Cancer 2004, 4, 757–768. Available online: https://www.ncbi.nlm.nih.gov/pubmed/15510157 (accessed on 13 June 2021). [CrossRef] [PubMed]
- Dawson, C.W.; Port, R.J.; Young, L.S. The role of the EBV-encoded latent membrane proteins LMP1 and LMP2 in the pathogenesis of nasopharyngeal carcinoma (NPC). Semin. Cancer Biol. 2012, 22, 144–153. Available online: https://www.ncbi.nlm.nih.gov/pubmed/22249143 (accessed on 15 June 2021). [CrossRef]
- Raab-Traub, N. Epstein-Barr virus in the pathogenesis of NPC. Semin. Cancer Biol. 2002, 12, 431–441. Available online: https://www.ncbi.nlm.nih.gov/pubmed/12450729 (accessed on 24 September 2021). [CrossRef]
- Vera-Sempere, F.J.; Burgos, J.S.; Botella, M.S.; Cordoba, J.; Gobernado, M. Immunohistochemical expression of Epstein-Barr virus-encoded latent membrane protein (LMP-1) in paraffin sections of EBV-associated nasopharyngeal carcinoma in Spanish patients. Eur. J. Cancer B Oral. Oncol. 1996, 32, 163–168. Available online: https://www.ncbi.nlm.nih.gov/pubmed/8762873 (accessed on 14 June 2021). [CrossRef]
- Ai, J.; Xie, Z.; Liu, C.; Huang, Z.; Xu, J. Analysis of EBNA-1 and LMP-1 variants in diseases associated with EBV infection in Chinese children. Virol. J. 2012, 9, 13. Available online: https://www.ncbi.nlm.nih.gov/pubmed/22236445 (accessed on 20 June 2021). [CrossRef] [Green Version]
- Li, S.N.; Chang, Y.S.; Liu, S.T. Effect of a 10-amino acid deletion on the oncogenic activity of latent membrane protein 1 of Epstein-Barr virus. Oncogene 1996, 12, 2129–2135. Available online: https://www.ncbi.nlm.nih.gov/pubmed/8668338 (accessed on 20 June 2021).
- Bobek, V.; Kolostova, K.; Pinterova, D.; Kacprzak, G.; Adamiak, J.; Kolodziej, J.; Boubelik, M.; Kubecova, M.; Hoffman, R.M. A clinically relevant, syngeneic model of spontaneous, highly metastatic B16 mouse melanoma. Anticancer Res. 2010, 30, 4799–4803. Available online: https://www.ncbi.nlm.nih.gov/pubmed/21187455 (accessed on 22 June 2021).
- Tiwawech, D.; Srivatanakul, P.; Karalak, A.; Ishida, T. Association between EBNA2 and LMP1 subtypes of Epstein-Barr virus and nasopharyngeal carcinoma in Thais. J. Clin. Virol. 2008, 42, 1–6. Available online: https://www.ncbi.nlm.nih.gov/pubmed/18180201 (accessed on 15 June 2021). [CrossRef] [PubMed]
- Slana, I.; Kralik, P.; Kralova, A.; Pavlik, I. On-farm spread of Mycobacterium avium subsp. paratuberculosis in raw milk studied by IS900 and F57 competitive real time quantitative PCR and culture examination. Int. J. Food Microbiol. 2008, 128, 250–257. Available online: https://www.ncbi.nlm.nih.gov/pubmed/18824269 (accessed on 23 June 2021). [CrossRef] [PubMed]
- Staggemeier, R.; Bortoluzzi, M.; HECK, T.M.d.S.; Spilki, F.R.; ALMEIDA, S.E.d.M. Quantitative vs. conventional PCR for detection of human adenoviruses in water and sediment samples. Rev. Do Inst. De Med. Trop. De São Paulo 2015, 57, 299–303. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Barnes, L.; Eveson, J.W.; Sidransky, D.; Reichart, P. Pathology and Genetics of Head and Neck Tumours; IARC press: Lyon, France, 2005; Volume 9. [Google Scholar]
- Edge, S.B.; Compton, C.C. The American Joint Committee on Cancer: The 7th edition of the AJCC cancer staging manual and the future of TNM. Ann. Surg. Oncol. 2010, 17, 1471–1474. Available online: https://www.ncbi.nlm.nih.gov/pubmed/20180029 (accessed on 27 June 2021). [CrossRef] [PubMed]
- Ali, M.R.B.M. Development of Multiplex-UniNest Molecular Approach for Simultaneous Detection of Common Febrille-causing Infections (Malaria, Leptospirosis, Meliodosis and Enteric Fever). Ph.D. Thesis, Universiti Sains Malaysia, Kubang Kerian, Kota Bharu, Kelantan, Malaysia, August 2018. in press. [Google Scholar]
- Morlan, J.; Baker, J.; Sinicropi, D. Mutation detection by real-time PCR: A simple, robust and highly selective method. PLoS ONE 2009, 4, e4584. Available online: https://www.ncbi.nlm.nih.gov/pubmed/19240792 (accessed on 27 June 2021). [CrossRef]
- Wei, W.I.; Kwong, D.L. Current management strategy of nasopharyngeal carcinoma. Clin. Exp. Otorhinolaryngol. 2010, 3, 1. Available online: https://www.ncbi.nlm.nih.gov/pubmed/20379395 (accessed on 28 June 2021). [CrossRef] [PubMed] [Green Version]
- Lang, J.; Hu, C.; Lu, T.; Pan, J.; Lin, T. Chinese expert consensus on diagnosis and treatment of nasopharyngeal carcinoma: Evidence from current practice and future perspectives. Cancer Manag. Res. 2019, 11, 6365–6376. Available online: https://www.ncbi.nlm.nih.gov/pubmed/31372041 (accessed on 28 June 2021). [CrossRef] [Green Version]
- Therasse, P.; Arbuck, S.G.; Eisenhauer, E.A.; Wanders, J.; Kaplan, R.S.; Rubinstein, L.; Verweij, J.; Van Glabbeke, M.; van Oosterom, A.T.; Christian, M.C.; et al. New guidelines to evaluate the response to treatment in solid tumors. European Organization for Research and Treatment of Cancer, National Cancer Institute of the United States, National Cancer Institute of Canada. J. Natl. Cancer Inst. 2000, 92, 205–216. Available online: https://www.ncbi.nlm.nih.gov/pubmed/10655437 (accessed on 30 June 2021). [CrossRef] [Green Version]
- Eisenhauer, E.A.; Therasse, P.; Bogaerts, J.; Schwartz, L.H.; Sargent, D.; Ford, R.; Dancey, J.; Arbuck, S.; Gwyther, S.; Mooney, M.; et al. New response evaluation criteria in solid tumours: Revised RECIST guideline (version 1.1). Eur. J. Cancer 2009, 45, 228–247. Available online: https://www.ncbi.nlm.nih.gov/pubmed/19097774 (accessed on 30 June 2021). [CrossRef]
- Cui, A.; Wang, S.; Zhang, Q.; Wang, H.; Zhu, Z.; Li, A.; Song, Q.; Hao, Y.; He, J.; Xu, W. Development of a multiplex one-step real-time RT-PCR assay for the simultaneous detection of eight viruses associated with febrile rash illnesses. Biosaf. Health 2020, 2, 89–94. [Google Scholar] [CrossRef]
- Svec, D.; Tichopad, A.; Novosadova, V.; Pfaffl, M.W.; Kubista, M. How good is a PCR efficiency estimate: Recommendations for precise and robust qPCR efficiency assessments. Biomol. Detect. Quantif. 2015, 3, 9–16. Available online: https://www.ncbi.nlm.nih.gov/pubmed/27077029 (accessed on 30 June 2021). [CrossRef] [PubMed] [Green Version]
- Bustin, S.A.; Mueller, R. Real-time reverse transcription PCR (qRT-PCR) and its potential use in clinical diagnosis. Clin. Sci. (Lond.) 2005, 109, 365–379. Available online: https://www.ncbi.nlm.nih.gov/pubmed/16171460 (accessed on 1 July 2021). [CrossRef] [Green Version]
- Siti-Azrin, A.H.; Norsa’adah, B.; Naing, N.N. Prognostic factors of nasopharyngeal carcinoma patients in a tertiary referral hospital: A retrospective cohort study. BMC Res. Notes 2017, 10, 705. Available online: https://www.ncbi.nlm.nih.gov/pubmed/29212521 (accessed on 1 July 2021). [CrossRef] [PubMed] [Green Version]
- YASSIN, W.B.M. Epidemiology of Nasopharyngeal Carcinoma (NPC) in Pahang, Malaysia. Int. J. Health Allied sci. 2019, 11. Available online: https://journals.iium.edu.my/ijahs/index.php/IJAHS/article/view/77 (accessed on 3 July 2021).
- Siti-Azrin, A.H.; Norsa’adah, B.; Naing, N.N. Five-year survival and median survival time of nasopharyngeal carcinoma in Hospital Universiti Sains Malaysia. Asian Pac. J. Cancer Prev. 2014, 15, 6455–6459. Available online: https://www.ncbi.nlm.nih.gov/pubmed/25124642 (accessed on 3 July 2021). [CrossRef] [PubMed] [Green Version]
- Wang, H.Y.; Chang, Y.L.; To, K.F.; Hwang, J.S.; Mai, H.Q.; Feng, Y.F.; Chang, E.T.; Wang, C.P.; Kam, M.K.; Cheah, S.L.; et al. A new prognostic histopathologic classification of nasopharyngeal carcinoma. Chin. J. Cancer 2016, 35, 41. Available online: https://www.ncbi.nlm.nih.gov/pubmed/27146632 (accessed on 3 July 2021). [CrossRef] [Green Version]
- Chai, S.J.; Pua, K.C.; Saleh, A.; Yap, Y.Y.; Lim, P.V.; Subramaniam, S.K.; Lum, C.L.; Krishnan, G.; Mahiyuddin, W.R.; Malaysian, N.P.C.S.G.; et al. Clinical significance of plasma Epstein-Barr Virus DNA loads in a large cohort of Malaysian patients with nasopharyngeal carcinoma. J. Clin. Virol. 2012, 55, 34–39. Available online: https://www.ncbi.nlm.nih.gov/pubmed/22739102 (accessed on 3 July 2021). [CrossRef]
- Kakkar, A.; Sakthivel, P.; Mahajan, S.; Thakar, A. Nasopharyngeal Papillary Adenocarcinoma as a Second Head and Neck Malignancy. Head Neck Pathol. 2019, 13, 699–704. Available online: https://www.ncbi.nlm.nih.gov/pubmed/29923095 (accessed on 3 July 2021). [CrossRef]
- Krishnamoorthy, M.; Kamaludin, Z.; Jaafar, H.; Lazim, N.M. Papillary Variant of Nasopharyngeal Carcinoma: An Unusual Variant Previously Unreported in Malaysia. J. Med. Health Sci. 2020, 16, 339–341. [Google Scholar]
- El-Sherbieny, E.; Rashwan, H.; Lubis, S.H.; Choi, V.J. Prognostic factors in patients with nasopharyngeal carcinoma treated in Hospital Kuala Lumpur. Asian Pac. J. Cancer Prev. 2011, 12, 1739–1743. Available online: https://www.ncbi.nlm.nih.gov/pubmed/22126556 (accessed on 10 July 2021).
- Xiao, L.; Xiao, T.; Wang, Z.-M.; Cho, W.C.; Xiao, Z.-Q. Biomarker discovery of nasopharyngeal carcinoma by proteomics. Expert Rev. Proteom. 2014, 11, 215–225. [Google Scholar] [CrossRef]
- Zheng, Z.M. Viral oncogenes, noncoding RNAs, and RNA splicing in human tumor viruses. Int. J. Biol. Sci. 2010, 6, 730–755. Available online: https://www.ncbi.nlm.nih.gov/pubmed/21152115 (accessed on 11 July 2021). [CrossRef] [Green Version]
- Kieser, A. Signal transduction by the Epstein-Barr virus oncogene latent membrane protein 1 (LMP1). Signal Transduct. 2007, 7, 20–33. [Google Scholar] [CrossRef]
- Murono, S.; Inoue, H.; Tanabe, T.; Joab, I.; Yoshizaki, T.; Furukawa, M.; Pagano, J.S. Induction of cyclooxygenase-2 by Epstein-Barr virus latent membrane protein 1 is involved in vascular endothelial growth factor production in nasopharyngeal carcinoma cells. Proc. Natl. Acad. Sci. USA 2001, 98, 6905–6910. Available online: https://www.ncbi.nlm.nih.gov/pubmed/11381123 (accessed on 10 July 2021). [CrossRef] [Green Version]
- Li, A.; Dubey, S.; Varney, M.L.; Dave, B.J.; Singh, R.K. IL-8 directly enhanced endothelial cell survival, proliferation, and matrix metalloproteinases production and regulated angiogenesis. J. Immunol. 2003, 170, 3369–3376. Available online: https://www.ncbi.nlm.nih.gov/pubmed/12626597 (accessed on 15 July 2021). [CrossRef]
- Wakisaka, N.; Kondo, S.; Yoshizaki, T.; Murono, S.; Furukawa, M.; Pagano, J.S. Epstein-Barr virus latent membrane protein 1 induces synthesis of hypoxia-inducible factor 1 alpha. Mol. Cell. Biol. 2004, 24, 5223–5234. Available online: https://www.ncbi.nlm.nih.gov/pubmed/15169887 (accessed on 15 July 2021). [CrossRef] [Green Version]
- Fulda, S. Tumor resistance to apoptosis. Int. J. Cancer 2009, 124, 511–515. Available online: https://www.ncbi.nlm.nih.gov/pubmed/19003982 (accessed on 15 July 2021). [CrossRef]
- Saechan, V.; Mori, A.; Mitarnun, W.; Settheetham-Ishida, W.; Ishida, T. Analysis of LMP1 variants of EBV in Southern Thailand: Evidence for strain-associated T-cell tropism and pathogenicity. J. Clin. Virol. 2006, 36, 119–125. [Google Scholar] [CrossRef] [PubMed]
- Nagamine, M.; Takahara, M.; Kishibe, K.; Nagato, T.; Ishii, H.; Bandoh, N.; Ogino, T.; Harabuchi, Y. Sequence variations of Epstein-Barr virus LMP1 gene in nasal NK/T-cell lymphoma. Virus Genes 2007, 34, 47–54. Available online: https://www.ncbi.nlm.nih.gov/pubmed/16917737 (accessed on 17 July 2021). [CrossRef] [PubMed]
- Neves, M.; Marinho-Dias, J.; Ribeiro, J.; Sousa, H. Epstein-Barr virus strains and variations: Geographic or disease-specific variants? J. Med. Virol. 2017, 89, 373–387. Available online: https://www.ncbi.nlm.nih.gov/pubmed/27430663 (accessed on 18 July 2021). [CrossRef] [PubMed]
- Wang, H.; Jiang, J.; Mostert, B.; Sieuwerts, A.; Martens, J.W.; Sleijfer, S.; Foekens, J.A.; Wang, Y. Allele-specific, non-extendable primer blocker PCR (AS-NEPB-PCR) for DNA mutation detection in cancer. J. Mol. Diagn. 2013, 15, 62–69. Available online: https://www.ncbi.nlm.nih.gov/pubmed/23159590 (accessed on 18 July 2021). [CrossRef]
- Vestheim, H.; Deagle, B.E.; Jarman, S.N. Application of blocking oligonucleotides to improve signal-to-noise ratio in a PCR. Methods Mol. Biol. 2011, 687, 265–274. Available online: https://www.ncbi.nlm.nih.gov/pubmed/20967615 (accessed on 19 July 2021). [CrossRef] [PubMed]
- Ryan, J.L.; Fan, H.; Glaser, S.L.; Schichman, S.A.; Raab-Traub, N.; Gulley, M.L. Epstein-Barr virus quantitation by real-time PCR targeting multiple gene segments: A novel approach to screen for the virus in paraffin-embedded tissue and plasma. J. Mol. Diagn. 2004, 6, 378–385. Available online: https://www.ncbi.nlm.nih.gov/pubmed/15507678 (accessed on 21 July 2021). [CrossRef]
- Chan, K.C. Plasma Epstein-Barr virus DNA as a biomarker for nasopharyngeal carcinoma. Chin. J. Cancer 2014, 33, 598–603. Available online: https://www.ncbi.nlm.nih.gov/pubmed/25418194 (accessed on 21 July 2021). [CrossRef]
- Chan, K.C.; Chan, A.T.; Leung, S.F.; Pang, J.C.; Wang, A.Y.; Tong, J.H.; To, K.F.; Chan, L.Y.; Tam, L.L.; Chung, N.Y.; et al. Investigation into the origin and tumoral mass correlation of plasma Epstein-Barr virus DNA in nasopharyngeal carcinoma. Clin. Chem. 2005, 51, 2192–2195. Available online: https://www.ncbi.nlm.nih.gov/pubmed/16244302 (accessed on 21 July 2021). [CrossRef] [PubMed] [Green Version]
- Fryer, J.F.; Heath, A.B.; Wilkinson, D.E.; Minor, P.D.; Collaborative Study, G. A collaborative study to establish the 1st WHO International Standard for Epstein-Barr virus for nucleic acid amplification techniques. Biologicals 2016, 44, 423–433. Available online: https://www.ncbi.nlm.nih.gov/pubmed/27461128 (accessed on 23 July 2021). [CrossRef] [PubMed] [Green Version]
- Hwang, K.A.; Ahn, J.H.; Nam, J.H. Development and validation of multiplex real-time PCR assays for rapid detection of cytomegalovirus, Epstein-Barr virus, and polyomavirus BK in whole blood from transplant candidates. J. Microbiol. 2018, 56, 593–599. Available online: https://www.ncbi.nlm.nih.gov/pubmed/30047089 (accessed on 23 July 2021). [CrossRef]
- Ji, M.F.; Huang, Q.H.; Yu, X.; Liu, Z.; Li, X.; Zhang, L.F.; Wang, P.; Xie, S.H.; Rao, H.L.; Fang, F.; et al. Evaluation of plasma Epstein-Barr virus DNA load to distinguish nasopharyngeal carcinoma patients from healthy high-risk populations in Southern China. Cancer 2014, 120, 1353–1360. Available online: https://www.ncbi.nlm.nih.gov/pubmed/24477877 (accessed on 24 July 2021). [CrossRef]
- Song, C.; Yang, S. A meta-analysis on the EBV DNA and VCA-IgA in diagnosis of Nasopharyngeal Carcinoma. Pak. J. Med. Sci. 2013, 29, 885–890. Available online: https://www.ncbi.nlm.nih.gov/pubmed/24353651 (accessed on 24 July 2021). [CrossRef]
- Adham, M.; Greijer, A.E.; Verkuijlen, S.A.; Juwana, H.; Fleig, S.; Rachmadi, L.; Malik, O.; Kurniawan, A.N.; Roezin, A.; Gondhowiardjo, S.; et al. Epstein-Barr virus DNA load in nasopharyngeal brushings and whole blood in nasopharyngeal carcinoma patients before and after treatment. Clin. Cancer Res. 2013, 19, 2175–2186. Available online: https://www.ncbi.nlm.nih.gov/pubmed/23493345 (accessed on 26 July 2021). [CrossRef] [Green Version]
- Kim, L.-H.; Peh, S.-C. Epstein-Barr virus-Associated Lymphomas in Malaysia. J. Clin. Exp. Hematop. 2003, 43, 11–19. [Google Scholar] [CrossRef]
- Tan, E.L.; Peh, S.C.; Sam, C.K. Analyses of Epstein-Barr virus latent membrane protein-1 in Malaysian nasopharyngeal carcinoma: High prevalence of 30-bp deletion, Xho1 polymorphism and evidence of dual infections. J. Med. Virol. 2003, 69, 251–257. Available online: https://www.ncbi.nlm.nih.gov/pubmed/12683415 (accessed on 26 July 2021). [CrossRef] [PubMed]
- Chan, A.K.; Chiu, R.W.; Lo, Y.M.; Clinical Sciences Reviews Committee of the Association of Clinical Biochemists. Cell-free nucleic acids in plasma, serum and urine: A new tool in molecular diagnosis. Ann. Clin. Biochem. 2003, 40, 122–130. Available online: https://www.ncbi.nlm.nih.gov/pubmed/12662399 (accessed on 26 July 2021). [CrossRef] [PubMed] [Green Version]
- Hui, E.P.; Chan, A.T. Epidemiology, Etiology, and Diagnosis of Nasopharyngeal Carcinoma; UpToDate: Waltham, MA, USA, 2018. [Google Scholar]
- Chang, Y.S.; Tyan, Y.S.; Liu, S.T.; Tsai, M.S.; Pao, C.C. Detection of Epstein-Barr virus DNA sequences in nasopharyngeal carcinoma cells by enzymatic DNA amplification. J. Clin. Microbiol. 1990, 28, 2398–2402. Available online: https://www.ncbi.nlm.nih.gov/pubmed/2174898 (accessed on 26 July 2021). [CrossRef] [Green Version]
- Paiar, F.; Di Cataldo, V.; Zei, G.; Pasquetti, E.M.; Cecchini, S.; Meattini, I.; Mangoni, M.; Agresti, B.; Iermano, C.; Bonomo, P.; et al. Role of chemotherapy in nasopharyngeal carcinoma. Oncol. Rev. 2012, 6, e1. Available online: https://www.ncbi.nlm.nih.gov/pubmed/25992199 (accessed on 26 July 2021). [CrossRef] [Green Version]
- Nakanishi, Y.; Wakisaka, N.; Kondo, S.; Endo, K.; Sugimoto, H.; Hatano, M.; Ueno, T.; Ishikawa, K.; Yoshizaki, T. Progression of understanding for the role of Epstein-Barr virus and management of nasopharyngeal carcinoma. Cancer Metastasis Rev. 2017, 36, 435–447. Available online: https://www.ncbi.nlm.nih.gov/pubmed/28819752 (accessed on 27 July 2021). [CrossRef] [Green Version]
- Xu, T.; Tang, J.; Gu, M.; Liu, L.; Wei, W.; Yang, H. Recurrent nasopharyngeal carcinoma: A clinical dilemma and challenge. Curr. Oncol. 2013, 20, e406. [Google Scholar] [CrossRef] [Green Version]
- Ng, R.H.; Ngan, R.; Wei, W.I.; Gullane, P.J.; Phillips, J. Trans-oral brush biopsies and quantitative PCR for EBV DNA detection and screening of nasopharyngeal carcinoma. Otolaryngol. Head Neck Surg. 2014, 150, 602–609. Available online: https://www.ncbi.nlm.nih.gov/pubmed/24486777 (accessed on 27 July 2021). [CrossRef]
- Lao, T.D.; Nguyen, D.H.; Nguyen, T.M.; Le, T.A.H. Molecular Screening for Epstein-Barr virus (EBV): Detection of Genomic EBNA-1, EBNA-2, LMP-1, LMP-2 Among Vietnamese Patients with Nasopharyngeal Brush Samples. Asian Pac. J. Cancer Prev. 2017, 18, 1675–1679. Available online: https://www.ncbi.nlm.nih.gov/pubmed/28670888 (accessed on 27 July 2021). [CrossRef]
- Hsu, C.L.; Chang, K.P.; Lin, C.Y.; Chang, H.K.; Wang, C.H.; Lin, T.L.; Liao, C.T.; Tsang, N.M.; Lee, L.Y.; Chan, S.C.; et al. Plasma Epstein-Barr virus DNA concentration and clearance rate as novel prognostic factors for metastatic nasopharyngeal carcinoma. Head Neck 2012, 34, 1064–1070. Available online: https://www.ncbi.nlm.nih.gov/pubmed/22083949 (accessed on 28 July 2021). [CrossRef]
- Lo, Y.D.; Leung, S.-F.; Chan, L.Y.; Chan, A.T.; Lo, K.-W.; Johnson, P.J.; Huang, D.P. Kinetics of plasma Epstein-Barr virus DNA during radiation therapy for nasopharyngeal carcinoma. Cancer Res. 2000, 60, 2351–2355. [Google Scholar] [PubMed]
- Liu, F.Y.; Lin, C.Y.; Chang, J.T.; Ng, S.H.; Chin, S.C.; Wang, H.M.; Liao, C.T.; Chan, S.C.; Yen, T.C. 18F-FDG PET can replace conventional work-up in primary M staging of nonkeratinizing nasopharyngeal carcinoma. J. Nucl. Med. 2007, 48, 1614–1619. Available online: https://www.ncbi.nlm.nih.gov/pubmed/17873135 (accessed on 28 July 2021). [CrossRef] [PubMed] [Green Version]
- Hsu, C.L.; Chan, S.C.; Chang, K.P.; Lin, T.L.; Lin, C.Y.; Hsieh, C.H.; Huang, S.F.; Tsang, N.M.; Lee, L.Y.; Ng, S.H.; et al. Clinical scenario of EBV DNA follow-up in patients of treated localized nasopharyngeal carcinoma. Oral. Oncol. 2013, 49, 620–625. Available online: https://www.ncbi.nlm.nih.gov/pubmed/23466197 (accessed on 28 July 2021). [CrossRef] [PubMed]
- Hui, E.P.; Leung, S.F.; Au, J.S.; Zee, B.; Tung, S.; Chua, D.; Sze, W.M.; Law, C.K.; Leung, T.W.; Chan, A.T. Lung metastasis alone in nasopharyngeal carcinoma: A relatively favorable prognostic group. A study by the Hong Kong Nasopharyngeal Carcinoma Study Group. Cancer 2004, 101, 300–306. Available online: https://www.ncbi.nlm.nih.gov/pubmed/15241827 (accessed on 28 July 2021). [CrossRef] [PubMed]
- Radhakrishnan, V.; Thulkar, S.; Karunanithi, S.; Tanveer, N.; Bakhshi, S. Nasopharyngeal carcinoma with splenic and cystic liver metastases in a pediatric patient: 18F-FDG PET-CT findings. Pediatr. Radiol. 2010, 40, S79–S82. Available online: https://www.ncbi.nlm.nih.gov/pubmed/20922367 (accessed on 28 July 2021). [CrossRef]
- Leung, S.F.; Lo, Y.M.; Chan, A.T.; To, K.F.; To, E.; Chan, L.Y.; Zee, B.; Huang, D.P.; Johnson, P.J. Disparity of sensitivities in detection of radiation-naive and postirradiation recurrent nasopharyngeal carcinoma of the undifferentiated type by quantitative analysis of circulating Epstein-Barr virus DNA1,2. Clin. Cancer Res. 2003, 9, 3431–3434. Available online: https://www.ncbi.nlm.nih.gov/pubmed/12960133 (accessed on 29 July 2021).
- Fan, H.; Nicholls, J.; Chua, D.; Chan, K.H.; Sham, J.; Lee, S.; Gulley, M.L. Laboratory markers of tumor burden in nasopharyngeal carcinoma: A comparison of viral load and serologic tests for Epstein-Barr virus. Int. J. Cancer 2004, 112, 1036–1041. Available online: https://www.ncbi.nlm.nih.gov/pubmed/15386346 (accessed on 29 July 2021). [CrossRef]
- Hong, R.L.; Lin, C.Y.; Ting, L.L.; Ko, J.Y.; Hsu, M.M. Comparison of clinical and molecular surveillance in patients with advanced nasopharyngeal carcinoma after primary therapy: The potential role of quantitative analysis of circulating Epstein-Barr virus DNA. Cancer 2004, 100, 1429–1437. Available online: https://www.ncbi.nlm.nih.gov/pubmed/15042677 (accessed on 29 July 2021). [CrossRef]
- Wang, W.Y.; Twu, C.W.; Lin, W.Y.; Jiang, R.S.; Liang, K.L.; Chen, K.W.; Wu, C.T.; Shih, Y.T.; Lin, J.C. Plasma Epstein-Barr virus DNA screening followed by (1)(8)F-fluoro-2-deoxy-D-glucose positron emission tomography in detecting posttreatment failures of nasopharyngeal carcinoma. Cancer 2011, 117, 4452–4459. Available online: https://www.ncbi.nlm.nih.gov/pubmed/21437892 (accessed on 29 July 2021). [CrossRef]
- Ferrari, D.; Codeca, C.; Bertuzzi, C.; Broggio, F.; Crepaldi, F.; Luciani, A.; Floriani, I.; Ansarin, M.; Chiesa, F.; Alterio, D.; et al. Role of plasma EBV DNA levels in predicting recurrence of nasopharyngeal carcinoma in a Western population. BMC Cancer 2012, 12, 208. Available online: https://www.ncbi.nlm.nih.gov/pubmed/22646734 (accessed on 29 July 2021). [CrossRef] [Green Version]
- Liang, F.Y.; Sun, W.; Han, P.; Lu, X.; Lian, Y.N.; Huang, X.M. Detecting plasma Epstein-Barr virus DNA to diagnose postradiation nasopharyngeal skull base lesions in nasopharyngeal carcinoma patients: A prospective study. Chin. J. Cancer 2012, 31, 142–149. Available online: https://www.ncbi.nlm.nih.gov/pubmed/22237037 (accessed on 30 July 2021). [CrossRef]
- Yee Ko, J.M.; Dai, W.; Wun Wong, E.H.; Kwong, D.; Tong Ng, W.; Lee, A.; Kai Cheong Ngan, R.; Chung Yau, C.; Tung, S.; Li Lung, M. Multigene pathway-based analyses identify nasopharyngeal carcinoma risk associations for cumulative adverse effects of TERT-CLPTM1L and DNA double-strand breaks repair. Int. J. Cancer 2014, 135, 1634–1645. Available online: https://www.ncbi.nlm.nih.gov/pubmed/24615621 (accessed on 30 July 2021). [CrossRef]
- Shen, T.; Tang, L.Q.; Luo, D.H.; Chen, Q.Y.; Li, P.J.; Mai, D.M.; Guo, S.S.; Liu, L.T.; Qian, C.N.; Guo, X.; et al. Different prognostic values of plasma Epstein-Barr virus DNA and maximal standardized uptake value of 18F-FDG PET/CT for nasopharyngeal carcinoma patients with recurrence. PLoS ONE 2015, 10, e0122756. Available online: https://www.ncbi.nlm.nih.gov/pubmed/25853677 (accessed on 30 July 2021). [CrossRef] [Green Version]
- An, X.; Wang, F.H.; Ding, P.R.; Deng, L.; Jiang, W.Q.; Zhang, L.; Shao, J.Y.; Li, Y.H. Plasma Epstein-Barr virus DNA level strongly predicts survival in metastatic/recurrent nasopharyngeal carcinoma treated with palliative chemotherapy. Cancer 2011, 117, 3750–3757. Available online: https://www.ncbi.nlm.nih.gov/pubmed/21319149 (accessed on 30 July 2021). [CrossRef]
- Chen, Y.P.; Chan, A.T.C.; Le, Q.T.; Blanchard, P.; Sun, Y.; Ma, J. Nasopharyngeal carcinoma. Lancet 2019, 394, 64–80. Available online: https://www.ncbi.nlm.nih.gov/pubmed/31178151 (accessed on 1 August 2021). [CrossRef]
- Tang, L.Q.; Li, C.F.; Li, J.; Chen, W.H.; Chen, Q.Y.; Yuan, L.X.; Lai, X.P.; He, Y.; Xu, Y.X.; Hu, D.P.; et al. Establishment and Validation of Prognostic Nomograms for Endemic Nasopharyngeal Carcinoma. J. Natl. Cancer Inst. 2016, 108. Available online: https://www.ncbi.nlm.nih.gov/pubmed/26467665 (accessed on 1 August 2021). [CrossRef] [PubMed] [Green Version]
- Hui, E.P.; Ma, B.B.; Chan, K.C.; Chan, C.M.; Wong, C.S.; To, K.F.; Chan, A.W.; Tung, S.Y.; Ng, W.T.; Cheng, A.C.; et al. Clinical utility of plasma Epstein-Barr virus DNA and ERCC1 single nucleotide polymorphism in nasopharyngeal carcinoma. Cancer 2015, 121, 2720–2729. Available online: https://www.ncbi.nlm.nih.gov/pubmed/25946469 (accessed on 1 August 2021). [CrossRef] [PubMed]
- Kim, K.Y.; Le, Q.T.; Yom, S.S.; Pinsky, B.A.; Bratman, S.V.; Ng, R.H.; El Mubarak, H.S.; Chan, K.C.; Sander, M.; Conley, B.A. Current State of PCR-Based Epstein-Barr Virus DNA Testing for Nasopharyngeal Cancer. J. Natl. Cancer Inst. 2017, 109. Available online: https://www.ncbi.nlm.nih.gov/pubmed/28376165 (accessed on 1 August 2021). [CrossRef] [PubMed]
- Leung, S.F.; Chan, K.C.; Ma, B.B.; Hui, E.P.; Mo, F.; Chow, K.C.; Leung, L.; Chu, K.W.; Zee, B.; Lo, Y.M.; et al. Plasma Epstein-Barr viral DNA load at midpoint of radiotherapy course predicts outcome in advanced-stage nasopharyngeal carcinoma. Ann. Oncol. 2014, 25, 1204–1208. Available online: https://www.ncbi.nlm.nih.gov/pubmed/24638904 (accessed on 2 August 2021). [CrossRef]
- Lin, J.C.; Wang, W.Y.; Chen, K.Y.; Wei, Y.H.; Liang, W.M.; Jan, J.S.; Jiang, R.S. Quantification of plasma Epstein-Barr virus DNA in patients with advanced nasopharyngeal carcinoma. N. Engl. J. Med. 2004, 350, 2461–2470. Available online: https://www.ncbi.nlm.nih.gov/pubmed/15190138 (accessed on 2 August 2021). [CrossRef] [Green Version]
- Li, W.F.; Zhang, Y.; Huang, X.B.; Du, X.J.; Tang, L.L.; Chen, L.; Peng, H.; Guo, R.; Sun, Y.; Ma, J. Prognostic value of plasma Epstein-Barr virus DNA level during posttreatment follow-up in the patients with nasopharyngeal carcinoma having undergone intensity-modulated radiotherapy. Chin. J. Cancer 2017, 36, 87. Available online: https://www.ncbi.nlm.nih.gov/pubmed/29116021 (accessed on 3 August 2021). [CrossRef] [PubMed]
- Smatti, M.K.; Al-Sadeq, D.W.; Ali, N.H.; Pintus, G.; Abou-Saleh, H.; Nasrallah, G.K. Epstein-Barr Virus Epidemiology, Serology, and Genetic Variability of LMP-1 Oncogene Among Healthy Population: An Update. Front. Oncol. 2018, 8, 211. Available online: https://www.ncbi.nlm.nih.gov/pubmed/29951372 (accessed on 3 August 2021). [CrossRef] [PubMed] [Green Version]
Target Gene | Sequences (5′→3′ End) | Source | |
---|---|---|---|
LMP1 30 bp deletion | Forward primer | GTCATAGTAGCTTAGCTGAAC | This study |
Gap-filling primer (reverse primer) | ACGGTGGCGGCGGTG | This study | |
Multi-points degenerative blocker (reverse sequence) | CGGCMRTGGCGGCGVTR-PO4 * | This study | |
Reverse probe | FAM-ATCCACACCTTCCTACGCTGCTTTTGG-BHQ_1 | This study | |
IAC | Forward primer | AAGGAGTTCTTCGGCACCA | [49] |
Reverse primer | GGCGCTTGTGGGTCAAC | [49] | |
Forward probe | Cy5.5-TTCCTGCTATTCTCATTCGCATCCATGT-IBRQ | [49] |
Concentration | Copies Number | Copies/mL | Number of Replicates | Number of Positive | Developed InnoPrimers-Duplex qPCR | ||
---|---|---|---|---|---|---|---|
Mean Cq | SD | CV% | |||||
2 ng | 17,300,000,000 | 865 × 109 | 3 | 1 | 2.73 | 4.73 | 173.21 |
200 pg | 1,730,000,000 | 865 × 108 | 3 | 3 | 11.02 | 0.37 | 3.31 |
20 pg | 173,000,000 | 865 × 107 | 3 | 3 | 14.01 | 0.61 | 4.37 |
2 pg | 17,300,000 | 865 × 106 | 3 | 3 | 18.11 | 0.25 | 1.36 |
200 fg | 1,730,000 | 865 × 105 | 3 | 3 | 20.21 | 2.30 | 11.40 |
20 fg | 173,000 | 865 × 104 | 3 | 3 | 24.11 | 0.97 | 4.03 |
2 fg | 17,300 | 865 × 103 | 3 | 3 | 28.86 | 0.41 | 1.46 |
200 ag | 1730 | 865 × 102 | 3 | 3 | 31.39 | 1.21 | 3.85 |
20 ag | 173 | 8650 | 3 | 3 | 33.6 | 0.12 | 0.34 |
2 ag | 17.3 | 865 | 3 | 1 | 39.36 | 1.11 | 2.81 |
200 zg | 1.73 | 86.5 | 3 | 0 | - | - | - |
Microorganism (n = 48) | Source | Origin | No. Tested | Result of LMP1 30 bp Deletion NPC Genetic Biomarker by the InnoPrimers-Duplex qPCR Assay |
---|---|---|---|---|
Aspergillus flavus | Clinical isolate | HUSM | 1 | Negative |
Aspergillus fumigatus | Clinical isolate | HUSM | 1 | Negative |
Aspergillus nidulans | Clinical isolate | HUSM | 1 | Negative |
Aspergillus niger | Clinical isolate | HUSM | 1 | Negative |
Aspergillus terreus | Clinical isolate | HUSM | 1 | Negative |
Bacillus subtilits | Clinical isolate | HUSM | 1 | Negative |
Candidaalbican | Clinical isolate | HUSM | 1 | Negative |
Candida famata | Clinical isolate | HUSM | 1 | Negative |
Candida glabrata | Clinical isolate | HUSM | 1 | Negative |
Candidakrusei | Clinical isolate | HUSM | 1 | Negative |
Candida lusitaniae | Clinical isolate | HUSM | 1 | Negative |
Candida parapsilosis | Clinical isolate | HUSM | 1 | Negative |
Candida rugosa | Clinical isolate | HUSM | 1 | Negative |
Candida tropicalis | Clinical isolate | HUSM | 1 | Negative |
Cladosporium spp. | Clinical isolate | HUSM | 1 | Negative |
Corynebacterium diphtheria | Clinical isolate | HUSM | 1 | Negative |
Cryptococcus neoformans | Clinical isolate | HUSM | 1 | Negative |
Cytomegalovirus (CMV) | Clinical isolate | HUSM | 5 | Negative |
Enterobacter cloacae | Clinical isolate | HUSM | 1 | Negative |
Enterobacter sp. | Clinical isolate | HUSM | 1 | Negative |
Escherichia coli | ATCC (25922) | HUSM | 1 | Negative |
Fusarium oxysporum | Clinical isolate | HUSM | 1 | Negative |
Fusarium proliferatum | Clinical isolate | HUSM | 1 | Negative |
Haemophilus influenza | ATCC (49247) | HUSM | 1 | Negative |
Human papillomavirus (HPV) | Clinical isolate | HUSM | 5 | Negative |
Klebsiella pneumoniae | Clinical isolate | HUSM | 1 | Negative |
Klebsiella oxytoca | Clinical isolate | HUSM | 1 | Negative |
Neisseria meningitides | ATCC (13090) | HUSM | 1 | Negative |
Penicillium marneffei | Clinical isolate | HUSM | 1 | Negative |
Pseudomonas aeruginosa | ATCC (27853) | HUSM | 1 | Negative |
Rhizopus spp. | Clinical isolate | HUSM | 1 | Negative |
Scedosporium aurantiacum | Clinical isolate | HUSM | 1 | Negative |
Staphylococcus aureus | ATCC (25923) | HUSM | 1 | Negative |
Staphylococcus epidermidis | ATCC (12228) | HUSM | 1 | Negative |
Stenotrophomonas maltophilia | Clinical isolate | HUSM | 1 | Negative |
Streptococcus Group A | Clinical isolate | HUSM | 1 | Negative |
Streptococcus mitis | Clinical isolate | HUSM | 1 | Negative |
Streptococcus pneumonia | Clinical isolate | HUSM | 1 | Negative |
Trichophyton rubrum | Clinical isolate | HUSM | 1 | Negative |
Trichosporon asahii | Clinical isolate | HUSM | 1 | Negative |
Name of Sample | Source | Origin | Sequencing Results | Conventional PCR Results | Result of LMP1 30 bp Deletion NPC Genetic Biomarker in Developed Assay |
---|---|---|---|---|---|
AB 1 | NPC | HUSM | WT | Heterogenous type | Negative |
AB 9 | NPC | HUSM | MT | MT | Positive |
AB 10 | NPC | HUSM | MT | MT | Positive |
AB 12 | NPC | HUSM | MT | MT | Positive |
AB 14 | NPC | HUSM | MT | MT | Positive |
AB 16 | NPC | HUSM | MT | MT | Positive |
AB 17 | NPC | HUSM | MT | MT | Positive |
FNA 1 | NPC | HUSM | WT | WT | Negative |
FNA 3 | NPC | HUSM | WT | Heterogenous type | Negative |
FNA 4 | NPC | HUSM | WT | WT | Negative |
FNA 6 | NPC | HUSM | MT | MT | Positive |
FNA 7 | NPC | HUSM | MT | MT | Positive |
Clinician Treatment Response Prediction | |||||
---|---|---|---|---|---|
Treatment response prediction based on the InnoPrimers-duplex qPCR result | CR | PR | PD/Recurrence* | Total | |
CR (Cq ≥ 37) | 15 | 5 a | 3 b | 23 | |
PR (Cq: 36.99–32.00) | 3 c | 5 | 0 | 8 | |
PD/recurrence (Cq ≤ 31.99) | 1 d | 0 | 2 | 3 | |
Total | 19 | 10 | 5 | 34 |
NPC WB Sample | |||||
---|---|---|---|---|---|
Categorical Cq of 30 bp Deletion Genetic Biomarker in WB Samples, n (%) | p-Value # | ||||
≥37 | 36.99–32.00 | ≤31.99 | 0.033 * | ||
Clinician treatment response prediction | CR PR Recurrence/PD | 15 (44.2) 5 (14.7) 3 (8.8) | 3 (8.8) 5 (14.7) 0 (0) | 1 (2.9) 0 (0) 2 (5.9) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Abusalah, M.A.H.; Binti Hassan, S.A.; Mat Lazim, N.; Abdullah, B.; Binti Wan Sohaimi, W.F.; Husin, A.; Cheng, K.Y.; Yean, C.Y. Design of InnoPrimers-Duplex Real-Time PCR for Detection and Treatment Response Prediction of EBV-Associated Nasopharyngeal Carcinoma Circulating Genetic Biomarker. Diagnostics 2021, 11, 1761. https://doi.org/10.3390/diagnostics11101761
Abusalah MAH, Binti Hassan SA, Mat Lazim N, Abdullah B, Binti Wan Sohaimi WF, Husin A, Cheng KY, Yean CY. Design of InnoPrimers-Duplex Real-Time PCR for Detection and Treatment Response Prediction of EBV-Associated Nasopharyngeal Carcinoma Circulating Genetic Biomarker. Diagnostics. 2021; 11(10):1761. https://doi.org/10.3390/diagnostics11101761
Chicago/Turabian StyleAbusalah, Mai Abdel Haleem, Siti Asma Binti Hassan, Norhafiza Mat Lazim, Baharudin Abdullah, Wan Fatihah Binti Wan Sohaimi, Azlan Husin, Kueh Yee Cheng, and Chan Yean Yean. 2021. "Design of InnoPrimers-Duplex Real-Time PCR for Detection and Treatment Response Prediction of EBV-Associated Nasopharyngeal Carcinoma Circulating Genetic Biomarker" Diagnostics 11, no. 10: 1761. https://doi.org/10.3390/diagnostics11101761
APA StyleAbusalah, M. A. H., Binti Hassan, S. A., Mat Lazim, N., Abdullah, B., Binti Wan Sohaimi, W. F., Husin, A., Cheng, K. Y., & Yean, C. Y. (2021). Design of InnoPrimers-Duplex Real-Time PCR for Detection and Treatment Response Prediction of EBV-Associated Nasopharyngeal Carcinoma Circulating Genetic Biomarker. Diagnostics, 11(10), 1761. https://doi.org/10.3390/diagnostics11101761