Next Article in Journal
Hermetia illucens in the Process of Kitchen Waste Biodegradation: The Effect of Different Approaches to Waste Storage on the Microbiological Profile and Nutritional Parameters of the Larvae
Previous Article in Journal
Differential Coding of Fruit, Leaf, and Microbial Odours in the Brains of Drosophila suzukii and Drosophila melanogaster
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Insects
Volume 16
Issue 1
10.3390/insects16010085
insects-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Mitochondrial Gene Expression of Three Different Dragonflies Under the Stress of Chlorpyrifos

by
Yuxin Chen
1,
Ziwen Yang
1,
Zhiqiang Guo
1,
Lemei Zhan
1,
Kenneth B. Storey
2,
Danna Yu
1,3 and
Jiayong Zhang
1,*
1
College of Life Sciences, Zhejiang Normal University, Jinhua 321004, China
2
Department of Biology, Carleton University, Ottawa, ON K1S 5B6, Canada
3
Key Lab of Wildlife Biotechnology, Conservation and Utilization of Zhejiang Province, Zhejiang Normal University, Jinhua 321004, China
*
Author to whom correspondence should be addressed.
Insects 2025, 16(1), 85; https://doi.org/10.3390/insects16010085
Submission received: 31 October 2024 / Revised: 13 January 2025 / Accepted: 13 January 2025 / Published: 16 January 2025
(This article belongs to the Section Insect Molecular Biology and Genomics)
Browse Figures
Versions Notes

Simple Summary

Mitochondrial genes can play a crucial role in insect resistance to pesticides. This study investigated the impact of chlorpyrifos (CPF) insecticide on the mitochondrial function of dragonflies by measuring changes in the transcript levels of mitochondrial protein-coding genes (mtPCGs) using the larvae of three dragonfly species (Anax parthenope, Epophthalmia elegans, and Gomphidia confluens). The study demonstrated that transcript levels of different mtPCGs from the three dragonfly species were significantly elevated in the presence of CPF, reflecting that these genes respond to varying levels of environmental contamination. These findings provide a new direction for pesticide detection in aquatic environments.

Abstract

Chlorpyrifos (CPF) is an organophosphate insecticide that is extensively utilized globally due to its effectiveness against over 200 pest species. CPF exhibits its toxicity primarily through the inhibition of the acetylcholinesterase (AChE) enzyme, while mitochondrial damage and dysfunction have also been observed. The present study quantified the transcript levels of mitochondria protein-coding genes (mtPCGs) using quantitative real-time polymerase chain reaction (RT-qPCR) in samples of larvae of three dragonfly species (A. parthenope, E. elegans, and G. confluens) under different levels of CPF stress. By exposing larvae from uncontaminated populations to 0.05 μg/L CPF for 24 h, the transcript levels of seven mtPCGs in A. parthenope were significantly increased (p < 0.05) by 1.89 ± 0.42-fold for COI, 4.30 ± 0.24-fold for COIII, 5.94 ± 0.17-fold for ND1, 4.69 ± 0.56-fold for ND2, 3.44 ± 0.48-fold for ND4, 2.19 ± 0.53-fold for ND4L, and 5.05 ± 0.36-fold for Cytb, respectively. In E. elegans, the transcript levels of ND1, ND2, and ND4 increased by 1.23 ± 0.15, 1.48 ± 0.31, and 1.98 ± 0.25-fold, respectively (p < 0.05). In G. confluens, the transcript levels of COI, COIII, and ND4 increased by 1.56 ± 0.13, 1.50 ± 0.26, and 3.74 ± 0.40-fold, respectively (p < 0.01). It was demonstrated that the transcript levels of different mtPCGs showed significant up-regulation in the three different dragonfly larvae under CPF stress in the absence of mortality. ND4 was significantly increased in all three species, indicating that it is an important target gene. The present study underscores the response of mitochondrial gene expression in larvae of three different species in response to CPF pollutants, indicating that pesticide influences can potentially alter mitochondrial gene expression and potentially act as a method for assessing aquatic ecosystem health.

1. Introduction

Chlorpyrifos is utilized in agricultural pest control through mechanisms of contact, ingestion, and gut toxicity, and fumigation [1]. Its toxicity is associated with various physiological and lifestyle-related disorders. These include neurological issues, endocrine disruption, hematological abnormalities, and reproductive problems [2]. CPF blocks the acetylcholinesterase (AChE) active site and interacts with neurotransmitter receptors. This leads to adverse neurological effects and significant toxicity in non-target organisms [3,4]. CPF primarily exerts its toxic effects by inhibiting AChE enzymes. These enzymes are involved in modulating neurotransmission through the hydrolysis of acetylcholine (ACh) [1,5]. Inhibition leads to the accumulation of Ach and over-stimulation of Ach receptors, potentially causing altered behavioral states, paralysis, and even death in exposed insects [6,7]. It has been shown that CPF stress alters the behavioral state of insects [8,9,10]. Despite its efficacy in pest control and subsequent improvement in crop yields, CPF has posed significant health risks to humans and other terrestrial animals. Additionally, unreasonable use of this chemical has led to environmental problems. The extensive application of CPF can lead to water contamination, with its presence detected in various aquatic environments such as rivers, lakes, seawater, and even rainfall [11].
One of the primary mechanisms underlying pesticide toxicity has been proposed to involve mitochondrial dysfunction [12]. CPF can induce mitochondrial dysfunction through several mechanisms, which can lead to a variety of adverse effects. The primary mechanism involved is the inhibition of AChE, but CPF also affects mitochondria directly. It can cause oxidative stress, which is one of the key factors leading to mitochondrial damage [13,14]. This stress is triggered by the generation of reactive oxygen species (ROS) that overwhelm the antioxidant defenses of cells, leading to lipid peroxidation, protein oxidation, and damage to mitochondrial genes [15,16,17,18]. To evaluate the long-term risks associated with CPF exposure more effectively, studies of its impact on mitogenomes are crucial.
Mitochondria are essential organelles within eukaryotic living organisms and are the primary sites responsible for both oxygen consumption and adenosine triphosphate (ATP) production, which serves as the energy currency of cells. Mitogenomes can facilitate phylogenetic, comparative genomic, and genetic barcoding analyses. As more and more mitogenomes have been sequenced (providing important sequence information), data have also been gathered on other aspects of mitochondrial genes, including replication strategies [19,20], transcriptional and translational architectures [21,22], mutational information [23,24,25], and arrangements [26,27,28,29,30]. Mitochondria adjust their oxidative phosphorylation process and regulate ATP production rates in response to environmental fluctuations, ensuring the maintenance of biophysiological stability [31,32]. CPF-induced apoptosis is associated with mitochondrial dysfunction through the generation of ROS [33,34]. ROS can impair mtDNA [35], membrane lipids [36], and proteins [37]. Additionally, environmental stressors can exacerbate these effects. Temperature fluctuations and chemical exposures generate unique DNA adducts, leading to significant mitochondrial dysfunction [38,39,40,41]. At extreme temperatures, mitochondrial activity adjusts to minimize damage, manifesting as alterations in gene expression, mtDNA levels, or phosphorylation efficiency [41,42,43,44,45,46]. Similarly, COI and 12S rRNA transcript levels decreased in the larvae of goldenrod gall insects under fluctuating oxygen levels [47]. Guan et al. [48] reported that exposure to imidacloprid resulted in altered mitochondrial gene expression in Choroterpes yixingensis. This finding underscores the vulnerability of aquatic insects, particularly when environmental contaminants such as pesticides are flushed into aquatic environments, disrupting mitochondrial energy metabolism and causing mtDNA damage [1,49,50,51,52]. Several studies have reported that CPF disrupts the electron transport chain (ETC) by impairing complex I and reducing antioxidant defenses essential for scavenging free radicals, leading to an increase in mitochondrial gene expression [34,53,54,55]. While extensive research has been conducted on stress resistance mechanisms in insects, much of the focus remains on detoxification processes and nuclear genome target genes. The response of the mitochondrial gene to insecticide stress remains an area that requires further investigation.
As hemimetabolous insects, dragonflies undergo a lifecycle that transitions from aquatic larvae to terrestrial adults, making them uniquely positioned to assess both aquatic and terrestrial environments. Although adults inhabit terrestrial environments, the larvae remain highly dependent on aquatic habitats and are extremely sensitive to changes in environmental conditions [56]. Due to these characteristics, dragonflies often serve as indicator species for evaluating ecological conditions [57]. Their observable biological responses enable intuitive assessments of local water quality and pollution levels [57]. Chang et al. found that CPF can disrupt physiological processes, potentially leading to long-term impacts on fitness and survival rates of species such as Ceriagrion species when exposed to environmental chemical stressors [58]. Furthermore, by assessing the species richness, abundance, and diversity of dragonflies, researchers have established a negative correlation between water pollution levels and dragonfly diversity [59,60]. Water contamination has also been quantified by analyzing the accumulation of heavy metals in dragonfly larvae [61]. Consequently, Odonata has been used as a standard environmental assessment tool for wetlands, as outlined in the Integrated Wetland Assessment Toolkit published by the International Union for Conservation of Nature (IUCN) in 2009 [62]. However, due to the varying environmental preferences and biological habits of the aquatic larvae of different dragonfly species, tolerance levels to environmental chemicals differ. Consequently, establishing an appropriate assessment standard presents a significant challenge. Species such as Ischnura elegans (Odonata: Zygoptera), which thrive in standing waters, exhibit tolerance to pollution and eutrophication [63]. This adaptability allows them to allocate part of their energy towards repairing and maintaining physiological integrity, highlighting the variability in species responses to environmental chemicals [64]. Even species that are closely related can exhibit markedly different levels of sensitivity to a pesticide [65]. Thus, the present study focuses on investigating the mitochondrial gene expression of three dragonfly species (Anax parthenope, Epophthalmia elegans, and Gomphidia confluens) under different concentrations of CPF stress using RT-qPCR. This work can enhance our understanding of the role that mitogenomes play in organismal tolerance to polluted environments.

2. Materials and Methods

2.1. Specimen Collection and CPF Treatment

Dragonfly larvae were all collected in the Agula Wetland Park from Tongliao (N 121°59′, E 42°59′), Inner Mongolia autonomous region, China. Specimens were identified at the species level based on the morphological features of the anterior, antenna, and anal appendages [66]. To minimize physiological and metabolic variations among larvae of different stages, we used a digital caliper to measure the head width and total length of each specimen (Table 1), ensuring that they were all in the ultimate instar. We identified that all specimens could be divided into A. parthenope, E. elegans, and G. confluens. After species identification, larvae were transferred to aerated aquaria at a controlled temperature of 24 °C (natural habitat) for one week to acclimate before exposure to experimentation. Larvae were fed by Hulk orange shrimp (Neocaridina denticulata) every day.
We first investigated the effect of low CPF concentration (0.05 µg/L), which is below the allowable environmental limit set in the United States [69], on the mitochondrial gene transcript levels of the three dragonfly species. We divided the 40 dragonfly larvae of each species into a control group and the three experimental groups (0.05 μg/L, 0.5 μg/L, and 5 μg/L), with ten larvae per group. Each group with ten larvae was bred in aquaria (80 × 50 × 50 cm) filled with 100 L of the aerated water. Moreover, CPF pesticide (CAS-No.: 2921-88-2, purity 98%; Shanghai Canspec Scientific Instruments Co., Ltd., Shanghai, China) was diluted with uncontaminated water and ethanol (analytical purity) to 500 mL at 5 μg/mL. The final test concentrations (0.05 μg/L, 0.5 μg/L, and 5 μg/L) were obtained by serial dilutions from a stock solution of 5 g/mL (uncontaminated water + ethanol). Based on the environmental allowable limit in the United States [69], the experimental groups were set to culture for 24 h under 0.05 μg/L, 0.5 μg/L, and 5 μg/L CPF, and the controls were kept in the same solution but CPF-free. We randomly selected four surviving individuals from each group (the individuals with similar genetic sequences) to be placed in an RNase-free environment rapidly dissected to obtain 15 ± 0.1 mg of gut tissue from individual specimens, which were immediately frozen in liquid nitrogen. Then, they were stored at −80 °C in the laboratory of JY Zhang, College of Life Sciences, Zhejiang Normal University, for further experiments.
To verify that the target genes obtained from our screening at low concentrations (0.5 μg/L) of CPF were effective target genes of CPF, we further tested these target gene expressions from larvae subjected to the 0.5 μg/L and 5 μg/L CPF stress, respectively. With other experimental conditions unchanged, the concentration of CPF stress was varied to determine if significant up-regulation of the target genes was also observed in the 0.5 μg/L and 5 μg/L CPF experimental groups.

2.2. DNA Extraction and Sequencing

Selection of all samples from each group of the three species for DNA extraction was performed. Muscle tissue from the legs of specimens was processed using the Ezup Column Animal Genomic DNA Purification Kit (Sangon Biotech Company, Shanghai, China). DNA barcoding was amplified using universal COI primers as described in Black et al. [70] with the forward primer (5′-GGTCAACAAATCATAAAGATATTGG-3′) and reverse primer (5′-TAAACTTCAGGGTGACCAAAAAATCA-3′). In addition, β-actin from the three species was chosen as the reference gene and successfully amplified by using forward primer (5′-CTTCCTTCCTGGGTATGG-3′) and reverse primer (5′-GCGGTGATTTCCTTCTGC-3′) [48]. Successful amplification of the target genes of the three species was evaluated using agarose gel electrophoresis. Then, all PCR products were sequenced by Youkang Biotech (Hangzhou, China). SeqMan in the DNASTAR package v.7.1 [71] was used to manually check and assemble Sanger sequencing results. The DNA samples of one individual of A. parthenope, E. elegans, and G. confluens were sequenced to obtain their mitogenomes using next-generation sequencing (NGS) at BGI Tech Inc. (Shenzhen, China). The obtained COI sequences served as a reliable indicator that the extracted DNA sample was free from contamination.

2.3. Mitogenome Assembly and Annotation

The complete mitogenomes of the three species were manually assembled using MitoZ [72], NOVOPlasty v.4.2 [73], and GetOrganelle v.1.7.1 [74], respectively, to ensure the accuracy of the results. The MITOS service (http://mitos.bioinf.uni-leipzig.de/index.py, accessed on 20 October 2023) [75] was used to determine the gene regions of tRNA and predict tRNA secondary structures. The sequence alignments with homologous genes of A. parthenope MT371045, E. elegans MK522522, and Davidius lunatus EU591677 were assessed using ClustalW in Mega v.7.0 [76] and could not only identify rRNA genes (12S rRNA and 16S rRNA) but also approximate the length and regions of the 13 mtPCGs. Subsequently, we manually annotated the approximate location of the 13 mtPCGs. The mitogenomes of G. confluens, A. parthenope, and E. elegans were deposited in the NCBI, with accession numbers PP577161, PP577162, and PP577163, respectively.

2.4. RNA Extraction, cDNA Synthesis, Primer Design

Following the instructions provided in the TaKaRa Mini BEST Universal RNA Extraction Kit (TaKaRa, Tokyo, Japan), we used four individuals per experimental group and the control group of three species with similar genetic sequences to extract RNA from the whole gut. The total RNA concentration was determined using an infinite M200pro enzyme label (Tecan, Ltd., Männedorf, Switzerland), and RNA purity was appraised using the A260/280 ratio (1.8~2.1). Then, we stored the RNA in an ultra-low temperature refrigerator at −80 °C.
Table 2. Primer sequences of the 10 mitochondrial PCGs used for RT-qPCR in this study. The β-actin gene was used as the reference gene.
Table 2. Primer sequences of the 10 mitochondrial PCGs used for RT-qPCR in this study. The β-actin gene was used as the reference gene.
GeneSpeciesGene Forward Primers (5′ to 3′)Reverse Primers (5′ to 3′)
β-actinA. parthenopeGAAACCGTCTACAACTCAATCAGCATCCTGTCAGCAATACC
G. confluensAACCGTCTACAACTCAATCATCCTTCTGCATCCTGTCA
E. elegansACCGTCTACAACTCCATCATGCATCCTGTCAGCAATACC
COIA. parthenopeTAGGAGCACCCGATATAGCCACCAGCAAGAGGAGGAT
G. confluensATACCACGACGATACTCTGAGTGCTGCTATGGCTTCTC
E. elegansGCTGGAATGGTTGGAACACGTGTGCTGTGACAATAAC
COIIA. parthenopeGCTTGAACTGTCCTTCCAACCACTGATGTCCTACTGT
G. confluensGAAGTAGATAACCGAGCAGTTGTCCTGGAGTTGCGTCTA
E. elegansAGGAGGACTTCGCTTACTTGTGTAGCATCAACCTTAACTC
COIIIA. parthenopeTTCACAGAAGTCTATCTCCAACGTTACAGTTACTCCTGATGCTA
G. confluensTGGTAATTGGACTACGATGAGCCTTAGGAGGTCATATACTTCC
E. elegansACCATTCACAATCGCAGATAAGGCAATGTCGTATTAAGC
ND1A. parthenopeGGTGGAGGATATATACTTGATGGCTAAACAAGACGCAAATCA
G. confluensTTGCTGGTTGGGCTTCTAACTCGTAAGCCTCCCAATAAAG
E. elegansTGCTGGATGAGCTTCTAATTCTATGAAATAGTCTGAGCCACAG
ND2A. parthenopeGCTGTAGGAGGACTTAATCACCAAGATGTCTAATGGAAGA
G. confluensCCAAGCTATTGCTTCAGTAATCGGAAATCAGAAATGGAAAGGAG
E. elegansATTTCCGGGAGTAATAGAAGGGTGTAGATAGAAGGACTGAAGT
ND3A. parthenopeCCACTGCACGTATTCCTTGCACCTTGATTTCATTCGT
G. confluensCCTACGATTCTTCTTGATTGCGGTAATGTTTGATGCGGTAAG
E. elegansGCACGAATCCCATTCTCTTTAAAGTAGGGCAATTTCCACATC
ND4A. parthenopeGGATTAAGTGGTGCCTATACTATAAACTACGACTCCCAAGAC
G. confluensGCTCCTATTTCTGGATCTATGACAACAACTCCTCCTACTAATCT
E. elegansGAGTTGGTATTGCTTTATTGGGACCTATATGAGCCACAGAAGA
ND5A. parthenopeGATAGAGTTGAAGCCCAAGTTAAAGGCAGATACAGGAGTAGG
G. confluensTTAGGATGAGATGGGTTAGGTCGATTAGAAAGCACAGTCAAC
E. elegansATGACTAAGAGTGCTCAGATTCAAGCAGATACAGGAGTAGGAG
Atp6A. parthenopeGGAACTACAGGACATAATGGAAGTGAATGCTAGATGACTTGAAC
G. confluensGCAGGACATCTTCTAATAACTCGCTACTGCGGATTCTAATACT
E. elegansTTACCAGAACCAGTCACATATCCTGAGGAACTAAATGAGCAAAC
Cyt bA. parthenopeGGGTGATTATTACGAACTCTTCCTACTCCTACACTTCAAGTATG
G. confluensCGGATGACTTCTACGAACATCTCCAACTCTTCAAGTGTGA
E. elegansCTGAGGAGCCACCGTAATGGCGTTATCTACTGCGAAT
According to the manufacturer’s instructions, 2 μL of 5 × gDNA Eraser Buffer, 1 μL gDNA Eraser, and 7 μL of a mixture containing RNase-Free ddH2O and RNA were mixed to a final volume of 10 μL and then heated at 42 °C for 2 min. Each mixture was then mixed with 1 μL Primer Script RT Enzyme Mix I, 1 μL RT Primer Mix I, 4 μL 5 × PrimerScript Buffer 2, and 4 μL RNase-free ddH2O to be reverse transcribed into cDNA. The reaction procedure was conducted at 37 °C for 15 min (reverse transcription reaction), 85 °C for 5 s (reverse transcriptase inactivation), and then stored in an ultra-low temperature refrigerator at −80 °C.
Primer Premier v.6.0 software (Premier Biosoft International, Palo Alto, CA, USA) was used to design valid primers for RT-qPCR based on the sequences of the 13 mtPCGs and the internal reference β-actin. The ATP8 fragment was too short for effective primer design, and ND3 and ND6 primers exhibited insufficient amplification efficiency for further experimental use. As a result, ten pairs of primers for the remaining PCGs as well as the β-actin gene are shown in Table 2, and all primers were synthesized by Sangon Biotech (Shanghai, China).
The reaction mixture configuration followed the method described by Guan et al. [48]: 2 μL cDNA, 6 μL ddH2O, 10 μL SYBR Premix Ex Taq II (2×), 0.4 μL ROX Reference Dye (50×), and 0.8 μL of each forward and reverse primer. The RT-qPCR conditions were 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 52 °C for 30 s, with melting curve analysis performed at 95 °C for 15 s, 60 °C for 1 min, and 95 °C for 15 s. In particular, samples for primer screening were diluted to five gradient concentrations, run in three technical replicates, and analyzed on an Applied Biosystems 7500 instrument. The results were assessed using StepOne software v.2.2.2 (Applied Biosystems, Foster City, CA, USA), and 11 pairs of fluorescent quantitative primers, including the β-actin gene, were validated based on the standard and melting curves (melting curves showing a single peak, standard curve R2 > 0.980, and E value between 90 and 110).

2.5. The Relative Transcription Levels of mtPCGs

The cDNAs obtained from RNA extraction and reverse transcription were diluted 10-fold. Subsequently, transcription levels were measured for 10 mtPCGs, with each gene repeated three times for four individuals from the experimental and control groups of each species. StepOne software v.2.2.2 (Applied Biological Systems, Foster City, CA, USA) was used to view and export the CT mean value. Gene expression was calculated using the 2−∆∆Ct method with β-actin as the reference gene. SPSS v.22.0 (SPSS, Inc., Chicago, IL, USA) was used to calculate. Values for each group are expressed as mean ± SE. Statistical differences between the CPF-treated samples at 0.05 μg/L, 0.5 μg/L, and 5 μg/L concentrations and the control group (without CPF) were evaluated using an independent t-test, where p < 0.05 was considered a significant difference. Finally, Origin v.8.0 software (Origin Lab, Northampton, MA, USA) and the pheatmap package in R software v.4.4.2 were used for data analysis and charting.

3. Results

3.1. Mitochondrial Gene Expression Under 0.05 µg/L CPF Stress

For A. parthenope, the transcript levels of COI, COIII, ND1, ND2, ND4, ND4L, and Cytb were significantly up-regulated (p < 0.01). Among them, the magnitude of the upward trend was high, increasing by 4.31 ± 0.24, 5.94 ± 0.17, 4.69 ± 0.56, 3.44 ± 0.48, and 5.05 ± 0.36 fold for COIII, ND1, ND2, ND4, and Cytb, respectively. The transcript levels of COI and ND4L genes were also significantly increased by 1.89 ± 0.42 and 2.19 ± 0.53 fold. In E. elegans, ND1, ND2, and ND4 were significantly increased by 1.23 ± 0.15, 1.48 ± 0.31, and 1.98 ± 0.25 fold (p < 0.05), respectively. For G. confluens, COI, COIII, and ND4 were significantly increased by 1.56 ± 0.13, 1.50 ± 0.26, and 3.74 ± 0.40 fold (p < 0.05), respectively (Figure 1).

3.2. Test the Target Gene Expressions Under 0.5 µg/L and 5 µg/L CPF Stress

To further investigate the expression mechanisms of genes with up-regulated transcript levels under 0.05 μg/L CPF stress, we further assessed the transcript levels of up-regulated genes under 0.5 μg/L and 5 μg/L CPF stresses. After 24 h all larvae of G. confluens and E. elegans were alive, whereas one larva of A. parthenope occurred death under 5 μg/L chlorpyrifos stress. In the 0.5 μg/L CPF group of A. parthenope, the transcript levels of several genes were still up-regulated significantly (p < 0.05). The transcript levels of COI, COIII, ND1, ND2, ND4, ND4L, and Cytb significantly increased by 1.83 ± 0.14, 2.63 ± 0.84, 2.18 ± 0.19, 3.57 ± 0.28, 1.74 ± 0.42, 2.75 ± 0.28, and 2.15 ± 0.51 fold, respectively (Figure 2). However, in the 5 μg/L experimental group, the transcript levels of COI, COIII, ND1, ND2, ND4, ND4L, and Cytb showed significant levels of reduction (p < 0.01), with the transcript levels of 0.28 ± 0.17, 0.36 ± 0.31, 0.28 ± 0.20, 0.19 ± 0.07, 0.15 ± 0.08, 0.20 ± 0.06, and 0.25 ± 0.16 fold, respectively (Figure 2). For E. elegans, the genes of ND1, ND2, and ND4 were also significantly up-regulated (p < 0.05). The transcript levels of ND1, ND2, and ND4 significantly increased by 6.68 ± 1.21, 6.89 ± 1.57, and 17.67 ± 5.35 fold, respectively (Figure 2). In the 5 μg/L experimental group, the transcript levels of ND1, ND2, and ND4 significantly increased by 2.19 ± 0.27, 2.04 ± 0.44, and 3.19 ± 0.69 fold, respectively (Figure 2). For G. confluens, both the experimental groups treated with 0.5 μg/L and 5 μg/L CPF were found to be significantly up-regulated in COI, COIII, and ND4 (p < 0.05) (Figure 2). In the 0.5 μg/L experimental group, the transcript levels of COI, COIII, and ND4 were significantly increased by 2.14 ± 0.45, 5.06 ± 0.51, and 3.62 ± 0.46 fold, respectively (Figure 2). In the 5 μg/L experimental group, the transcript levels of COI, COIII, and ND4 were increased by 2.23 ± 0.44, 1.51 ± 0.44, and 1.99 ± 0.18 fold, respectively (Figure 2).

4. Discussion

In this study, we initially investigated the transcript levels of 10 PCGs in three species of dragonfly larvae (A. parthenope, E. elegans, and G. confluens) when exposed to 0.05 μg/L CPF stress, a value that is under the environmental allowable limit in the United States [69]. The results indicated that CPF stress predominantly affected complex IV (COI and COIII), complex I (ND1, ND2, ND4, and ND4L), and complex III (Cytb) in A. parthenope. For E. elegans, CPF stress primarily affected complex I, as indicated by the elevated transcript levels of ND1, ND2, and ND4. For G. confluens, the higher transcript levels of COI, COIII, and ND4 suggested that CPF stress mainly impacted complex I and complex II. As the largest and first complex in the ETC, Complex I is crucial for oxidative phosphorylation and the transfer of electrons from NADH to coenzyme Q10 (CoQ10), which is essential for respiratory metabolism in many aerobic organisms [77,78]. Complexes III and IV collaborate with Complex I in this electron transfer [79], while CPF and other OPs can impair mitochondrial function by disrupting the ETC and oxidative phosphorylation [13,14]. When cells are exposed to CPF, the mitochondria become targets with ROS levels increasing significantly [80,81,82]. The increased expression of mitochondrial genes may be a response aimed at restoring mitochondrial function and mitigating damage by enhancing the repair mechanisms or by upregulating proteins involved in the ETC to compensate for reduced energy production [83].
In particular, we found that the ND4 gene exhibited significant upregulation in transcript levels in all three dragonfly species under CPF stress. This aligns with findings from Wang et al. [84], who reported elevated ND4 expression in porcine granulosa cells exposed to malathion, another OP, suggesting that ND4 upregulation may be a general response to OP-induced mitochondrial stress. Such mitochondrial stress responses are frequently observed in studies addressing both endogenous and exogenous antioxidant damage. For instance, Yan et al. [85] demonstrated that upregulation of mitochondrial ND4 expression alleviated exogenous oxidative damage in rats. The stress response, essential for preserving cellular homeostasis under oxidative stress, is predominantly regulated by heat shock proteins (Hsps) [86,87]. These proteins are typically upregulated under CPF-induced stress, a phenomenon observed in both fish and insects [1,88]. According to Cui et al., increased expression of mitochondrial chaperones such as Hsp75 serves as a compensatory mechanism to address mitochondrial dysfunction, either by assisting in protein refolding or promoting the degradation of damaged proteins [18]. Therefore, we believe that the upregulation of ND4 may be an effective cellular strategy to reduce ROS production and restore mitochondrial function. This suggests their potential involvement as target genes for monitoring exposure to insecticides.
Under higher concentrations (0.5 μg/L and 5 μg/L) of CPF, the target gene expressions were significantly induced. This suggested that these genes can indicate CPF contamination in a range of concentrations in the environment. However, among the three dragonfly species, only A. parthenope displayed a notable reduction in the transcript levels of genes and experienced larval mortality under 5 μg/L CPF stress (with one larva dying out of ten individuals). The sharp decline of genes in transcription levels and the mortality of larvae may be due to mitochondrial dysfunction induced by high CPF concentrations or through neurotransmission deterioration and oxidative damage [13]. Multiple studies found that increasing CPF exposure time or concentration leads to a corresponding rise in mortality, a decline in the activity of energy metabolism enzymes, and a downregulation of the expression of various other relevant genes [18,89,90]. It could be that excess pesticide exposure exacerbates ROS generation in dragonfly larvae, leading to mitochondrial membrane rupture and reduced transcript levels of mitochondrial PCGs [80,83,91]. This is also consistent with the reported mitochondrial dysfunction when exposed to CPF, with the appearance of fragmented mitochondrial structures [16]. The genes of A. parthenope to CPF showed sensitivity, as seen in Figure 1, which is likely due to various factors, including genetic differences, metabolic pathways, and detoxification mechanisms specific to each of the three species analyzed [65,92]. Whereas A. parthenope tends to cling to submerged vegetation, other species like E. elegans and G. confluens burrow or lie flat on the bottom substrate [92]. Several studies have revealed that aquatic insects that inhabit aquatic plants may experience reduced adverse effects from poisons due to the barrier effect of plants [93,94]. Conversely, bottom-dwelling insects are susceptible to pollutants accumulated in sediments and frequently exhibit a certain resistance to poisons [95]. This may explain why A. parthenope mitochondrial gene expression differs from that of other species.

5. Conclusions

In this study, after 24 h exposure to 0.05 μg/L CPF stress treatment, the transcript levels of several mitochondrial genes were significantly up-regulated in a species-specific pattern. Notably, the ND4 gene exhibited significant up-regulation of transcript levels in all three dragonfly species under chlorpyrifos exposure, suggesting that the sensitivity of ND4 to OP pesticides in insects is highly significant compared to other genes. The increased expression of genes associated with these ETC complexes may reflect an adaptive response to enhance respiratory rates and may contribute to resistance against low concentrations of CPF. Furthermore, by examining the effects of higher concentrations of CPF (0.5 µg /L and 5 µg /L) on transcript levels, it was found that, except for A. parthenope, that showed a significant decrease in transcript levels and increased larval mortality under 5 µg /L CPF stress, the transcript levels of all other genes remained significantly upregulated in the other species. This may indicate a protective or stress-responsive role in coping with CPF stress. Conversely, the larval mortality of A. parthenope and the down-regulation of genes may indicate that mitochondrial function is affected under CPF stress. These findings illuminate the effects of CPF on mitochondrial function in aquatic insects and provide new directions for pesticide detection in aquatic environments, exploring the potential of mitochondrial gene expressions as effective biomarkers for CPF.

Author Contributions

Conceptualization, J.Z., D.Y., Y.C. and Z.Y.; Methodology, Y.C., L.Z. and Z.Y.; Statistical analysis, Y.C., L.Z. and Z.Y.; Investigation, J.Z., D.Y. and K.B.S.; Data curation, Y.C., Z.Y., J.Z., Z.G. and D.Y.; Writing—original draft preparation, Y.C., J.Z., D.Y. and K.B.S.; Writing—review and editing, Y.C., Z.G., J.Z., K.B.S. and D.Y.; Maps and graphics, Y.C., L.Z. and Z.Y.; Project administration, J.Z., D.Y. and K.B.S.; funding acquisition, J.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Natural Science Foundation of Zhejiang Province (LY23C040002) and by the Natural Science Foundation of China (32470475). The funders had no role in the study design, data collection and analysis, or preparation of the manuscript.

Institutional Review Board Statement

All samples belong to non-protected invertebrate species, so no animal care protocol was needed.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data to support this study are available from the National Center for Biotechnology Information (https://www.ncbi.nlm.nih.gov) (accessed on 20 December 2024). The GenBank numbers are PP577161-PP577163.

Acknowledgments

Special thanks to Chen-Yang Shen and Jie-Hong Ji for the collection of samples and invaluable guidance.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Muñiz-González, A.-B.; Paoli, F.; Martínez-Guitarte, J.-L.; Lencioni, V. Molecular biomarkers as tool for early warning by chlorpyrifos exposure on Alpine chironomids. Environ. Pollut. 2021, 290, 118061. [Google Scholar] [CrossRef]
  2. Ubaid Ur Rahman, H.; Asghar, W.; Nazir, W.; Sandhu, M.A.; Ahmed, A.; Khalid, N. A comprehensive review on chlorpyrifos toxicity with special reference to endocrine disruption: Evidence of mechanisms, exposures and mitigation strategies. Sci. Total Environ. 2021, 755, 142649. [Google Scholar] [CrossRef]
  3. Tilton, F.A.; Bammler, T.K.; Gallagher, E.P. Swimming impairment and acetylcholinesterase inhibition in zebrafish exposed to copper or chlorpyrifos separately, or as mixtures. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2011, 153, 9–16. [Google Scholar] [CrossRef]
  4. Kumar, V.; Sharma, N.; Sharma, P.; Pasrija, R.; Kaur, K.; Umesh, M.; Thazeem, B. Toxicity analysis of endocrine disrupting pesticides on non-target organisms: A critical analysis on toxicity mechanisms. Toxicol. Appl. Pharmacol. 2023, 474, 116623. [Google Scholar] [CrossRef]
  5. Flaskos, J. The developmental neurotoxicity of organophosphorus insecticides: A direct role for the oxon metabolites. Toxicol. Lett. 2012, 209, 86–93. [Google Scholar] [CrossRef]
  6. Costa, L.G. Organophosphorus compounds at 80: Some old and new issues. Toxicol. Sci. 2018, 162, 24–35. [Google Scholar] [CrossRef]
  7. Smallman, B.N.; Fisher, R.W. Effect of anticholinesterases on acetylcholini levels in insects. Canad. J. Biochem. Physiol. 1958, 36, 575–586. [Google Scholar] [CrossRef]
  8. Adedara, I.A.; Rosemberg, D.B.; de Souza, D.; Farombi, E.O.; Aschner, M.; Souza, D.O.; Rocha, J.B.T. Neurobehavioral and biochemical changes in Nauphoeta cinerea following dietary exposure to chlorpyrifos. Pestic. Biochem. Physiol. 2016, 130, 22–30. [Google Scholar] [CrossRef]
  9. Di Nica, V.; González, A.B.M.; Lencioni, V.; Villa, S. Behavioural and biochemical alterations by chlorpyrifos in aquatic insects: An emerging environmental concern for pristine Alpine habitats. Environ. Sci. Pollut. Res. Int. 2020, 27, 30918–30926. [Google Scholar] [CrossRef]
  10. Plata-Rueda, A.; Menezes, C.H.M.; Cunha, W.S.; Alvarenga, T.M.; Barbosa, B.F.; Zanuncio, J.C.; Martínez, L.C.; Serrão, J.E. Side-effects caused by chlorpyrifos in the velvetbean caterpillar Anticarsia gemmatalis (Lepidoptera: Noctuidae). Chemosphere 2020, 259, 127530. [Google Scholar] [CrossRef]
  11. Huang, X.; Cui, H.; Duan, W. Ecotoxicity of chlorpyrifos to aquatic organisms: A review. Ecotoxicol. Environ. Saf. 2020, 200, 110731. [Google Scholar] [CrossRef]
  12. Lee, G.H.; Choi, K.C. Adverse effects of pesticides on the functions of immune system. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2020, 235, 108789. [Google Scholar] [CrossRef]
  13. Ibrahim, K.; Abdelrahman, S.; Elhakim, H.; Ragab, E. Single or combined exposure to chlorpyrifos and cypermethrin provoke oxidative stress and downregulation in monoamine oxidase and acetylcholinesterase gene expression of the rat’s brain. Environ. Sci. Pollut. Res. Int. 2020, 27, 12692–12703. [Google Scholar] [CrossRef]
  14. Kao, S.H.; Shofer, F.S.; Greenwood, J.C.; Alomaja, O.; Ranganathan, A.; Piel, S.; Mesaros, C.; Shin, S.S.; Ehinger, J.K.; Kilbaugh, T.J.; et al. Cell-free DNA as a biomarker in a rodent model of chlorpyrifos poisoning causing mitochondrial dysfunction. J. Med. Toxicol. 2023, 19, 352–361. [Google Scholar] [CrossRef]
  15. Crumpton, T.L.; Seidler, F.J.; Slotkin, T.A. Is oxidative stress involved in the developmental neurotoxicity of chlorpyrifos? Dev. Brain Res. 2000, 121, 189–195. [Google Scholar] [CrossRef] [PubMed]
  16. Thosapornvichai, T.; Huangteerakul, C.; Jensen, A.N.; Jensen, L.T. Mitochondrial dysfunction from malathion and chlorpyrifos exposure is associated with degeneration of GABAergic neurons in Caenorhabditis elegans. Environ. Toxicol. Pharmacol. 2022, 96, 104000. [Google Scholar] [CrossRef]
  17. Gupta, S.C.; Mishra, M.; Sharma, A.; Deepak Balaji, T.G.; Kumar, R.; Mishra, R.K.; Chowdhuri, D.K. Chlorpyrifos induces apoptosis and DNA damage in Drosophila through generation of reactive oxygen species. Ecotoxicol. Environ. Saf. 2010, 73, 1415–1423. [Google Scholar] [CrossRef]
  18. Cui, J.; Hao, Z.; Zhou, Q.; Qiu, M.; Liu, Y.; Liu, Y.; Teng, X.; Kang, L. Chlorpyrifos induced autophagy and mitophagy in common carp livers through AMPK pathway activated by energy metabolism disorder. Ecotoxicol. Environ. Saf. 2023, 258, 114983. [Google Scholar] [CrossRef]
  19. Falkenberg, M.; Larsson, N.-G.; Gustafsson, C.M. DNA replication and transcription in mammalian mitochondria. Annu. Rev. Biochem. 2007, 76, 679–699. [Google Scholar] [CrossRef] [PubMed]
  20. Yasukawa, T.; Kang, D. An overview of mammalian mitochondrial DNA replication mechanisms. J. Biochem. 2018, 164, 183–193. [Google Scholar] [CrossRef]
  21. D’Souza, A.R.; Minczuk, M. Mitochondrial transcription and translation: Overview. Essays Biochem. 2018, 62, 309–320. [Google Scholar]
  22. Hillen, H.S.; Temiakov, D.; Cramer, P. Structural basis of mitochondrial transcription. Nat. Struct. Mol. Biol. 2018, 25, 754–765. [Google Scholar] [CrossRef]
  23. Ruiz-Pesini, E.; Lott, M.T.; Procaccio, V.; Poole, J.C.; Brandon, M.C.; Mishmar, D.; Yi, C.; Kreuziger, J.; Baldi, P.; Wallace, D.C. An enhanced MITOMAP with a global mtDNA mutational phylogeny. Nucleic Acids Res. 2007, 35, D823–D828. [Google Scholar] [CrossRef] [PubMed]
  24. Tuppen, H.A.L.; Blakely, E.L.; Turnbull, D.M.; Taylor, R.W. Mitochondrial DNA mutations and human disease. Biochim. Biophys. Acta Bioenerg. 2010, 1797, 113–128. [Google Scholar] [CrossRef] [PubMed]
  25. Wallace, D.C. Mitochondrial DNA mutations in disease and aging. Environ. Mol. Mutag. 2010, 51, 440–450. [Google Scholar] [CrossRef]
  26. Hong, Y.H.; Huang, H.M.; Wu, L.; Storey, K.B.; Zhang, J.Y.; Zhang, Y.P.; Yu, D.N. Characterization of two mitogenomes of Hyla sanchiangensis (Anura: Hylidae), with phylogenetic relationships and selection pressure analyses of Hylidae. Animals 2023, 13, 1593. [Google Scholar] [CrossRef]
  27. Shen, S.Q.; Cai, Y.Y.; Xu, K.K.; Chen, Q.P.; Cao, S.S.; Yu, D.N.; Zhang, J.Y. The complete mitochondrial genome of Pedetontus zhejiangensis (Microcoryphia: Machilidae) and its phylogeny. Mitochondrial DNA Part B 2020, 5, 3143–3145. [Google Scholar] [CrossRef]
  28. Xu, X.D.; Guan, J.Y.; Zhang, Z.Y.; Cao, Y.R.; Cai, Y.Y.; Storey, K.B.; Yu, D.N.; Zhang, J.Y. Insight into the phylogenetic relationships among three subfamilies within Heptageniidae (Insecta: Ephemeroptera) along with low-temperature selection pressure analyses using mitogenomes. Insects 2021, 12, 656. [Google Scholar] [CrossRef] [PubMed]
  29. Yuan, Y.; Zhang, L.; Li, K.; Hong, Y.; Storey, K.B.; Zhang, J.; Yu, D. Nine mitochondrial genomes of phasmatodea with two novel mitochondrial gene rearrangements and phylogeny. Insects 2023, 14, 485. [Google Scholar] [CrossRef]
  30. Li, K.; Yu, S.W.; Hu, H.; Feng, Y.F.; Storey, K.B.; Ma, Y.; Zhang, J.Y.; Yu, D.N. The phylogenetic relationship of Lamiinae (Coleoptera: Cerambycidae) using mitochondrial genomes. Genes 2024, 15, 13. [Google Scholar] [CrossRef] [PubMed]
  31. Bennett, C.F.; Latorre-Muro, P.; Puigserver, P. Mechanisms of mitochondrial respiratory adaptation. Nat. Rev. Mol. Cell Biol. 2022, 23, 817–835. [Google Scholar] [CrossRef]
  32. Zhao, R.Z.; Jiang, S.; Zhang, L.; Yu, Z.B. Mitochondrial electron transport chain, ROS generation and uncoupling (Review). Int. J. Mol. Med. 2019, 44, 3–15. [Google Scholar] [CrossRef] [PubMed]
  33. Boveris, A. Mitochondrial production of superoxide radical and hydrogen peroxide. Adv. Exp. Med. Biol. 1977, 78, 67–82. [Google Scholar]
  34. Lee, J.E.; Park, J.H.; Shin, I.C.; Koh, H.C. Reactive oxygen species regulated mitochondria-mediated apoptosis in PC12 cells exposed to chlorpyrifos. Toxicol. Appl. Pharm. 2012, 263, 148–162. [Google Scholar] [CrossRef]
  35. Quan, Y.; Xin, Y.; Tian, G.; Zhou, J.; Liu, X. Mitochondrial ROS-modulated mtDNA: A potential target for cardiac aging. Oxidative Med. Cell Longev. 2020, 2020, 9423593. [Google Scholar] [CrossRef]
  36. Guderley, H. Metabolic responses to low temperature in fish muscle. Biol. Rev. 2004, 79, 409–427. [Google Scholar] [CrossRef] [PubMed]
  37. Roede, J.R.; Jones, D.P. Reactive species and mitochondrial dysfunction: Mechanistic significance of 4-hydroxynonenal. Environ. Mol. Mutagen. 2010, 51, 380–390. [Google Scholar] [CrossRef]
  38. Swenberg, J.A.; Lu, K.; Moeller, B.C.; Gao, L.; Upton, P.B.; Nakamura, J.; Starr, T.B. Endogenous versus exogenous DNA adducts: Their role in carcinogenesis, epidemiology, and risk assessment. Toxicol. Sci. 2011, 120 (Suppl. S1), S130–S145. [Google Scholar] [CrossRef]
  39. Slimen, I.B.; Najar, T.; Ghram, A.; Dabbebi, H.; Mrad, M.B.; Abdrabbah, M. Reactive oxygen species, heat stress and oxidativeinduced mitochondrial damage. Rev. Int. J. Hyperth. 2014, 30, 513–523. [Google Scholar] [CrossRef]
  40. Syromyatnikov, M.Y.; Gureev, A.P.; Starkova, N.N.; Savinkova, O.V.; Starkov, A.A.; Lopatin, A.V.; Popov, V.N. Method for detection of mtDNA damages for evaluating of pesticides toxicity for bumblebees (Bombus terrestris L.). Pestic. Biochem. Physiol. 2020, 169, 104675. [Google Scholar] [CrossRef] [PubMed]
  41. Roubicek, D.A.; de Souza-Pinto, N.C. Mitochondria and mitochondrial DNA as relevant targets for environmental contaminants. Toxicology 2017, 391, 100–108. [Google Scholar] [CrossRef] [PubMed]
  42. Hong, Y.H.; Yuan, Y.N.; Li, K.; Storey, K.B.; Zhang, J.Y.; Zhang, S.S.; Yu, D.N. Differential mitochondrial genome expression of four hylid frog species under low-temperature stress and its relationship with amphibian temperature adaptation. Int. J. Mol. Sci. 2024, 25, 5967. [Google Scholar] [CrossRef] [PubMed]
  43. He, J.Y.; Zhan, L.M.; Meng, S.Q.; Wang, Z.; Gao, L.L.; Wang, W.J.; Storey, K.B.; Zhang, Y.P.; Yu, D.N. Differential mitochondrial genome expression of three sympatric lizards in response to low-temperature stress. Animals 2024, 14, 1158. [Google Scholar] [CrossRef]
  44. Wang, J.Y.; Zhang, L.H.; Hong, Y.H.; Cai, L.N.; Storey, K.B.; Zhang, J.Y.; Zhang, S.S.; Yu, D.N. How does mitochondrial protein-coding gene expression in Fejervarya kawamurai (Anura: Dicroglossidae) respond to extreme temperatures? Animals 2023, 13, 3015. [Google Scholar] [CrossRef]
  45. Zhan, L.M.; He, J.Y.; Meng, S.Q.; Guo, Z.Q.; Chen, Y.X.; Storey, K.B.; Zhang, J.Y.; Yu, D.N. Mitochondrial protein-coding gene expression in the lizard Sphenomorphus incognitus (Squamata:Scincidae) responding to different temperature stresses. Animals 2024, 14, 1671. [Google Scholar] [CrossRef] [PubMed]
  46. Cai, L.N.; Zhang, L.H.; Lin, Y.J.; Wang, J.Y.; Storey, K.B.; Zhang, J.Y.; Yu, D.N. Two-fold ND5 genes, three-fold control regions, lncRNA, and the “missing” ATP8 found in the mitogenomes of Polypedates megacephalus (Rhacophridae: Polypedates). Animals 2023, 13, 2857. [Google Scholar] [CrossRef]
  47. McMullen, D.; Storey, K.B. Mitochondria of cold hardy insects: Responses to cold and hypoxia assessed at enzymatic, mRNA and DNA levels. Insect Biochem. Mol. Biol. 2008, 38, 367–373. [Google Scholar] [CrossRef]
  48. Guan, J.Y.; Zhang, Z.Y.; Cao, Y.R.; Xu, X.D.; Storey, K.B.; Yu, D.N.; Zhang, J.Y. The complete mitochondrial genome of Choroterpes (Euthralus) yixingensis (Ephemeroptera: Leptophlebiidae) and its mitochondrial protein-coding gene expression under imidacloprid stress. Gene 2021, 800, 145833. [Google Scholar] [CrossRef] [PubMed]
  49. Dewer, Y.; Pottier, M.A.; Lalouette, L.; Maria, A.; Dacher, M.; Belzunces, L.P.; Kairo, G.; Renault, D.; Maibeche, M.; Siaussat, D. Behavioral and metabolic effects of sublethal doses of two insecticides, chlorpyrifos and methomyl, in the Egyptian cotton leafworm, Spodoptera littoralis (Boisduval) (Lepidoptera: Noctuidae). Environ. Sci. Pollut. Res. Int. 2016, 23, 3086–3096. [Google Scholar] [CrossRef]
  50. Russo, R.; Haange, S.B.; Rolle-Kampczyk, U.; von Bergen, M.; Becker, J.M.; Liess, M. Identification of pesticide exposure-induced metabolic changes in mosquito larvae. Sci. Total Environ. 2018, 643, 1533–1541. [Google Scholar] [CrossRef]
  51. Rodrigues, A.C.; Gravato, C.; Quintaneiro, C.; Bordalo, M.D.; Golovko, O.; Žlábek, V.; Barata, C.; Soares, A.M.; Pestana, J.L. Exposure to chlorantraniliprole affects the energy metabolism of the caddisfly Sericostoma vittatum. Environ. Toxicol. Chem. 2017, 36, 1584–1591. [Google Scholar] [CrossRef]
  52. Ding, Y.R.; Yan, Z.T.; Si, F.L.; Li, X.D.; Mao, Q.M.; Asghar, S.; Chen, B. Mitochondrial genes associated with pyrethroid resistance revealed by mitochondrial genome and transcriptome analyses in the malaria vector Anopheles sinensis (Diptera: Culicidae). Pestic. Manag. Sci. 2019, 76, 769–778. [Google Scholar] [CrossRef]
  53. Hroudová, J.; Fišar, Z.; Korábečný, J.; Kuča, K. In vitro effects of acetylcholinesterase inhibitors and reactivators on Complex I of electron transport chain. Neuroendocrinol. Lett. 2011, 32, 259–263. [Google Scholar]
  54. Piruat, J.I.; López-Barneo, J. Oxygen tension regulates mitochondrial DNA-encoded complex I gene expression. J. Biol. Chem. 2005, 280, 42676–42684. [Google Scholar] [CrossRef]
  55. Khambay, B.P.; Jewess, P. The potential of natural naphthoquinones as the basis for a new class of pest control agents—An overview of research at IACR-Rothamsted. Crop. Prot. 2000, 19, 597–601. [Google Scholar] [CrossRef]
  56. Remsburg, A.J.; Olson, A.C.; Samways, M.J. Shade alone reduces adult dragonfly (Odonata: Libellulidae) abundance. J. Insect Behav. 2008, 21, 460–468. [Google Scholar] [CrossRef]
  57. Balian, E.V.; Segers, H.; Lévéque, C.; Martens, K. The freshwater animal diversity assessment: An overview of the results. Hydrobiologia 2008, 595, 627–637. [Google Scholar] [CrossRef]
  58. Chang, X.; Zhai, B.; Wang, M.; Wang, B. Relationship between exposure to an insecticide and fluctuating asymmetry in a damselfly (Odonata, Coenagriidae). Hydrobiologia 2007, 586, 213–220. [Google Scholar] [CrossRef]
  59. Gómez-Anaya, J.A.; Novelo-Gutiérrez, R. A case of successful restoration of a tropical wetland, evaluated through its Odonata (Insecta) larval assemblage. Rev. Biol. Trop. 2015, 63, 1043–1058. [Google Scholar] [CrossRef]
  60. Gómez-Tolosa, M.; Rivera-Velázquez, G.; Rioja-Paradela, T.M.; Mendoza-Cuenca, L.F.; Tejeda-Cruz, C.; López, S. The use of Odonata species for environmental assessment: A meta-analysis for the Neotropical region. Environ. Sci. Pollut. Res. Int. 2021, 28, 1381–1396. [Google Scholar] [CrossRef] [PubMed]
  61. Janssen, S.E.; Kotalik, C.J.; Willacker, J.J.; Tate, M.T.; Pritz, C.M.F.; Nelson, S.J.; Krabbenhoft, D.P.; Walters, D.M.; Eagles-Smith, C.A. Geographic drivers of mercury entry into aquatic food webs revealed by mercury stable isotopes in dragonfly larvae. Environ. Sci. Technol. 2024, 58, 13444–13455. [Google Scholar] [CrossRef]
  62. Springate-Baginski, O.; Allen, D. An Integrated Wetland Assessment Toolkit: A Guide to Good Practice; Darwall, W.R.T., Ed.; IUCN: Gland, Switzerland; Cambridge, UK, 2009. [Google Scholar]
  63. Yu, X.; Bu, W.; Zhu, L. Research advances in eco-environment assessment using dragonfly as a bioindicator. Chin. J. Ecol 2012, 31, 1585–1590. [Google Scholar]
  64. Van Praet, N.; De Bruyn, L.; De Jonge, M.; Vanhaecke, L.; Stoks, R.; Bervoets, L. Can damselfly larvae (Ischnura elegans) be used as bioindicators of sublethal effects of environmental contamination? Aquat. Toxicol. 2014, 154, 270–277. [Google Scholar] [CrossRef] [PubMed]
  65. de Beeck, L.O.; Verheyen, J.; Stoks, R. Strong differences between two congeneric species in sensitivity to pesticides in a warming world. Sci. Total Environ. 2018, 618, 60–69. [Google Scholar] [CrossRef]
  66. Tennessen, K.J. Dragonfly Nymphs of North America: An Identification Guide, 1st ed.; Springer: New York, NY, USA, 2019; 620p. [Google Scholar]
  67. Calvert, P.P. The rates of growth, larval development and seasonal distribution of dragonflies of the genus Anax (Odonata: Aeshnidæ). Proc. Am. Philos. Soc. 1934, 73, 1–70. [Google Scholar]
  68. Butler, S.G. The larva of Gomphidia t-nigrum Selys from Nepal (Anisoptera: Gomphidae). Odonatologica 2007, 36, 399–403. [Google Scholar]
  69. EPA. National Recommended Water Quality Criteria—Aquatic Life Criteria Table. Available online: https://www.epa.gov/wqc/national-recommended-water-quality-criteria-aquatic-life-criteria-table (accessed on 12 December 2024).
  70. Flomer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar]
  71. Burland, T.G. DNASTAR’s lasergene sequence analysis software. In Bioinformatics Methods and Protocols; Misener, S., Krawetz, S.A., Eds.; Humana Press: Totowa, NJ, USA, 2000; Volume 132, pp. 71–91. [Google Scholar]
  72. Meng, G.; Li, Y.; Yang, C.; Liu, S. MitoZ: A toolkit for animal mitochondrial genome assembly, annotation and visualization. Nucleic Acids Res. 2019, 47, e63. [Google Scholar] [CrossRef] [PubMed]
  73. Dierckxsens, N.; Mardulyn, P.; Smits, G. NOVOPlasty: De novo assembly of organelle genomes from whole genome data. Nucleic Acids Res. 2017, 45, e18. [Google Scholar]
  74. Jin, J.J.; Yu, W.B.; Yang, J.B.; Song, Y.; DePamphilis, C.W.; Yi, T.S.; Li, D.Z. GetOrganelle: A fast and versatile toolkit for accurate de novo assembly of organelle genomes. Genome Biol. 2020, 21, 241. [Google Scholar] [CrossRef] [PubMed]
  75. Bernt, M.; Donath, A.; Jühling, F.; Externbrink, F.; Florentz, C.; Fritzsch, G.; Pütz, J.; Middendorf, M.; Stadler, P.F. MITOS: Improved de novo metazoan mitochondrial genome annotation. Mol. Phylogen. Evol. 2013, 69, 313–319. [Google Scholar] [CrossRef] [PubMed]
  76. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef]
  77. Koopman, W.J.H.; Nijtmans, L.G.J.; Dieteren, C.E.J.; Roestenberg, P.; Valsecchi, F.; Smeitink, J.A.M.; Willems, P.H.G.M. Mammalian mitochondrial complex I: Biogenesis, regulation, and reactive oxygen species generation. Antioxid. Redox Signal. 2010, 12, 1431–1470. [Google Scholar] [CrossRef]
  78. Hidalgo-Gutiérrez, A.; González-García, P.; Díaz-Casado, M.E.; Barriocanal-Casado, E.; López-Herrador, S.; Quinzii, C.M.; López, L.C. Metabolic targets of Coenzyme Q10 in mitochondria. Antioxidants 2021, 10, 520. [Google Scholar] [CrossRef] [PubMed]
  79. Acín-Pérez, R.; Bayona-Bafaluy, M.P.; Fernández-Silva, P.; Moreno-Loshuertos, R.; Pérez-Martos, A.; Bruno, C.; Moraes, C.T.; Enríquez, J.A. Respiratory complex III Is required to maintain complex I in mammalian mitochondria. Mol. Cell 2004, 13, 805–815. [Google Scholar] [CrossRef]
  80. Orrenius, S.; Gogvadze, V.; Zhivotovsky, B. Mitochondrial oxidative stress: Implications for cell death. Annu. Rev. Pharmacol. Toxicol. 2007, 47, 143–183. [Google Scholar] [CrossRef]
  81. Seth, E.; Ahsan, A.U.; Kaushal, S.; Mehra, S.; Chopra, M. Berberine affords protection against oxidative stress and apoptotic damage in F1 generation of wistar rats following lactational exposure to chlorpyrifos. Pestic. Biochem. Physiol. 2021, 179, 104977. [Google Scholar] [CrossRef] [PubMed]
  82. Farkhondeh, T.; Mehrpour, O.; Forouzanfar, F.; Roshanravan, B.; Samarghandian, S. Oxidative stress and mitochondrial dysfunction in organophosphate pesticide-induced neurotoxicity and its amelioration: A review. Environ. Sci. Pollut. Res. Int. 2020, 27, 24799–24814. [Google Scholar] [CrossRef]
  83. Xu, S.; Li, S.; Bjorklund, M.; Xu, S. Mitochondrial fragmentation and ROS signaling in wound response and repair. Cell Regen. 2022, 11, 38. [Google Scholar] [CrossRef]
  84. Wang, W.; Yang, L.L.; Luo, S.M.; Ma, J.Y.; Zhao, Y.; Shen, W.; Yin, S. Toxic effects and possible mechanisms following malathion exposure in porcine granulosa cells. Environ. Toxicol. Pharmacol. 2018, 64, 172–180. [Google Scholar] [CrossRef]
  85. Yan, W.; Kang, Y.; Ji, X.; Li, S.; Li, Y.; Zhang, G.; Cui, H.; Shi, G. Testosterone upregulates the expression of mitochondrial ND1 and ND4 and alleviates the oxidative damage to the nigrostriatal dopaminergic system in orchiectomized rats. Oxidative Med. Cell. Longev. 2017, 2017, 1–13. [Google Scholar] [CrossRef]
  86. Kalmar, B.; Greensmith, L. Induction of heat shock proteins for protection against oxidative stress. Adv. Drug Del. Rev. 2009, 61, 310–318. [Google Scholar] [CrossRef]
  87. Ikwegbue, P.C.; Masamba, P.; Oyinloye, B.E.; Kappo, A.P. Roles of heat shock proteins in apoptosis, oxidative stress, human inflammatory diseases, and cancer. Pharmaceuticals 2018, 11, 2. [Google Scholar] [CrossRef]
  88. Xing, H.; Wang, Z.; Wu, H.; Zhao, X.; Liu, T.; Li, S.; Xu, S. Assessment of pesticide residues and gene expression in common carp exposed to atrazine and chlorpyrifos: Health risk assessments. Ecotoxicol. Environ. Saf. 2015, 113, 491–498. [Google Scholar] [CrossRef] [PubMed]
  89. Chen, D.; Zhang, Z.; Yao, H.; Liang, Y.; Xing, H.; Xu, S. Effects of atrazine and chlorpyrifos on oxidative stress-induced autophagy in the immune organs of common carp (Cyprinus carpio L.). Fish Shellfish Immunol. 2015, 44, 12–20. [Google Scholar] [CrossRef]
  90. Zhang, J.; Liu, L.; Ren, L.; Feng, W.; Lv, P.; Wu, W.; Yan, Y. The single and joint toxicity effects of chlorpyrifos and beta-cypermethrin in zebrafish (Danio rerio) early life stages. J. Hazard. Mater. 2017, 334, 121–131. [Google Scholar] [CrossRef]
  91. Dilberger, B.; Baumanns, S.; Schmitt, F.; Schmiedl, T.; Hardt, M.; Wenzel, U.; Eckert, G.P. Mitochondrial oxidative stress impairs energy metabolism and reduces stress resistance and longevity of C. elegans. Oxidative Med. Cell. Longev. 2019, 2019, 6840540. [Google Scholar] [CrossRef]
  92. Corbet, P.S. Dragonflies: Behaviour and Ecology of Odonata; Harley Books: Colchester, UK, 1999. [Google Scholar]
  93. Brogan, W.R., III; Relyea, R.A. Submerged macrophytes mitigate direct and indirect insecticide effects in freshwater communities. PLoS ONE 2015, 10, e0126677. [Google Scholar] [CrossRef]
  94. Brogan, W.R.; Relyea, R.A. A new mechanism of macrophyte mitigation: How submerged plants reduce malathion’s acute toxicity to aquatic animals. Chemosphere 2014, 108, 405–410. [Google Scholar] [CrossRef]
  95. Giesy, J.P.; Graney, R.L.; Newsted, J.L.; Rosiuand, C.J.; Benda, A.; Kreis, R.G., Jr.; Horvath, F.J. Comparison of three sediment bioassay methods using detroit river sediments. Environ. Toxicol. Chem. 1988, 7, 483–498. [Google Scholar] [CrossRef]
Insects 16 00085 g001
Figure 1. The expression of 10 PCGs from larvae of A. parthenope, G. confluens, and E. elegans comparing control versus experimental conditions (under 0.05 μg/L CPF stress). The x-axis shows gene names. For each gene, 3 pairs of bars are shown. The first (yellow), third (orange), and fifth (red) bars show controls (all standardized to 1.0), whereas the second (yellow), fourth (orange), and sixth (red) bars show the relative gene expression of the experimental data compared to control values. Yellow columns show data for A. parthenope; orange columns show data for E. elegans; and red columns show data for G. confluens. The error bars represent standard deviation. Asterisks indicate significantly different expressions: *, p < 0.05; **, p < 0.01. The value of p was calculated by an independent t-test.
Figure 1. The expression of 10 PCGs from larvae of A. parthenope, G. confluens, and E. elegans comparing control versus experimental conditions (under 0.05 μg/L CPF stress). The x-axis shows gene names. For each gene, 3 pairs of bars are shown. The first (yellow), third (orange), and fifth (red) bars show controls (all standardized to 1.0), whereas the second (yellow), fourth (orange), and sixth (red) bars show the relative gene expression of the experimental data compared to control values. Yellow columns show data for A. parthenope; orange columns show data for E. elegans; and red columns show data for G. confluens. The error bars represent standard deviation. Asterisks indicate significantly different expressions: *, p < 0.05; **, p < 0.01. The value of p was calculated by an independent t-test.
Insects 16 00085 g001
Insects 16 00085 g002
Figure 2. The expression of 10 PCGs from larvae of (A) A. parthenope, (B) G. confluens, and (C) E. elegans comparing control versus experimental conditions (under 0.05 μg/L, 0.5 μg/L, and 5 μg/L CPF stress). The x-axis shows gene names. For each gene, four bars show the relative gene expression of the four experimental conditions compared to control values. The error bars represent standard deviation. Asterisks indicate significantly different expressions: *, p < 0.05; **, p < 0.01. The value of p was calculated by an independent t-test.
Figure 2. The expression of 10 PCGs from larvae of (A) A. parthenope, (B) G. confluens, and (C) E. elegans comparing control versus experimental conditions (under 0.05 μg/L, 0.5 μg/L, and 5 μg/L CPF stress). The x-axis shows gene names. For each gene, four bars show the relative gene expression of the four experimental conditions compared to control values. The error bars represent standard deviation. Asterisks indicate significantly different expressions: *, p < 0.05; **, p < 0.01. The value of p was calculated by an independent t-test.
Insects 16 00085 g002
Table 1. Characteristics of larvae from three dragonfly species in the last stadium.
Table 1. Characteristics of larvae from three dragonfly species in the last stadium.
SpeciesWidth of Head (mm)Total Length (mm)Reference
A. parthenope8.43 ± 0.4545.50 ± 0.25[67]
E. elegans6.84 ± 0.3633.7 ± 0.11[66]
G. confluens7.82 ± 0.3926.4 ± 0.10[68]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Chen, Y.; Yang, Z.; Guo, Z.; Zhan, L.; Storey, K.B.; Yu, D.; Zhang, J. Mitochondrial Gene Expression of Three Different Dragonflies Under the Stress of Chlorpyrifos. Insects 2025, 16, 85. https://doi.org/10.3390/insects16010085

AMA Style

Chen Y, Yang Z, Guo Z, Zhan L, Storey KB, Yu D, Zhang J. Mitochondrial Gene Expression of Three Different Dragonflies Under the Stress of Chlorpyrifos. Insects. 2025; 16(1):85. https://doi.org/10.3390/insects16010085

Chicago/Turabian Style

Chen, Yuxin, Ziwen Yang, Zhiqiang Guo, Lemei Zhan, Kenneth B. Storey, Danna Yu, and Jiayong Zhang. 2025. "Mitochondrial Gene Expression of Three Different Dragonflies Under the Stress of Chlorpyrifos" Insects 16, no. 1: 85. https://doi.org/10.3390/insects16010085

APA Style

Chen, Y., Yang, Z., Guo, Z., Zhan, L., Storey, K. B., Yu, D., & Zhang, J. (2025). Mitochondrial Gene Expression of Three Different Dragonflies Under the Stress of Chlorpyrifos. Insects, 16(1), 85. https://doi.org/10.3390/insects16010085

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop