Next Article in Journal
Bixafen, Prothioconazole, and Trifloxystrobin Alone or in Combination Have a Greater Effect on Health Related Gene Expression in Honey Bees from Nutritionally Deprived than from Protein Supplemented Colonies
Next Article in Special Issue
De Novo Transcriptome Profiling of Mustard Aphid (Lipaphis erysimi) and Differential Expression of Transcripts Associated with Feeding and Non-Feeding Conditions and Developmental Stages
Previous Article in Journal
The Carotenoid Composition of Larvae Feed Is Reflected in Adult House Fly (Musca domestica) Body
Previous Article in Special Issue
Binding Analysis of Sf-SR-C MAM Domain and Sf-FGFR Ectodomain to Vip3Aa
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Insects
Volume 15
Issue 7
10.3390/insects15070522
insects-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Identification and Evaluation of qRT-PCR Reference Genes in Melanaphis sacchari

by
Kunliang Zou
1,†,
Tonghan Wang
1,†,
Minghui Guan
2,3,
Yang Liu
3,
Jieqin Li
1,2,
Yanlong Liu
1,2,
Junli Du
1,2,* and
Degong Wu
1
1
College of Agriculture, Anhui Science and Technology University, Chuzhou 233100, China
2
Anhui Province International Joint Research Center of Forage Bio-Breeding, Chuzhou 233100, China
3
College of Resources and Environment, Anhui Science and Technology University, Chuzhou 233100, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Insects 2024, 15(7), 522; https://doi.org/10.3390/insects15070522
Submission received: 11 June 2024 / Revised: 26 June 2024 / Accepted: 29 June 2024 / Published: 11 July 2024
(This article belongs to the Special Issue Biology and Molecular Mechanisms of Plant-Aphid Interactions)
Browse Figures
Review Reports Versions Notes

Abstract

:

Simple Summary

The sorghum aphid, a significant pest affecting sorghum cultivation in several continents, feeds primarily on sorghum leaves and stems by sucking sap. This feeding behavior results in the depletion of nutrients, sugars, and water in the plants, leading to inhibited growth, chlorosis, wilting, and ultimately death. The main objective of this study was to assess the stability of potential reference genes in the sorghum aphid (Melanaphis sacchari). Nine candidate reference genes underwent a rigorous selection process, and their reliability was evaluated using qRT-PCR Ct values. Various experiments were conducted to determine the best reference genes for the sorghum aphid through systematic stability analyses. The research offers a dependable collection of reference genes that can improve studies on gene expression and functional genomics related to the sorghum aphid.

Abstract

Appropriate reference genes must be selected for accurate qRT-PCR data to conduct a thorough gene expression analysis in the sorghum aphid (Melanaphis sacchari, Hemiptera, Aphididae). This approach will establish a foundation for gene expression analysis and determines the efficacy of RNA interference in the sorghum aphid. Nine potential reference genes, including Actin, 18S, GAPDH, RPL7, EF-1α, EF-1β, 28S, HSP70, and TATA, were assessed under various experimental conditions to gauge their suitability based on qRT-PCR Ct values. The stability of these candidate reference genes in diverse experimental setups was analyzed employing several techniques, including the ΔCt comparative method, geNorm, Normfinder, BestKeeper, and RefFinder. The findings revealed that the quantity of ideal reference genes ascertained by the geNorm method for diverse experimental conditions remained consistent. For the developmental stages of the sorghum aphid, RPL7 and 18S proved to be the most dependable reference genes, whereas GAPDH and EF-1β were recommended as the most stable reference genes for different tissues. In experiments involving wing dimorphism, EF-1α and GAPDH were identified as the optimal reference gene pair. Under varying temperatures, EF-1α and EF-1β were found to be the most dependable gene pair. For studies focusing on insecticide susceptibility, 18S and TATA emerged as the most stable candidate reference genes. Across all experimental conditions, EF-1α and EF-1β was the optimal combination of reference genes in the sorghum aphid. This research has pinpointed stable reference genes that can be utilized across various treatments, thereby enhancing gene expression studies and functional genomics research on the sorghum aphid.

1. Introduction

Melanaphis sacchari is a harmful sorghum aphid (Hemiptera, Aphididae) and a major pest causing damage to forage crops such as sugarcane, wheat, corn, Sudan grass, peach, and others [1,2,3,4,5]. The damage results from the direct feeding and transmission of many plant viruses [6,7,8]. Additionally, the honeydew secreted by the aphid causes mildew disease during later growth stages, reducing forage crop yield and affecting quality and flavor [9]. Quantifying gene expression through real-time fluorescence quantitative polymerase chain reaction (qRT-PCR) analysis is dependable and reproducible [10,11,12]. This technique is valuable for assessing insect gene function and is effective in verifying gene expression [13,14]. However, difficulties persist in standardizing qRT-PCR data due to inconsistencies in sample amounts, RNA extraction methods, reverse transcription processes, and PCR amplification efficiency. Standard reference genes are employed to guarantee the accuracy of target gene expression results obtained from qRT-PCR analyses [14,15,16]. The ideal reference gene is one with consistent expression under all experimental conditions [17]. Research has demonstrated that reference gene expression stability is relative, and no single reference gene exhibits consistent expression under all experimental conditions, in all tissues, and across different species [18,19,20,21].
The consistent expression of a reference gene signifies stable expression within a specified range [22,23,24,25]. Actin (beta-actin gene) [26], 18S ribosomal (18S rRNA) [27], 28S ribosomal (28S rRNA) [28], glyceraldehyde-3-phosphate dehydrogenase (GAPDH) [29], alpha-tubulin (α-TUB) [30], TATA-box-binding protein (TATA) [31], ribosomal protein L7 (RPL7) [32], elongation factor 1 alpha (EF-1α) [33], elongation factor 1 beta (EF-1β) [34], ribosomal protein L18 (RPL18) [35], and various other genes are commonly used as reference genes in insects. Screening reference genes is crucial under specific experimental conditions, as some reference genes may not have consistent expression levels across all conditions [20]. To validate the chosen reference genes, the expression levels of Heat Shock Protein 70 (HSP70), a critical gene involved in the stress response, was utilized [36]. Researchers use different reference genes to study gene expression in different insect species. For example, reference genes have been described for model insects, such as Drosophila melanogaster, Nilaparvata lugens (Stal), and Tribolium castaneum [37,38,39], while reference genes for the sorghum aphid have not been documented. The stability of potential sorghum aphid genes will be analyzed in this study by measuring the Ct values of eight frequently used normalization genes (Actin, 18S, GAPDH, RPL7, EF-1α, EF-1β, 28S, and TATA) under various treatments. Consequently, the reference genes for the sorghum aphid under various treatments will be identified, laying the groundwork for subsequent studies of sorghum aphid gene function.

2. Materials and Methods

2.1. Insect Rearing

The sorghum aphids were collected from plantations at Anhui Science and Technology University, Fengyang County, Anhui Province, China. They were later raised on sweet sorghum seedlings in a controlled environment, maintaining a temperature of 24 ± 1 °C, relative humidity of 60 ± 10%, and a photoperiod of 14L: 10D. This setup allowed for continuous feeding over multiple generations. The developmental stages of the sorghum aphids encompassed five instars (1st, 2nd, 3rd, 4th instar, and adulthood), with the larval stage lasting 6–7 days and the overall lifespan of the sorghum aphid spanning 30–35 days.

2.2. Biotic Conditions

2.2.1. Developmental Stage

The sorghum aphid undergoes five stages of development, including first, second, third, fourth, and adult. The five instars of sorghum aphids were collected, and female aphids were transplanted onto sorghum leaves in vitro. After 12 h, the female aphids were removed, leaving behind the hatched nymphs. Five hundred first-instar and second-instar nymphs, as well as three hundred third-instar, fourth-instar, and adult aphids, were collected for the experiment. All of the aphids were subjected to three biological replications. Afterward, the specimens were stored at −80 degrees Celsius [10].

2.2.2. Tissue and Wing Dimorphism

Three distinct body regions, namely the head, legs, thorax, and abdomen, were isolated. Three hundred wingless aphids were dissected using tweezers under a stereomicroscope, with each sample being collected three times and stored as previously mentioned. Furthermore, fifty mature insects, both winged and wingless, were each gathered and placed in separate 1.5 mL centrifuge tubes. Each sample used in the study was duplicated three times and stored according to the previous instructions [17].

2.3. Abiotic Conditions

2.3.1. Temperature Treatment

The sorghum aphids were subjected to different temperatures (10, 18, 24, 30, and 35 °C) for 2 h. The experimental temperatures ranged from 10 to 35 °C. Each temperature treatment involved the repeated exposure of 50 aphids, with each sample collected three times and stored according to established protocols.

2.3.2. Insecticide Treatment

Initially imidacloprid was dissolved in acetone and then diluted with distilled water to achieve an LC concentration of 500.25 mg L−1. The sorghum seedlings infested with aphids were immersed in an imidacloprid solution for 10 s, while the control group of aphids were immersed in distilled water for the same duration. Following the treatment, the surviving sorghum aphids were selected after 24 h of pesticide treatment. The surviving aphids treated with imidacloprid were selected and control aphids were collected. All samples utilized in the experiment were replicated three times and stored per established procedures.

2.4. Total RNA Extraction and cDNA Synthesis

Total RNA was isolated from the M. sacchari sample with Trizol reagent (Tian gen Biochemical Technology, Beijing, China), followed by genomic DNA removal using DNaseΙ treatment (TAkara Bio, Beijing, China). RNA quantification was conducted using the Nanodrop 2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA). The first-strand complementary DNA (cDNA) was synthesized using the PrimeScriptR RT reagent kit and stored at −20 °C for further use.

2.5. Selection of Reference Genes and Design of the Primers

The nucleotide gene sequences of the sorghum aphid were obtained from the NCBI database (https://www.ncbi.nlm.nih.gov/datasets/genome/; accessed on 22 May 2023), with candidate reference genes primarily composed of Actin [26], 18S [27], GAPDH [29], RPL7 [32], EF-1 [33], EF-1β [34], 28S [28], TATA [31], and the selected target gene HSP70 [36]. Primers designed for the nine genes were constructed using Primer Premier 5.0, followed by traditional PCR cloning of the candidate genes and subsequent comparison and verification of the genetic sequences. The procedure involved creating primers to clone and identify potential reference genes for the sorghum aphid (Table 1).

2.6. Real-Time qPCR Analysis

The SYBR qPCR Master Mix from Vazyme Biotech was utilized for the real-time qPCR analysis, with the expression of candidate reference genes evaluated using the ViiA 7 system (ABI, Foster City, CA, USA). qRT-PCR reactions were performed according to the manufacturer’s guidance. The thermal cycling protocol included an initial denaturation at 95 °C for 30 s, followed by 40 cycles of denaturation at 95 °C for 10 s and annealing/extension at 60 °C for 30 s. After cycling, the melting curves were generated by increasing the temperature from 60 to 95 °C at a rate of 0.2 °C per second to dissociate double-stranded DNA. Relative standard curves were created by performing five-fold serial dilutions of cDNA (diluted 1, 5, 25, 125, and 625 times). The efficiency of amplification for the target genes was calculated by the formula E = 10(−1/Slope) − 1. Each sample was analyzed in three biological replicates, and each qRT-PCR reaction was conducted in triplicate [40].

2.6.1. Analysis of Expression Stability of Candidate Reference Genes

The Ct values derived from qRT-PCR were examined using several approaches, including the ΔCt method [15], geNorm (version v3.4) [41], Normfinder (version 20) [42], and BestKeeper (version 20) [43]. The reference genes were assessed with geNorm and NormFinder by converting the Ct values into 2ΔCt for further analysis. geNorm determines the Vn/Vn+1 pairwise variation, which reveals the difference between consecutive normalization factors, thereby identifying the optimal number of reference genes required for precise normalization. The Ct values were evaluated directly using the ΔCt and BestKeeper methods. The comprehensive final ranking was achieved using RefFinder. RefFinder is an extensive online tool designed to appraise and filter reference genes from extensive experimental datasets (https://blooge.cn/RefFinder/?type=reference; accessed on 22 January 2024). This software incorporates key computational tools, including geNorm, NormFinder, BestKeeper, and the comparative ΔCt method, to assess and rank potential reference genes. RefFinder utilizes the rankings generated by each tool to assign weights to the genes, then determining the final ranking by calculating the geometric mean of these weights.

2.6.2. Verification of the Stability of Selected Reference Genes

To validate the selected reference genes, the expression levels of HSP70, a key stress-responsive gene, were analyzed. HSP70 expression was assessed across different developmental stages, temperature variations, and insecticide treatments. The expression level of the HSP70 gene was determined using the 2−ΔΔCt method [44]. Statistical analysis of target gene expression levels was conducted using one-way ANOVA with SPSS Statistics 17.0, setting the significance threshold at p < 0.05.

3. Results

3.1. Cloning of the Candidate Genes and qRT-PCR Primer Selection

Primer sequences for the reference genes of the candidates were created using the gene sequence information from the NCBI database (Table 2). The potential genes were analyzed using RT-PCR. Subsequently, all amplicons were sequenced and were identical to their respective transcripts (see Supplementary Materials File S1 for details). Furthermore, every gene candidate was confirmed to be a sole amplicon of the accurate size through the utilization of 2% agarose gel electrophoresis. Fluorescent primers for qPCR were created based on sequence information, and the accuracy of the eight reference genes as well as the heat shock protein gene was verified for qRT-PCR. This validation was achieved by detecting a single peak in the melting curve analysis and observing distinct bands on an agarose gel. This validation was accomplished by identifying a sole peak in the melting curve analysis and observing clear bands on an agarose gel. A standard curve was generated using the Ct value on the y-axis and the logarithm of the relative copy number on the x-axis to evaluate the linearity of this correlation by determining. the slope of the linear equation and the regression coefficient (R2) [45]. The amplification efficiency of the potential reference genes varied between 101.577 and 108.547, while the correlation coefficients varied between 0.991 and 1.000. The primers for the potential reference genes and the gene encoding HSP were chosen.

3.2. Evaluation of the Levels of Gene Expression in Potential Reference Genes

The quantity of potential reference genes available is a key factor in the screening process [23]. The sorghum aphid exhibited Ct values between 15.80 and 27.967 for the eight potential reference genes, satisfying the required standards for gene expression as reference genes [12]. The EF-1α gene exhibited the smallest Ct value, suggesting the highest expression level, whereas the TATA gene displayed the largest Ct value, indicating the lowest expression level. Specifically, the expression levels of the EF-1α, EF-1β, GAPDH, and RPL7 genes were higher, whereas the gene expression levels of the Actin, TATA, 28S, and 18S genes were lower. These results demonstrate that the Ct values of the EF-1α, GAPDH, RPL7, and EF-1β genes were smaller than those of Actin and 18S, whereas the Ct values of TATA and 28S were larger (Figure 1).

3.3. Stability of the Reference Genes under Various Experimental Conditions

3.3.1. Development Stages

Four software programs, ΔCt, BestKeeper, NormFinder, and geNorm, were used to evaluate the stability ranking of potential reference genes across different developmental stages of the sorghum aphid. The RPL7 and EF-1β genes emerged as the most stable (Table 3 and Table 4). A detailed stability ranking of the eight candidate reference genes was generated through RefFinder analysis. The comprehensive stability ranking ordered the candidate reference genes as follows: RPL7, EF-1β, 18S, EF-1α, GAPDH, TATA, Actin, and 28S (Figure 2A), with 28S being the least stable. Additionally, the V2/3 value from geNorm software was <0.15 (Figure 3). Therefore, for quantifying gene expression levels across various developmental stages in the sorghum aphid, two genes, RPL7 and EF-1β, were selected as reference genes.

3.3.2. Different Tissue

According to the ΔCt and NormFinder evaluations (Table 3), the GAPDH, EF-1β, and TATA genes were the most reliable. The RefFinder results indicated that the GAPDH and EF-1β genes exhibited the highest stability, ranking in the order of stability as GAPDH, EF-1β, TATA, Actin, RPL7, 18S, EF-1α, and 28S (Figure 2B). Furthermore, the 28S gene showed the least stability. According to the geNorm analysis, the V2/3 pairwise variation value fell below the recommended threshold of 0.15 (Figure 3). Therefore, for effective normalization in this study, the use of GAPDH and EF-1β genes was essential (Table 4).

3.3.3. Wing Dimorphism

Based on analyses from ΔCt, geNorm, and NormFinder, EF-1α and GAPDH emerged as the most dependable genes (Table 3). Additionally, RefFinder analysis confirmed the robustness of EF-1α and GAPDH, ranking their stability as EF-1α > GAPDH > Actin > 18S > EF-1β > TATA > RPL7 > 28S (Figure 2C). Both the analytical software and RefFinder consistently revealed that the 28S gene had the lowest stability. Additionally, the geNorm analysis demonstrated that the V2/3 ratio was <0.15 (Figure 3), suggesting that two candidate reference genes would suffice for accurate normalization across various dimorphisms. Consequently, EF-1α and GAPDH were crucial for appropriate normalization in this scenario (Table 4).

3.3.4. Insecticide Treatment

Sorghum aphids treated with imidacloprid were compared with untreated aphids used as a control group. Candidate reference genes for assessing pesticide effects on sorghum aphids were identified. Analysis utilizing ΔCt, NormFinder, and additional software programs indicated that the TATA gene exhibited the greatest stability, whereas BestKeeper and geNorm recognized 18S as the most stable gene (Table 3 and Table 4). Gene stability was ranked by RefFinder in the following order from most stable to least stable as 18S, TATA, EF-1β, Actin, EF-1α, RPL7, GAPDH, and 28S (Figure 2D). Additionally, geNorm analysis underscored the importance of selecting two reference genes for accurate gene expression analysis in studies involving pesticide effects on sorghum aphids (Figure 3).

3.3.5. Temperature

The temperature conditions were set to 10, 18, 24, 30, and 35 °C, and third or fourth-instar aphids were exposed to these temperatures for 2 h in an artificial climate box. According to NormFinder and geNorm analyses, EF-1α showed the highest stability among the genes, while the ΔCt method identified EF-1β as the most reliable (Table 3). RefFinder’s assessment further detailed the stability ranking from most to least stable: EF-1α, EF-1β, GAPDH, TATA, 18S, RPL7, Actin, and 28S (Figure 2E). Consistently, the 28S gene was the most unstable gene at all temperatures and in every analysis. Additionally, according to the geNorm assessment, because the V2/3 ratio was <0.15 (Figure 3), It is advisable to utilize EF-1α and EF-1β for appropriate standardization within this specific group (Table 4).

3.3.6. RefFinder’s Comprehensive Ranking of Reference Genes

RefFinder determined that EF-1β and EF-1α were the most dependable genes (Table 4), with EF-1β being the most stable followed by EF-1β, EF-1α, GAPDH, 18S, TATA, RPL7, Actin, and 28S (Figure 2F). The geNorm program was utilized to assess the pairwise differences (Vn/Vn+1) among normalization factors NFn and NFn+1, identifying the ideal quantity of reference genes needed for accurate normalizationA value below 0.15 indicates that adding more reference genes would not significantly enhance normalization.

3.4. Selection Verification of Reference Genes

The HSP70 gene served as a validation marker to assess the stability of reference genes under various temperature conditions. RefFinder analysis identified EF-1α and EF-1β as suitable reference genes for studying HSP70 expression across different temperatures (Figure 4A). Interestingly, no significant differences in HSP70 expression were observed at lower temperatures (10 and 18 °C) compared to moderate temperature (24 °C) (p > 0.05). Similarly, there were no notable variations in HSP70 activity between 30 °C and 24 °C (p > 0.05). However, HSP70 expression was significantly higher in sorghum aphids at 35 °C than under other temperature conditions (p < 0.05).
Moreover, 18S and TATA were chosen as reference genes for the pesticide treatment assessment based on the RefFinder analysis. The level of HSP70 gene activity in sorghum aphids was established. The results indicate a significant increase in HSP70 levels in sorghum aphids that were exposed to imidacloprid compared to the control group (p < 0.05) (Figure 4B). HSP70 gene expression in aphids exposed to the pesticide increased 54.86-fold compared to the control group, demonstrating a significant physiological reaction from the sorghum aphids to the stress induced by the pesticide.

4. Discussion

Analysis of gene expression is paramount in contemporary biology and represents a central focus of ongoing research [45,46,47,48]. Such analyses are instrumental in comprehending the molecular mechanisms governing various processes related to insect growth and development [49]. qRT-PCR is the premier technique for measuring gene expression because of its exceptional sensitivity and efficiency [48,50]. It has been widely employed to measure mRNA expression levels under various experimental settings, as well as to evaluate the effectiveness of RNA interference [51]. It is important to recognize that the activity of certain target genes may be affected by control genes in a particular experimental context. Consequently, in biological experiments involving target insects, the use of distinct internal reference genes is imperative to ensure accurate analysis of target gene expression [52]. Various insect species, such as Tribolium castaneum [53], Apis mellifera [54], Nilaparvata lugens [55], and the cotton aphid [56], have had reference genes discovered. However, a lack of data exists on the suitable reference genes for the sorghum aphid, a pest that mainly affects forage crops like sorghum, sorghum Sudanense, and Sudan grass [57]. The stability of eight candidate reference genes was assessed for the sorghum aphid under different experimental conditions in this study.
Consistently, the V2/3 value stayed below 0.15 in every instance, as determined by geNorm software, suggesting that two reference genes were the best choice for all experiments. The geNorm software identified the best number of control genes for greenbug (Schizaphis graminum Rondani) and Aphidius gifuensis (Hymenoptera Aphidiidae). Notably, the ideal number of control genes for sorghum aphids matched those for S. graminum and A. gifuensis [10,58]. 28S and α-TUB were the best reference genes in S. graminum, while 28S was the least stable reference gene in sorghum aphid in different treatments [10]. A ccording to the RefFinder analysis, RPL7 and EF-1β were identified as the most dependable reference genes throughout different phases of sorghum aphids, with RPL7 also emerging as the preferred option for cotton aphids. Notably, the reference genes for cotton aphids were similar to those identified for sorghum aphids at different developmental stages [56]. GAPDH and EF-1β are the most stable genes across different tissue types, as supported by the ΔCt, BestKeeper, NormFinder, geNorm, and RefFinder analyses. EF-1α was consistently identified as a dependable control gene by NormFinder, geNorm, and RefFinder in relation to differences in wing morphology and temperature, while 18S and TATA showed the highest stability in response to insecticide exposure. RefFinder’s stability assessment determined that EF-1β and EF-1α are the most dependable genes in regards to stability. In contrast, the 28S gene was consistently unstable across various software analyses and was deemed unreliable as a reference gene for cotton aphids.
Molecular chaperones, known as Heat shock proteins (HSPs), are quickly produced when cells encounter a range of environmental stress conditions, including heat shock, cold exposure, insecticide exposure, heavy metal contamination, and diapause [59]. We analyzed the levels of HSP70 expression under various temperature and insecticide treatment scenarios to confirm the chosen reference genes. EF-1α and EF-1β were selected as the reference genes for the different temperature conditions during the evaluation of HSP70 expression. The findings reveal significantly higher HSP70 expression at 35 °C than at the other temperatures, aligning with previous research demonstrating the low tolerance of the sorghum aphid to high temperatures; 24 °C is the optimal temperature for sorghum aphids. Consequently, the substantial increase in HSP70 expression at 35 °C was a response to cope with the high-temperature environment. In addition to the environmental temperature, insecticide stress is a significant factor affecting insect responses. Non-lethal levels of beta-cypermethrin increase the expression levels of RpHSP70-1 and RpHSP70-2 in Rhopalosiphum padi [60]. After the insecticide treatment, HSP70 expression was examined using 18S and TATA as reference genes in sorghum aphids. These findings show that HSP70 gene expression increased by 54.86 times after exposure to the pesticide compared to the control group, demonstrating a physiological reaction of the sorghum aphid to stress caused by the pesticide.

5. Conclusions

The stability of nine genes used as reference were thoroughly assessed under various experimental conditions using five different methods. Consistently, the geNorm method determined the best number of reference genes for every experiment. During the course of development, RPL7 and EF-1β demonstrated strong reliability as reference genes. In various tissues, GAPDH and EF-1β exhibited stable expression. EF-1α and GAPDH were identified as the most effective reference gene pair for experiments related to wing dimorphism. EF-1α and EF-1β were found to be the most dependable gene pair under varying temperatures, with 18S and TATA consistently showing positive responses to insecticide exposure. EF-1α and EF-1β emerged as the optimal pair of reference genes for aphids in various experimental settings. This extensive research successfully pinpointed genes that remained constant under various treatment conditions, providing a strong foundation for future investigations into gene expression and functional genomics in the sorghum aphid.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/insects15070522/s1, File S1: the sequencing results of candidate reference genes and one heat shock protein gene HSP70 of sorghum aphid Melanaphis sacchari.

Author Contributions

Conceptualization: J.D. and D.W.; methodology: K.Z., T.W., M.G. and Y.L. (Yang Liu); software: K.Z., J.D. and M.G.; validation: J.D. and J.L.; formal analysis: J.L. and Y.L. (Yanlong Liu); investigation: M.G. and K.Z.; resources: D.W.; data curation: J.D.; writing—original draft preparation: J.D., K.Z., T.W., M.G., Y.L. (Yang Liu), J.L., Y.L. (Yanlong Liu) and D.W.; writing—review and editing: J.D., K.Z., T.W., M.G., Y.L. (Yang Liu), J.L., Y.L. (Yanlong Liu) and D.W.; visualization: D.W. and T.W.; supervision: J.D. and D.W.; project administration: J.D.; funding acquisition, J.D. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Natural Science Foundation of Education Department of Anhui Province (2023AH051852), Key Discipline Construction Fund for Crop Science of Anhui Science and Technology University (No. XK-XJGF001), and supported by Anhui Province International Joint Research Center of Forage Bio-breeding (No. AHIJRCFB202303).

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Acknowledgments

We acknowledge Guo-qing Li in Nanjing Agricultural University for providing experimental technical support.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Bowling, R.D.; Brewer, M.J.; Kerns, D.L.; Gordy, J.; Seiter, N.; Elliott, N.E.; Buntin, G.D.; Way, M.O.; Royer, T.A.; Biles, S.; et al. Sugarcane Aphid (Hemiptera: Aphididae): A New Pest on Sorghum in North America. J. Integr. Pest Manag. 2016, 7, 12. [Google Scholar] [CrossRef] [PubMed]
  2. Huang, J.; Shrestha, K.; Huang, Y. Revealing Differential Expression of Phytohormones in Sorghum in Response to Aphid Attack Using the Metabolomics Approach. Int. J. Mol. Sci. 2022, 23, 13782. [Google Scholar] [CrossRef] [PubMed]
  3. Keerthana, A.; Keerthana, M.; Shireesh Kumar, M.P.; Bahuguna, R.N.; Singh, S.K.; Rai, D.; Reddy, M.S.S. Characterizing and assessing the wheat-aphid complex under varying temperature and humidity. Cereal Res. Commun. 2023, 29, 259–268. [Google Scholar] [CrossRef]
  4. Liu, J.; Xie, J.; Khashaveh, A.; Zhou, J.; Zhang, Y.; Dong, H.; Cong, B.; Gu, S. Identification and Tissue Expression Profiles of Odorant Receptor Genes in the Green Peach Aphid Myzus persicae. Insects 2022, 13, 398. [Google Scholar] [CrossRef] [PubMed]
  5. Halawa, S. Susceptibility of Certain Corn Varieties to Infestation with Two Aphid Species in Qalubia Governorate. Ann. Agric. Sci. Moshtohor 2021, 59, 563–576. [Google Scholar] [CrossRef]
  6. Wilson, B.E.; Reay-Jones, F.P.F.; Lama, L.; Mulcahy, M.; Reagan, T.E.; Davis, J.A.; Yang, Y.; Wilson, L.T.; Musser, F. Influence of Sorghum Cultivar, Nitrogen Fertilization, and Insecticides on Infestations of the Sugarcane Aphid (Hemiptera: Aphididae) in the Southern United States. J. Econ. Entomol. 2020, 113, 1850–1857. [Google Scholar] [CrossRef] [PubMed]
  7. Liu, Y.; Xu, P.; Dai, H.; Wang, F.; Zong, H.; Yang, H.; Wang, L.; Graham, R.I.; Wang, X.; Zhang, Y.; et al. An aphid-transmitted polerovirus is mutualistic with its insect vector by accelerating population growth in both winged and wingless individuals. J. Plant Interact. 2024, 19, 2321151. [Google Scholar] [CrossRef]
  8. Yue, B.-S.; Nibouche, S.; Costet, L.; Holt, J.R.; Jacobson, A.; Pekarcik, A.; Sadeyen, J.; Armstrong, J.S.; Peterson, G.C.; McLaren, N.; et al. Invasion of sorghum in the Americas by a new sugarcane aphid (Melanaphis sacchari) superclone. PLoS ONE 2018, 13, e0196124. [Google Scholar]
  9. Brewer, M.J.; Gordy, J.W.; Kerns, D.L.; Woolley, J.B.; Rooney, W.L.; Bowling, R.D. Sugarcane Aphid Population Growth, Plant Injury, and Natural Enemies on Selected Grain Sorghum Hybrids in Texas and Louisiana. J. Econ. Entomol. 2017, 110, 2109–2118. [Google Scholar] [CrossRef]
  10. Zhang, B.-Z.; Liu, J.-J.; Yuan, G.-H.; Chen, X.-L.; Gao, X.-W. Selection and evaluation of potential reference genes for gene expression analysis in greenbug (Schizaphis graminum Rondani). J. Integr. Agric. 2018, 17, 2054–2065. [Google Scholar] [CrossRef]
  11. Zhang, P.; Chen, S.; Chen, S.; Zhu, Y.; Lin, Y.; Xu, X.; Liu, Z.; Zou, S. Selection and Validation of qRT-PCR Internal Reference Genes to Study Flower Color Formation in Camellia impressinervis. Int. J. Mol. Sci. 2024, 25, 3029. [Google Scholar] [CrossRef] [PubMed]
  12. Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef]
  13. Shakeel, M.; Rodriguez, A.; Tahir, U.B.; Jin, F. Gene expression studies of reference genes for quantitative real-time PCR: An overview in insects. Biotechnol. Lett. 2018, 40, 227–236. [Google Scholar] [CrossRef]
  14. Bagnall, N.H.; Kotze, A.C. Evaluation of reference genes for real-time PCR quantification of gene expression in the Australian sheep blowfly, Lucilia cuprina. Med. Vet. Entomol. 2010, 24, 176–181. [Google Scholar] [CrossRef]
  15. Kang, Z.W.; Liu, F.H.; Tian, H.G.; Zhang, M.; Guo, S.S.; Liu, T.X. Evaluation of the reference genes for expression analysis using quantitative real-time polymerase chain reaction in the green peach aphid, Myzus persicae. Insect Sci. 2017, 24, 222–234. [Google Scholar] [CrossRef] [PubMed]
  16. Bustin, S.A. Improving the quality of quantitative polymerase chain reaction experiments: 15 years of MIQE. Mol. Asp. Med. 2024, 96, 101249. [Google Scholar] [CrossRef]
  17. Zhang, Y.; Pan, H.; Yang, X.; Bidne, K.; Hellmich, R.L.; Siegfried, B.D.; Zhou, X. Selection of Reference Genes for RT-qPCR Analysis in the Monarch Butterfly, Danaus plexippus (L.), a Migrating Bio-Indicator. PLoS ONE 2015, 10, e0129482. [Google Scholar]
  18. Wang, G.; Cheng, H.; Li, M.; Zhang, C.; Deng, W.; Li, T. Selection and validation of reliable reference genes for Tolypocladium guangdongense gene expression analysis under differentially developmental stages and temperature stresses. Gene 2020, 734, 144380. [Google Scholar] [CrossRef]
  19. Chiu, J.; Gou, Y.; Gao, S.; Liu, A.; Sun, S.; Zhu, X.; Meng, Q.; Wang, Z. Identification and Evaluation of Reference Genes for Normalization of Gene Expression in Developmental Stages, Sexes, and Tissues of Diaphania caesalis (Lepidoptera, Pyralidae). J. Insect Sci. 2020, 20, 6. [Google Scholar]
  20. López-Martínez, G.; Velada, I.; Ragonezi, C.; Arnholdt-Schmitt, B.; Cardoso, H. Reference Genes Selection and Normalization of Oxidative Stress Responsive Genes upon Different Temperature Stress Conditions in Hypericum perforatum L. PLoS ONE 2014, 9, e115206. [Google Scholar]
  21. Nagy, N.A.; Németh, Z.; Juhász, E.; Póliska, S.; Rácz, R.; Kosztolányi, A.; Barta, Z. Evaluation of potential reference genes for real-time qPCR analysis in a biparental beetle, Lethrus apterus (Coleoptera: Geotrupidae). PeerJ 2017, 5, e4047. [Google Scholar] [CrossRef] [PubMed]
  22. Basu, S.; Pereira, A.E.; Pinheiro, D.H.; Wang, H.; Valencia-Jiménez, A.; Siegfried, B.D.; Louis, J.; Zhou, X.J.; Vélez, A.M. Evaluation of reference genes for real-time quantitative PCR analysis in southern corn rootworm, Diabrotica undecimpunc TATA howardi (Barber). Sci. Rep. 2019, 9, 10703. [Google Scholar] [CrossRef] [PubMed]
  23. Batista, D.S.; Moreira, V.S.; Felipe, S.H.S.; Fortini, E.A.; Silva, T.D.; Chagas, K.; Louback, E.; Romanel, E.; Costa, M.G.C.; Otoni, W.C. Reference gene selection for qRT-PCR in Brazilian-ginseng [Pfaffia glomerata (Spreng.) Pedersen] as affected by various abiotic factors. Plant Cell Tissue Organ Cult. 2019, 138, 97–107. [Google Scholar] [CrossRef]
  24. Cameron, R.C.; Duncan, E.J.; Dearden, P.K. Stable reference genes for the measurement of transcript abundance during larval caste development in the honeybee. Apidologie 2013, 44, 357–366. [Google Scholar] [CrossRef]
  25. Wang, Z.; Meng, Q.; Zhu, X.; Sun, S.; Gao, S.; Gou, Y.; Liu, A. Evaluation and Validation of Reference Genes for Quantitative Real-Time PCR in Helopeltis theivora Waterhouse (Hemiptera: Miridae). Sci. Rep. 2019, 9, 13291. [Google Scholar] [CrossRef] [PubMed]
  26. Geng, A.; Cheng, Y.; Wang, Y.; Zhu, D.; Le, Y.; Wu, J.; Xie, R.; Yuan, J.S.; Sun, J. Transcriptome analysis of the digestive system of a wood-feeding termite (Coptotermes formosanus) revealed a unique mechanism for effective biomass degradation. Biotechnol. Biofuels 2018, 11, 24. [Google Scholar] [CrossRef]
  27. Wang, W.A.; Liu, W.X.; Durnaoglu, S.; Lee, S.K.; Lian, J.; Lehner, R.; Ahnn, J.; Agellon, L.B.; Michalak, M. Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis. Sci. Rep. 2017, 7, 5941. [Google Scholar] [CrossRef]
  28. Bhanja, S.K.; Goel, A.; Pandey, N.; Mehra, M.; Majumdar, S.; Mandal, A.B. In ovo carbohydrate supplementation modulates growth and immunity-related genes in broiler chickens. J. Anim. Physiol. Anim. Nutr. 2015, 99, 163–173. [Google Scholar] [CrossRef]
  29. Chen, J.; Castelvecchi, G.D.; Li-Villarreal, N.; Raught, B.; Krezel, A.M.; McNeill, H.; Solnica-Krezel, L. Atypical Cadherin Dachsous1b Interacts with Ttc28 and Aurora B to Control Microtubule Dynamics in Embryonic Cleavages. Dev. Cell 2018, 45, 376–391.e5. [Google Scholar] [CrossRef]
  30. Seelan, R.S.; Pisano, M.M.; Greene, R.M.; Casanova, M.F.; Parthasarathy, R.N. Differential methylation of the gene encoding myo-inositol 3-phosphate synthase (Isyna1) in rat tissues. Epigenomics 2011, 3, 111–124. [Google Scholar] [CrossRef]
  31. Kermarrec, L.; Eissa, N.; Wang, H.; Kapoor, K.; Diarra, A.; Gounni, A.S.; Bernstein, C.N.; Ghia, J.E. Semaphorin-3E attenuates intestinal inflammation through the regulation of the communication between splenic CD11C(+) and CD4(+) CD25(-) T-cells. Br. J. Pharmacol. 2019, 176, 1235–1250. [Google Scholar] [CrossRef] [PubMed]
  32. Yoo, I.; Seo, H.; Choi, Y.; Jang, H.; Han, J.; Lee, S.; Choi, Y.; Ka, H. Analysis of interferon-γ receptor IFNGR1 and IFNGR2 expression and regulation at the maternal-conceptus interface and the role of interferon-γ on endometrial expression of interferon signaling molecules during early pregnancy in pigs. Mol. Reprod. Dev. 2019, 86, 1993–2004. [Google Scholar] [CrossRef] [PubMed]
  33. Zheng, W.; Peng, Z.; Peng, S.; Yu, Z.; Cao, Z. Multinuclei Occurred Under Cryopreservation and Enhanced the Pathogenicity of Melampsora larici-populina. Front. Microbiol. 2021, 12, 650902. [Google Scholar] [CrossRef]
  34. Øvrebø, J.I.; Campsteijn, C.; Kourtesis, I.; Hausen, H.; Raasholm, M.; Thompson, E.M. Functional specialization of chordate CDK1 paralogs during oogenic meiosis. Cell Cycle 2015, 14, 880–893. [Google Scholar] [CrossRef]
  35. Lim, L.; Ab Majid, A.H. Analysis of Transcriptome Difference between Blood-Fed and Starved Tropical Bed Bug, Cimex hemipterus (F.) (Hemiptera: Cimicidae). Insects 2022, 13, 387. [Google Scholar] [CrossRef]
  36. Kannan, U.; Sharma, R.; Gangola, M.P.; Ganeshan, S.; Båga, M.; Chibbar, R.N. Sequential expression of raffinose synthase and stachyose synthase corresponds to successive accumulation of raffinose, stachyose and verbascose in developing seeds of Lens culinaris Medik. J. Plant Physiol. 2021, 265, 153494. [Google Scholar] [CrossRef]
  37. Matta, B.P.; Bitner-Mathé, B.C.; Alves-Ferreira, M. Getting real with real-time qPCR: A case study of reference gene selection for morphological variation in Drosophila melanogaster wings. Dev. Genes Evol. 2011, 221, 49–57. [Google Scholar] [CrossRef] [PubMed]
  38. Lord, J.C.; Hartzer, K.; Toutges, M.; Oppert, B. Evaluation of quantitative PCR reference genes for gene expression studies in Tribolium castaneum after fungal challenge. J. Microbiol. Methods 2010, 80, 219–221. [Google Scholar] [CrossRef]
  39. Smagghe, G.; Zhu, X.; Yuan, M.; Shakeel, M.; Zhang, Y.; Wang, S.; Wang, X.; Zhan, S.; Kang, T.; Li, J. Selection and Evaluation of Reference Genes for Expression Analysis Using qRT-PCR in the Beet Armyworm Spodoptera exigua (Hübner) (Lepidoptera: Noctuidae). PLoS ONE 2014, 9, e84730. [Google Scholar]
  40. Hu, C.; Yang, J.; Qi, Z.; Wu, H.; Wang, B.; Zou, F.; Mei, H.; Liu, J.; Wang, W.; Liu, Q. Heat shock proteins: Biological functions, pathological roles, and therapeutic opportunities. MedComm 2022, 3, e161. [Google Scholar] [CrossRef]
  41. Jo, V.; Katleen, D.P.; Filip, P.; Bruce, P.; Nadine, V.R.; Anne, D.P.; Frank, S. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, RESEARCH0034. [Google Scholar]
  42. Andersen, C.L.; Jensen, J.L.; Orntoft, T.F. Normalization of Real-Time Quantitative Reverse Transcription-PCR Data: A Model-Based Variance Estimation Approach to Identify Genes Suited for Normalization, Applied to Bladder and Colon Cancer Data Sets. Cancer Res. 2004, 64, 5245–5250. [Google Scholar] [CrossRef] [PubMed]
  43. Pfaffl, M.W.; Tichopad, A.; Prgomet, C.; Neuvians, T.P. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper—Excel-based tool using pair-wise correlations. Biotechnol. Lett. 2004, 26, 509–515. [Google Scholar] [CrossRef] [PubMed]
  44. Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  45. Liu, Y.; Zhou, J.; Qiu, Z.; Hu, P.; Chen, X.; Yang, Z. Identification and Validation of Reference Genes for Expression Analysis Using RT-qPCR in Leptocybe invasa Fisher and La Salle (Hymenoptera: Eulophidae). Insects 2023, 14, 456. [Google Scholar] [CrossRef] [PubMed]
  46. Zheng, C.; Zhao, D.; Xu, Y.; Shi, F.; Zong, S.; Tao, J. Reference Gene Selection for Expression Analyses by qRT-PCR in Dendroctonus valens. Insects 2020, 11, 328. [Google Scholar] [CrossRef] [PubMed]
  47. Melcher, U.; Bai, B.; Ren, J.; Bai, F.; Hao, L. Selection and validation of reference genes for gene expression studies in Pseudomonas brassicacearum GS20 using real-time quantitative reverse transcription PCR. PLoS ONE 2020, 15, e0227927. [Google Scholar]
  48. Zhang, Y.; Lü, J.; Chen, S.; Guo, M.; Ye, C.; Qiu, B.; Yang, C.; Pan, H. Selection of appropriate reference genes for RT-qPCR analysis in Propylea japonica (Coleoptera: Coccinellidae). PLoS ONE 2018, 13, e0208027. [Google Scholar]
  49. Li, Y.; Yang, C.; Pan, H.; Liu, Y.; Zhou, X. Selection of Reference Genes for Expression Analysis Using Quantitative Real-Time PCR in the Pea Aphid, Acyrthosiphon pisum (Harris) (Hemiptera, Aphidiae). PLoS ONE 2014, 9, e110454. [Google Scholar]
  50. Buyuk, I.; Su, X.; Lu, L.; Li, Y.; Zhen, C.; Hu, G.; Jiang, K.; Yan, Y.; Xu, Y.; Wang, G.; et al. Reference gene selection for quantitative real-time PCR (qRT-PCR) expression analysis in Galium aparine L. PLoS ONE 2020, 15, e0226668. [Google Scholar]
  51. Zhang, S.; An, S.; Li, Z.; Wu, F.; Yang, Q.; Liu, Y.; Cao, J.; Zhang, H.; Zhang, Q.; Liu, X. Identification and validation of reference genes for normalization of gene expression analysis using qRT-PCR in Helicoverpa armigera (Lepidoptera: Noctuidae). Gene 2015, 555, 393–402. [Google Scholar] [CrossRef] [PubMed]
  52. Yu, S.-H.; Yang, P.; Sun, T.; Qi, Q.; Wang, X.-Q.; Xu, D.-L.; Chen, X.-M. Identification and evaluation of reference genes in the Chinese white wax scale insect Ericerus pela. SpringerPlus 2016, 5, 719. [Google Scholar] [CrossRef] [PubMed]
  53. Koch, E.L.; Guillaume, F. Additive and mostly adaptive plastic responses of gene expression to multiple stress in Tribolium castaneum. PLoS Genet. 2020, 16, e1008768. [Google Scholar] [CrossRef] [PubMed]
  54. Jeon, J.H.; Moon, K.; Kim, Y.; Kim, Y.H. Reference gene selection for qRT-PCR analysis of season- and tissue-specific gene expression profiles in the honey bee Apis mellifera. Sci. Rep. 2020, 10, 13935. [Google Scholar] [CrossRef] [PubMed]
  55. Lin, X.; Zhang, L.; Jiang, Y. Distinct Roles of Met and Interacting Proteins on the Expressions of takeout Family Genes in Brown Planthopper. Front. Physiol. 2017, 8, 100. [Google Scholar] [CrossRef] [PubMed]
  56. Zhang, Y.; Zhai, Y.; Lin, Q.; Zhou, X.; Zhang, X.; Liu, T.; Yu, Y. Identification and Validation of Reference Genes for Quantitative Real-Time PCR in Drosophila suzukii (Diptera: Drosophilidae). PLoS ONE 2014, 9, e106800. [Google Scholar]
  57. Guoqing, L.; Ruiheng, D.; Shenglin, H.; Peng, L.; Guisu, J.; Suying, L. Resistance to Aphids in Sorghum: A Review. Chin. Bull. Bot. 2012, 47, 171–187. [Google Scholar] [CrossRef]
  58. Schönbach, C.; Gao, X.-K.; Zhang, S.; Luo, J.-Y.; Wang, C.-Y.; Lü, L.-M.; Zhang, L.-J.; Zhu, X.-Z.; Wang, L.; Cui, J.-J. Identification and validation of reference genes for gene expression analysis in Aphidius gifuensis (Hymenoptera: Aphidiidae). PLoS ONE 2017, 12, e0188477. [Google Scholar]
  59. Zhou, C.; Yang, X.-b.; Yang, H.; Long, G.-y.; Wang, Z.; Jin, D.-c. Effects of abiotic stress on the expression of HSP70 genes in Sogatella furcifera (Horváth). Cell Stress Chaperones 2020, 25, 119–131. [Google Scholar] [CrossRef]
  60. Li, Y.; Zhao, Q.; Duan, X.; Song, C.; Chen, M. Transcription of four Rhopalosiphum padi (L.) heat shock protein genes and their responses to heat stress and insecticide exposure. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2017, 205, 48–57. [Google Scholar] [CrossRef]
Insects 15 00522 g001
Figure 1. Expression levels of candidate reference genes of Melanaphis sacchari indicated by Ct values.
Figure 1. Expression levels of candidate reference genes of Melanaphis sacchari indicated by Ct values.
Insects 15 00522 g001
Insects 15 00522 g002
Figure 2. Expression stabilities of the candidate reference genes under different experimental conditions calculated by RefFinder. (A) Different developmental stages. (B) Different tissues. (C) Wing dimorphism. (D) Insecticide treatments. (E) Temperature. (F) Pooled samples. A lower geomean of ranking value indicates more stable expression.
Figure 2. Expression stabilities of the candidate reference genes under different experimental conditions calculated by RefFinder. (A) Different developmental stages. (B) Different tissues. (C) Wing dimorphism. (D) Insecticide treatments. (E) Temperature. (F) Pooled samples. A lower geomean of ranking value indicates more stable expression.
Insects 15 00522 g002
Insects 15 00522 g003
Figure 3. Optimal numbers of reference genes for normalization in Melanaphis sacchari.
Figure 3. Optimal numbers of reference genes for normalization in Melanaphis sacchari.
Insects 15 00522 g003
Insects 15 00522 g004
Figure 4. Relative expression levels of an HSP70 target gene calculated using various sets of reference genes. (A) Expressions of HSP70 of sorghum aphid for different temperatures. (B) Expressions of HSP70 of sorghum aphid in insecticide treatment. Different lowercase letters represent differences in expression.
Figure 4. Relative expression levels of an HSP70 target gene calculated using various sets of reference genes. (A) Expressions of HSP70 of sorghum aphid for different temperatures. (B) Expressions of HSP70 of sorghum aphid in insecticide treatment. Different lowercase letters represent differences in expression.
Insects 15 00522 g004
Table 1. The primers for cloning and identification of candidate reference genes and one heat shock protein gene HSP70 of sorghum aphid Melanaphis sacchari.
Table 1. The primers for cloning and identification of candidate reference genes and one heat shock protein gene HSP70 of sorghum aphid Melanaphis sacchari.
GenesPrimer Sequences (5′-3′)GeneAccession No.Length (bp)
ActinF:TGCTGTCTTCCCGTCCATActinXM_025350371.1746
R:TTTCGTGGATACCGCAAG
18SF:TGGCAGTGTTGCTGAAGA18S ribosomalXM_025343011.1624
R:CCACTCCTTGATCGTCCT
GAPDHF:GTAGCCATCAATGACCCAGlyceraldehyde-3-phosphateXM_025343821700
R:GGCAGCACCTCTACCATC
RPL7F:ACGTAAGGCTCGTACAGCRibosomal protein L 7XM_025345708.1406
R:TGAAAGGCCAAAGGAAGT
EF-1αF:TCATTGACGCACCTGGACElongation factor 1 alphaXM_025346188.1574
R:AAGACCACAACCATACCG
EF-1βF:ATGGCTGCCGTTGACTTAElongation fator 1 betaXM_025337882.1644
R:TTGAATGCAGCAATGTCC
28SF:AAAAGGTCCTGGACGAAA28S ribosomalXM_025343486.11136
R:ACGCCATAACAGGTAACATAC
TATAF:GGATCAAATGTTACCGAGTCTATA box binding proteinXM_025347315.1828
R:CGTACTTTGGCACCTGTC
HSP70F:ATGGTCGGAAAGACTGCTATHeat Shock Protein 70XM_025350978.11004
R:ATGTCGTGGATGTCTCCCT
Table 2. The amplification efficiencies of qPCR primers of candidate reference genes and HSP 70 gene in sorghum aphid Melanaphis sacchari.
Table 2. The amplification efficiencies of qPCR primers of candidate reference genes and HSP 70 gene in sorghum aphid Melanaphis sacchari.
GenesPrimer Sequences (5′-3′)Accession No.Length (bp)Amplification Efficiency (%)R2
ActinF:TTTGGACTCAGGTGACGGTGXM_025350371.1166105.7970.9997
R:TTCACGCTCAGCAGTAGTGG
18SF:ACATTGGTGATGGCGTTCCAXM_025343011.1172104.6230.9993
R:AAGACTGCTCTAGCGTTGCG
GAPDHF:AGGTGTTCTCTGAACGCGACXM_02534382178105.6810.9990
R:CACCGGTGGATTCAACAACG
RPL7F:AACGCGCTGAAGCTTATGTTXM_025345708.1151105.5750.9997
R:GCCACTTGATTCACACCACG
EF-1αF:CAACTGACAAGGCTCTCCGTXM_025346188.177101.5770.9992
R:ACGACCAACTGGGACTGTTC
EF-1βF:TTTGCTGCGATTCAAGCACCXM_025337882.1141103.3750.9990
R:TGCAGCATTAGCCGAAGACA
28SF:GCTTGAGCAAGGTCACGTCTXM_025343486.1160102.7470.9997
R:CCAGTGAAACGCCTAGACCA
TATAF:GGTATGCACTGGCGCAAAAAXM_025347315.1167108.5470.9995
R:GTACCAATCCCTCAAGCCGT
HSP70F:CTGCGGAAAGCCCAAAATCCXM_025350978.1119109.3200.9943
R:TTCGTCAGCACCATCGAACT
Table 3. Expression stabilities of the candidate reference genes in Melanaphis sacchari under different experimental conditions by ΔCt, BestKeeper, NormFinder, and geNorm.
Table 3. Expression stabilities of the candidate reference genes in Melanaphis sacchari under different experimental conditions by ΔCt, BestKeeper, NormFinder, and geNorm.
TreatmentsGenesΔCtBestKeeperNormFindergeNorm
StabilityRankStabilityRankStabilityRankStabilityRank
Development
Stages		Actin0.96270.5720.31160.4816
18S0.82750.4510.29250.4185
GAPDH0.81740.7250.10710.3904
RPL70.77210.5830.27140.3212
EF-1α0.78430.8160.12320.2831
EF-1β0.77720.6740.15830.2831
28S3.02981.9482.25181.1777
TATA0.86960.9170.40870.3513
Different TissuesActin0.34040.3670.31940.0111
18S0.35050.3780.33250.0111
GAPDH0.26010.2050.04210.1263
RPL70.31030.3260.25330.0432
EF-1α0.39060.0820.35260.2896
EF-1β0.30010.0410.14520.2275
28S0.4770.1440.46570.3357
TATA0.2620.1430.04210.1724
Wing dimorphismActin1.05941.1520.06840.4554
18S1.14161.0110.06830.5525
GAPDH0.95421.4840.00120.0041
RPL71.31272.0771.02370.6466
EF-1α0.95211.4830.00110.0041
EF-1β1.02131.7250.52450.2282
28S4.48282.5684.00881.9317
TATA1.08951.8360.69360.3033
InsecticideActin0.19450.0640.09460.0442
18S0.25930.0110.03220.0161
GAPDH0.23570.1270.09450.1246
RPL70.20560.0750.11370.0523
EF-1α0.17620.0960.05240.1015
EF-1β0.16940.0330.02010.0714
28S0.24080.1880.16380.1537
TATA0.19910.0220.04930.0161
TemperatureActin0.80160.6570.30160.3295
18S0.95470.2710.16350.2213
GAPDH0.67240.3540.14440.1381
RPL70.65330.4960.08630.2564
EF-1α0.63220.3330.04810.1381
EF-1β0.62610.3220.05120.1752
28S2.83482.2382.14081.1597
TATA0.67350.3950.72770.5076
Table 4. Recommended reference genes in Melanaphis sacchari for the different experimental conditions.
Table 4. Recommended reference genes in Melanaphis sacchari for the different experimental conditions.
Biotic FactorReference GeneAbiotic FactorReference Gene
Developmental stageRPL7, EF-1βTemperatureEF-1α, EF-1β
TissueGAPDH, EF-1βInsecticide18S, TATA
Wing dimorphismEF-1α, GAPDHAll conditionsEF-1β, EF-1α
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zou, K.; Wang, T.; Guan, M.; Liu, Y.; Li, J.; Liu, Y.; Du, J.; Wu, D. Identification and Evaluation of qRT-PCR Reference Genes in Melanaphis sacchari. Insects 2024, 15, 522. https://doi.org/10.3390/insects15070522

AMA Style

Zou K, Wang T, Guan M, Liu Y, Li J, Liu Y, Du J, Wu D. Identification and Evaluation of qRT-PCR Reference Genes in Melanaphis sacchari. Insects. 2024; 15(7):522. https://doi.org/10.3390/insects15070522

Chicago/Turabian Style

Zou, Kunliang, Tonghan Wang, Minghui Guan, Yang Liu, Jieqin Li, Yanlong Liu, Junli Du, and Degong Wu. 2024. "Identification and Evaluation of qRT-PCR Reference Genes in Melanaphis sacchari" Insects 15, no. 7: 522. https://doi.org/10.3390/insects15070522

APA Style

Zou, K., Wang, T., Guan, M., Liu, Y., Li, J., Liu, Y., Du, J., & Wu, D. (2024). Identification and Evaluation of qRT-PCR Reference Genes in Melanaphis sacchari. Insects, 15(7), 522. https://doi.org/10.3390/insects15070522

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop