Next Article in Journal
Minimal Dosage of Porcine Circovirus Type 2d Based Virus-like Particles to Induce Stable Protective Immunity against Infection
Previous Article in Journal
Validation and Application of Skin RT-QuIC to Patients in China with Probable CJD
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Pathogens
Volume 10
Issue 12
10.3390/pathogens10121643
pathogens-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Detection of Zoonotic and Non-Zoonotic Pathogens from Wild Boars and Their Ticks in the Corsican Wetlands

by
Baptiste Defaye
1,*,
Sara Moutailler
2,
Christian Pietri
3,
Clemence Galon
2,
Sébastien Grech-Angelini
4,
Vanina Pasqualini
1 and
Yann Quilichini
1,*
1
UMR CNRS SPE 6134, Université de Corse Pascal Paoli, 20250 Corte, France
2
Anses, INRAE, Ecole Nationale Vétérinaire d’Alfort, UMR BIPAR, Laboratoire de Santé Animale, 94700 Maisons-Alfort, France
3
Fédération Départementale des Chasseurs de Haute-Corse, St-Joseph, 20600 Bastia, France
4
Groupement Technique Vétérinaire de Corse, 20240 Ghisonaccia, France
*
Authors to whom correspondence should be addressed.
Pathogens 2021, 10(12), 1643; https://doi.org/10.3390/pathogens10121643
Submission received: 3 November 2021 / Revised: 16 December 2021 / Accepted: 17 December 2021 / Published: 20 December 2021
(This article belongs to the Section Ticks)
Browse Figures
Versions Notes

Abstract

:
Corsica is the main French island in the Mediterranean Sea and has high levels of human and animal population movement. Among the local animal species, the wild boar is highly prevalent in the Corsican landscape and in the island’s traditions. Wild boars are the most commonly hunted animals on this island, and can be responsible for the transmission and circulation of pathogens and their vectors. In this study, wild boar samples and ticks were collected in 17 municipalities near wetlands on the Corsican coast. A total of 158 hunted wild boars were sampled (523 samples). Of these samples, 113 were ticks: 96.4% were Dermacentor marginatus, and the remainder were Hyalomma marginatum, Hyalomma scupense and Rhipicephalus sanguineus s.l. Of the wild boar samples, only three blood samples were found to be positive for Babesia spp. Of the tick samples, 90 were found to be positive for tick-borne pathogens (rickettsial species). These results confirm the importance of the wild boar as a host for ticks carrying diseases such as rickettsiosis near wetlands and recreational sites. Our findings also show that the wild boar is a potential carrier of babesiosis in Corsica, a pathogen detected for the first time in wild boars on the island.

1. Introduction

The wild boar (Sus scrofa) is one of the most widely distributed ungulates in the world, present on all continents except Antarctica [1]. The distribution of this species has increased over the years through increased farming or reintroduction or introduction for hunting, and due to vigorous reproduction and the animals’ adaptable feeding habits [2,3,4]. Wild boars can represent a major hazard via direct or indirect interaction with many different species, including domestic pigs, livestock [5,6,7], and humans. These interactions can increase the risk of transmission of pathogens [8,9,10,11]. Currently in the Mediterranean region, the wild boar is known to act as a reservoir for many disease-causing agents through interactions with many different populations and in multiple landscapes, including in Corsica (western Mediterranean) [10,12].
Wild boars live close to water, especially wetlands, mainly because of their diet [13]. Wetlands are areas that are key to human activities and where there are high levels of interactions with animals. Wetlands represent one of the main watering and resting areas for both animals and humans [14,15]. These habitats are important for public health given their role in vector proliferation and pathogen transmission [16,17,18]. Risks are mostly related to the animal species found in the wetland of interest. Depending on the ecosystem, the diversity and the prevalence of ectoparasite communities and pathogens can change [19].
Worldwide, the wild boar is host to many types of pathogens, such as food-borne, tick-borne, and mosquito-borne pathogens [9,20,21]. Across Europe, S. scrofa can carry a large spectrum of tick-borne pathogens, including Anaplasma spp., Rickettsia spp., Ehrlichia spp., Theileria spp., Borrelia spp., Babesia spp., and tick-borne encephalitis virus [8,9,11,20,22]. It has been confirmed in Corsica that S. scrofa is an important host of many diseases and parasites [12,23,24]. On this island, wild boar hunting is a very long-standing tradition that is still very popular, with over 26,000 wild boars hunted in 2017 [25]. One of the main routes of pathogen transmission from wild boars to humans is via food, especially in Corsica, where wild boar meat is widely consumed. Pathogens such as the hepatitis E virus are highly prevalent in the Corsican population (>60% of blood donors) and in wild boars. The population may also be exposed to Trichinella britovi and Echinococcus canadensis [12,26,27,28]. Another route of transmission is direct or indirect interactions that cover different kinds of pathogens: viruses such as the Aujeszky’s disease virus, bacteria such as Mycobacterium bovis, and parasites such as Toxoplasma gondii have been found in wild boars in Corsica [12,29,30]. Transmission may also occur through vectors, especially ticks. The five tick species found on wild boars in Corsica are known to be vectors of different kinds of disease [31]. To date, Rickettsia from the spotted fever group (Rickettsia slovaca and Rickettsia aeschlimannii), Rickettsia raoultii, Rickettsia conorii (the agent of Mediterranean spotted fever), Anaplasma spp. and Bartonella spp. are the only tick-borne pathogens recorded from ticks collected from wild boars in Corsica [32,33,34]. The wild boar may play an important role in the transmission of these pathogens [9,35]. The species serves as a maintenance host and contributes to distribution by spreading ticks as part of its numerous interactions with other species [6,9]. Even though wild boars can play a major role in pathogen transmission and ectoparasite spreading, few studies have focused on the extensive detection of pathogens in both animals and vectors. Detecting pathogens simultaneously in animals and in the ectoparasites they carry makes it possible to observe animal-borne and ectoparasite-borne pathogens in the same area.
Among potential vectors, ticks (Acarida) rank first for veterinary vector-borne pathogens and second for human disease, just after mosquitoes. Ticks are involved in the transmission, circulation and maintenance of pathogens between different groups of animals worldwide [36,37]. Tick-borne pathogens are maintained in a stable, natural cycle involving their incidental host and reservoir (such as animals) and accidental host (such as humans) by blood-feeding by vectors [38]. In this way, ticks can transmit a range of bacteria, viruses, and parasites. These tick-borne pathogens are known to be both pathogens of veterinary importance and zoonotic pathogens harmful to humans [39]. Many different animals are involved as reservoirs. In European countries, there are a diversity of important reservoir groups, such as birds, rodents, domestic and wild ungulates, such as the wild boar [40]. In four surveys of tick fauna, 10 species were found in Corsica from rodent pets and domestic and wild ungulates: Amblyomma variegatum (sporadically), Ixodes ricinus, Rhipicephalus bursa, Rhipicephalus sanguineus s.l., Rhipicephalus annulatus, Hyalomma marginatum, Haemaphysalis sulcata, Haemaphysalis punctata, Hyalomma scupense and Dermacentor marginatus [31,32,41,42,43]. Five species have been found in wild boars. Out of the five species, D. marginatus was the most common, constituting >80% of the collected ticks. The other species are Rh. bursa, Rh. sanguineus s.l., Hy. marginatum and I. ricinus.
The aims of this study were to (i) determine the main tick species of wild boars in Corsican wetlands, and (ii) obtain an overview of the potential presence of a wide range of zoonotic and non-zoonotic pathogens in wild boars and their ticks in the Corsican wetlands.
For this purpose, we collected tissue samples and ticks from wild boar from the Corsican wetlands, and we focused the screening on the detection of 34 species and 11 genera of bacteria, viruses, and parasites expected to be present and belonging to the main tick-borne pathogens or non-tick-borne pathogens with an considerable impact on animal and human health, including: African swine fever virus, Anaplasma spp., Anaplasma marginale, Anaplasma phagocytophilum, Aujeszky’s virus, Babesia bigemina, Babesia bovis, Babesia caballi, Babesia divergens, Babesia microti, Babesia ovis, Babesia vogeli, Babesia venatorum, Bartonella spp., Bartonella henselae, Bartonella quintana, Borrelia afzelii, Borrelia burgdorferi spp., Borrelia burgdorferi sensu stricto, Borrelia lusitaniae, Borrelia miyamotoi, Borrelia spielmanii, Chlamydia psittaci, Coxiella burnetii, Ehrlichia spp., Ehrlichia ruminatum¸ Haemoproteus spp., Hepatozoon spp., Leishmania spp., Leishmania infantum, Leptospira spp., Leucocytozoon spp., Neoehrlichia mikurensis, Plasmodium spp., Rickettsia spp., R. aeschlimannii, R. conorii, Rickettsia helvetica, Rickettsia massiliae, Rickettsia monacensis, R. slovaca, Theileria annulata, Theileria equi, T. gondii and Trypanosoma spp by means of microfluidic real-time PCR.

2. Results

2.1. Tick Identification

Of the 158 wild boar samples from 17 municipalities, a total of 113 ticks were collected from 32 wild boars from nine areas close to coastal wetlands (Table 1). Overall, 96.4% of them were D. marginatus; the remainder belonged to three species: Hy. marginatum, Hy. scupense and Rh. sanguineus s.l.. They were all adults, with 53.6% being males and 46.4% being fully and partially engorged females.

2.2. Detection of Tick-Borne Pathogen DNA in Wild Boar Samples

Only three wild boar samples were found to be positive. These were three blood samples from three juvenile males from Chiatra municipality which were positive for Babesia spp. (Table 1 and Figure 1A). Unfortunately, the sequencing did not enable us to identify the Babesia species involved. This was the only pathogen found in wild boar blood samples, and no pathogens were found in the other tissue samples (spleen and liver).

2.3. Detection of Tick-Borne Pathogen DNA in Ticks

Of the 113 ticks collected from wild boars, 90 were positive (79.6%) and two genera were identified. The main genus was Rickettsia spp., with two species. Of the 89 tick samples positive for rickettsiae, three were Rickettsia spp. and two species were confirmed by sequencing: R. slovaca and R. aeschlimannii.
Six ticks were positive for R. aeschlimannii: 2.8% of the D. marginatus, 50% of the H. marginatum, and 100% of the Hy. scupense and Rh. sanguineus s.l. (Table 1 and Figure 1B). Of the six positive samples, two were males collected on juvenile wild boars, and the other four were one female and three males collected on adult wild boars. These six samples were found to be related to the ompB sequence of R. aeschlimannii detected in H. marginatum collected from the environment in the Crimean Peninsula (GenBank: KU961544.1), with 88–98% identity to the sequence for one D. marginatus and more than 99% for the other five.
A total of 80 ticks were positive for R. slovaca: 73.4% of the D. marginatus collected (Table 1 and Figure 1C). About half of the ticks were male (52.5%), and the other half female (47.5%). Most ticks were collected from adults rather that juveniles (98.8% and 1.2%) and female rather than male wild boars (68.8% and 31.8%). R. slovaca sequences found were related to the R. slovaca ompB sequence from a Dermacentor spp. nymph collected on a Royle’s mountain vole (GenBank: MN581993.1), with an identity between 96% and 100%, and from an R. slovaca citrate synthase sequence from a D. marginatus tick from S. scrofa in the south of France (GenBank: AY129301.1), with an identity between 99% and 100%.
The last tick was detected as being positive for Anaplasma spp. It was a male D. marginatus collected from a male wild boar in Ersa municipality (Table 1 and Figure 1D). Unfortunately, the sequencing of Anaplasma spp. in this sample was unsuccessful.

3. Discussion

In this paper, we report two wild boar hunting season surveys (2018–2019 and 2019–2020) in several coastal or near-coastal administrative municipalities of Corsica with the aim of identifying major non-vector pathogens, tick-borne pathogens, and their vectors.

3.1. Ticks on Wild Boar Population in Corsican Wetland

Across the Mediterranean Rim, a high diversity of Ixodidae ticks is found on wild boars. Their distribution can be divided into two areas: the western side, with the highest diversity, and the eastern side, where ticks were found only in Israel and Turkey. A total of five genera were found on the western side: Dermacentor, Haemaphysalis, Hyalomma, Ixodes and Rhipicephalus, with a total of nine different species; and four genera on the eastern side: Dermacentor, Haemaphysalis, Hyalomma, and Rhipicephalus, with a total of seven different species (Table 2).
Of these tick species, five are the main ticks found in various studies. The term main specie defines the species found with the highest number of tick individuals on the wild boar in each study. The most important is D. marginatus, which is the main tick found on wild boars in more than half of the publications in the Mediterranean Rim. This can be explained by the tropism of the adult stage mainly for wild ungulates, especially wild boars [41]. On the western side, the other main species are Hy. marginatum and Hy. lusitanicum, which mainly target livestock but can occur on wild ungulates [44]. In the Eastern part, the two other main species are H. parva and Hy. detritum, which have previously been found mainly in domestic ruminants but can also target wild ungulates [44,45].
In Corsica, ticks from four genera have previously been found on wild boars: Dermacentor, Ixodes, Hyalomma and Rhipicephalus. Tick belonging to the genus Rhipicephalus and the species Hy. marginatum were the main ones found on domestic ungulates and pets. On the other hand, I. ricinus was more commonly found on deer and pets [31,32]. Our results are consistent with those of studies performed elsewhere in the Mediterranean Rim. This can be explained by the distribution of D. marginatus, which is mainly found in the west Mediterranean Rim (Figure 2), due to its tropism for the wild boar, and its activity peak in autumn and winter [44]. The three other species found (Hy. marginatum, Hy. scupense, which also infest ungulates with a tropism for domestic animals, and Rh. sanguineus s.l., which infest both dog and ungulates in the Mediterranean Rim) have an activity peak in spring [41]. However, the tropism for the wild boar, the activity peak of D. marginatus and the seasonal collection of ticks (autumn and winter) can explain the difference in proportions between the D. marginatus found and other tick species, such as Hyalomma spp., which are more present in spring and summer. Seasonal surveys of ticks on wild boars from wetlands could be useful to determine the circulation of tick-borne pathogens linked to wild boars, and the threat to animals and humans.
Table
Table 2. Tick-borne pathogens detected in the wild boar (Sus scrofa) and its ticks in the Mediterranean Rim.
Table 2. Tick-borne pathogens detected in the wild boar (Sus scrofa) and its ticks in the Mediterranean Rim.
Area (Island)Main Tick SpeciesOther Tick SpeciesPathogens Found in Ticks (Bacterium b, Parasite p and Virus v)Pathogens Found in Wild Boars (Bacterium b, Parasite p and Virus v)References
AlgeriaD. marginatusH. punctata, Rh. sanguineusR. massiliaeb,
R. slovacab		Not found[46]
Algeria Not screenedR. slovacab[47]
France (Corsica)D. marginatusHy. marginatum, H.scupense,
I. ricinus		A. phagocytophilumb, R. spp. b,
R. aeschlimannii b,
R. slovaca b		Babesia spp. bPresent study
France (Corsica)D.marginatusHy. marginatum, I. ricinus,
Rh. bursa		R. aeschlimanniib,
R. slovacab		Not screened[32]
France (Corsica)D. marginatusHy. marginatum, I. ricinus,
Rh. bursa, Rh. sanguineus		A. phagocytophilumb,
Ba. henselaeb,
R. aeschlimanniib,
R. slovacab		Not screened[33]
France (Corsica)Hy. marginatum R. aeschlimanniibNot screened[48]
France Not screenedTick-borne encephalitis virus v,
Louping ill v		[49]
France Not screenedA. phagocytophilumb[50]
FranceD. marginatus Rickettsia spp. b,
R. slovaca b		Not search[51]
IsraelH. parvaH. aleri, Hyalomma spp.,
Rh. turanicus		R. massiliaebNot screened[52]
IsraelHy. detritum R. africaebNot screened[53]
Italy Not screenedA. phagocytophilumb, Bo. burgdoferi s.l. b[54]
ItalyD. marginatus R. raoultiib,
R. slovacab		Not screened[55]
Italy (Sardinia)D. marginatus R.slovacabNot screened[56]
Italy (Sardinia)D. marginatus R. spp. bNot screened[57]
ItalyD. marginatus R. slovacabNot screened[58]
ItalyD. marginatus E. canisbNot screened[59]
Italy Not screenedB.bigeminap,
Theileria spp. p		[60]
Slovenia Not screenedA. phagocytophilumb[61]
Slovenia Not screenedA. phagocytophilumb[62]
SpainHy. marginatumD. marginatus, Rh. bursaA. marginale b,
A. phagocytophilum b, Ehrlichia spp. b,
Piroplasmid p
Rickettsia spp. b,
R. slovaca b		Not screened[22]
SpainD. marginatusD. reticulatus, Rh. bursaNot foundC. burnetiib[63]
SpainD. marginatus R.slovacabNot screened[64]
SpainD. marginatus R. slovacabNot screened[65]
SpainHy. lusitanicumD. marginatusR. raoultiib,
R. slovacab		Not screened[66]
TurkeyD. marginatusH. parva, Hy. excavatum, Hy. marginatum, Rh. turanicusB. crassap,
B.occultansp,
B. rossip		Not found[67]

3.2. Pathogens Detected in Wild Boar and Their Ticks in the Corsican Wetlands

Another objective of our study was to overview the potential presence of a wide range of pathogens in wild boars and their ticks in the Corsican wetlands. Concerning wild boars in the Mediterranean Rim, most pathogens were found on ticks. We found only one article focusing on Algeria, and another on Turkey [46,67], in which the pathogens were searched for in both ticks and wild boars. Screening for pathogens in both ticks and hosts enables us to research tick-borne pathogens in ticks and non-vector pathogens in wild boars from the Corsican wetlands.

3.2.1. Babesia spp.

In this study, only the Babesia genus was found in three wild boar blood samples. All of the remaining tissue and blood samples were negative. This genus is composed of an intracellular protozoan parasite from the piroplasmid group. It targets erythrocyte cells and is transmitted by hard ticks. It mainly infects livestock and pets, but can also be found in wild ungulates and rodents [60,68]. Parasites of the Babesia genus can be responsible for moderate symptoms such as myalgia, headache, anorexia, as well as severe symptoms such as pulmonary edema, organ dysfunction syndrome and coma [69]. The zoonotic species are mainly transmitted by ticks from the Ixodes genus and are primarily B. divergens, B. duncani, B. microti, and B. venatorum. Their primary reservoir is often rodents, which contaminate immature tick stages, and the pathogens can be transmitted to ungulates during the adult stage [69]. In the Mediterranean Rim, one species of the Babesia genus (B. bigemina) has already been detected in wild boar in Italy, with a prevalence of 4.67% [60], and no Babesia was found in ticks. In Corsica, B. bigemina was found in I. ricinus collected from cattle and goats; B. ovis was found only in I. ricinus collected from cattle for domestic animals, and from mouflons for wild ungulates [33]. Our findings are the first possible report of Babesia spp. DNA in wild boars from Corsica; however, the sequences could not be obtained, so the presence of Babesia spp. in wild boar still requires confirmation.

3.2.2. Rickettsia spp.

The Rickettsia genus was the most detected in the tick samples; however, Rickettsia DNA was not detected in the tissue samples of wild boars. This genus is composed of three groups: the spotted fever group (SFG), the typhus group and the transitional group. The SFG is the only group transmitted exclusively by ticks, which have both the role of vector and reservoir thanks to their transstadial and transovarial transmission of the pathogens. It is composed of many zoonotic agents with diverse pathogenicity levels, but most of these species can be a threat for human health, with symptoms ranging from a cutaneous rash to lymphadenopathy, for example [70,71]. In Corsica, even if the exact impact of Rickettsia species is still unknown, diverse species were already found in animals (R. aeschlimannii, R. africae, R. felis, R. helvetica, R. massiliae and R. slovaca [32,33,43,48]), and a previous sero-epidemiological study showed the exposition of 4.8% of the people to these pathogens in “Corse du Sud” [72].
In our study, the main Rickettsia species detected was R. slovaca, found in 73.4% of collected D. marginatus. R. slovaca is a tick-borne rickettsia species from the spotted fever group, mainly transmitted by D. marginatus [73]. This rickettsia species is mainly known for causing tick-borne lymphadenopathy in humans [74]. It was first isolated in a D. marginatus tick in Slovakia in 1968. In Europe, R. slovaca has already been detected in several countries in Eastern Europe, including Slovakia, Romania, and Bulgaria, as well as in southern Europe, including France, Spain, Portugal and Italy, mainly with the involvement of D. marginatus and D. reticulatus [74,75,76,77]. In the Mediterranean Rim, R. slovaca is one of the most frequent tick-borne pathogens found in wild boar ticks, mainly in the north-west of the Mediterranean Rim and in Algeria. It is mainly found in D. marginatus, and the only detection in wild boar tissues was from the North of Algeria, with a prevalence of 5.4% in wild boar spleens [47]. Concerning Mediterranean islands, R. slovaca has already been found in Sardinia from D. marginatus, Rh. bursa and H. marginatum collected from wild boars, mouflons and foxes, and in D. marginatus collected from humans in Sicily. In Corsica, R. slovaca has already been detected from D. marginatus, I. ricinus and Rh. bursa from wild boars, and D. marginatus from cats [32,33,78,79,80]. The prevalence of R. slovaca (70.8%) found in our study was quite similar to that previously found in Corsica (66%) [32,33]. In this study, we show the importance of D. marginatus ticks in R. slovaca’s possible presence near wetland areas in Corsica, where humans and animals could be at risk from this pathogen.
R.aeschlimannii belongs to the spotted fever group of rickettsiae, similarly to R. slovaca, and was first found in Hy. marginatum from Morocco. This disease was detected in a man who traveled to Morocco in 2000 [81,82]. Given its circulation via Hy. marginatum, R. aeschlimannii has a different distribution pattern compared to R. slovaca, following the distribution of H. marginatum, mainly in Africa. It has also been found in southern Europe and in the Mediterranean Rim. R. aeschlimannii has been detected in species other than H. marginatum, such as Rhipicephalus and Ixodes ticks [83]. As with R. slovaca, R. aeschlimannii was mainly found in ticks. Regarding the Mediterranean islands, R. aeschlimannii seems to follow migratory birds that carry ticks from the Hyalomma genus, such as Hy. marginatum and Hy. rufipes, carrying R. aeschlimannii in Greece and the Italian islands [84,85]. In wild boars, unlike R. slovaca, R. aeschlimannii is only found on the north-west border of the Mediterranean Rim. In Corsica, R. aeschlimannii was also detected in Rhipicephalus, Hyalomma, and Ixodes ticks collected from a wide range of domestic ungulates and wild boars [32,33]. In wetlands, R. aeschlimannii was detected in wild boars with a lower prevalence, but at a high prevalence in the ticks of the genus Hyalomma and Rhipicephalus (50–100%), which confirms the importance of these tick genera in R. aeschlimannii’s potential circulation in Corsica. On the other hand, since the pathogen was not found in the wild boar, this animal species seems not to be involved in R. aeschlimannii’s circulation in this area.

3.2.3. Anaplasma spp.

The other genus found in ticks was was Anaplasma spp., which belongs to the Anaplasmataceae, and is known to be a pathogen targeting ruminants. The members of this genus are obligatory intracellular bacteria which can be responsible of febrile illness and can cause diseases such as human granulocytic anaplasmosis. They are mainly transmitted by hard ticks of the Ixodes genus [86]. The confirmation of the transstadial and transovarial transmission of Anaplasma bacteria seems to also show the reservoir behavior of the ticks [87,88]. This genus has a worldwide distribution [89,90,91]. From ticks collected from wild boars of the Mediterranean Rim, A. marginale and A. phagocytophilum have been detected in Slovenia and Spain. This genus was also one of the most frequently detected in wild boar tissue samples, with the detection of A. phagocytophilum in France, Italy, and Slovenia. In the Mediterranean Rim, unlike Rickettsia spp., Anaplasma spp. was found to a moderate extent in ticks and wild boars. In Corsican ticks, A. phagocytophilum has already been found in ticks collected from birds, livestock, and wild boars, while A. marginale was detected in ticks from cattle and mouflons and A. ovis was detected in ticks from goats [33,92,93]. From animals in Corsica, A. bovis, A. marginale, and A. omtjenn were found in cattle’s blood samples and A. ovis was found in goats’ blood samples [33,93,94]. The observed prevalence of Anaplasma spp. (0.9%) was lower than the prevalence previously found in wild boars from Corsica (2%) [33]. In our study, we confirmed the presence of Anaplasma spp. near the Corsican wetlands.
The results of this study confirm the importance of pathogen research in both animals and their associated tick species, in order to draw conclusions described above about the potential risks to animal and human health in the Corsican wetland. In our study, as no pathogen DNA was found in common between the wild boar and their ticks, no statement can be made regarding the transmission of these pathogens between both species. However, the methodology used was based on PCR detection and did not allow us to confirm the presence and the circulation of these pathogens. Nevertheless, these results are a first step in the characterization of the potential threat regarding those pathogens in hotspots of human and animal activity in Corsica. Obviously, serological surveys and pathogen isolations are needed to draw conclusions regarding the presence and potential circulation of these pathogens in the wild boar population of the Corsican wetlands. Future studies are needed to assess the extent of major non-vector pathogens, tick-borne pathogens and their vectors in wetland compared to other land types in the wild boar population of Corsica.

4. Materials and Methods

4.1. Animals and Sampling

Corsica is the third largest island in the Mediterranean Sea (8722 km²). It is located 15 km north of the closest Italian territory (Sardinia) and 160 km from the coast of mainland France. It is characterized by a mild Mediterranean climate and has a huge spectrum of landscapes, such as wetlands (mainly on the coast), forests, and mountains (Monte Cintu peaks at 2706 m). Corsica is divided into two administrative departments, Haute-Corse and Corse du Sud, with a population of 322,000, which is multiplied by 10 during the tourist season, with approximately 3 million tourists, located primarily around the coastal wetlands. From autumn 2018 to winter 2020, a total of 523 samples were collected from 158 hunter-harvested wild boars in 17 municipalities close to wetlands. In all, 100 blood samples, 158 liver samples, 152 spleen samples, and 113 fully and partially engorged ticks were collected by hunters just after wild boar death during the hunting season, in compliance with current regulations. All samples were stored at −80 °C until further study. Every animal was morphometrically characterized by the hunter. Age was determined on the basis of tooth eruption patterns. The animals were classified as juveniles if they were under 12 months of age, and as adults above 12 months of age. Wetlands were divided into 4 categories: lagoon, river/river mouth, artificial lake, and temporary pool.

4.2. DNA Extraction and PCR Pre-Amplification

Ticks were washed in ethanol and distilled water and then morphologically determined to the species level using standard keys [37,38]. Prior to extraction, tissues and ticks were crushed in microtubes filled with six metal beads using a fisher brand Bead Mill 24 (Thermofisher, Waltham, MA, USA) at 5500 rpm for 20 s. DNA from ticks and tissues was extracted using a Nucleospin tissue kit (Macherey-Nagel, Düren, Germany). For the blood samples, a Nucleospin Quickpure Blood kit (Macherey-Nagel, Düren, Germany) was used, according to the manufacturer’s instructions. All the ticks were analyzed individually.
To improve the detection of pathogen DNA, total DNA was pre-amplified using a PreAmp Master Mix, according to the manufacturer’s instructions (Fluidigm, South San Francisco, CA, USA). Prior to experiments, primers targeting all pathogens were pooled in equal volumes (200 nM each). The experiment was performed with 1 µL of PreAmp Master Mix, 1.25 µL of pooled primers mix, 1.5 µL distilled water, and 1.25 µL DNA for 5 µL final volume. The pre-amplifications were performed with one cycle at 95 °C for 2 min, 14 cycles at 95 °C for 15 s and 60 °C for 4 min. At the end of pre-amplification, samples were diluted to 1:10. Pre-amplified DNA was stored at −20 °C until further use.

4.3. Assay Design

Vector-borne pathogens and their targeted genes were Anaplasma spp. (16S), A. marginale (Msp1b), A. phagocytophilum (Msp2), Borrelia spp. (23S), Bo. burgdorferi s.s. (rpoB), Bo. afzelii (flagellin), Bo. miyamotoi (glpQ), Bo. lusitaniae (rpoB), Bo. spielmanii (flagellin), Rickettsia spp. (gltA), R. slovaca (23S-5S ITS), R. helvetica (23S-5S ITS), R. aeschlimannii (23S-5S ITS), R. massiliae (23S-5S ITS), R. conorii (23S-5S ITS), C. burnetii (idc, IS1111), N. mikurensis (ARN16S), Bartonella spp. (ssrA), Ba. henselae (pap31), Ba. quintana (bqtR), Ehrlichia spp. (16S), E. ruminatum (dsb), Hepatozoon spp. (18S), T. gondii, B. microti (CCTeta), B. bigemina (ARN 18S), B. vogeli (hsp70), B. caballi (rap1), B. bovis (CCTeta), B. ovis (ARN18S), B. divergens (hsp70), T. equi (Ema1), T. annulata (ARN 18S), Leishmania spp. (hsp70), L. infantum (ITS), and African swine fever virus (Vp72). The primers and probes for these pathogens selected from the literature were designed by Grech-Angelini et al., Gondard et al. and Michelet et al. [33,95,96]. The primer and probe sets created for this study are listed in Table 3.

4.4. DNA Amplification and Microfluidic Real-Time PCR

Prior to the microfluidic real-time PCR, DNA from each sample for all targeted pathogens was amplified by simple PCR for better detection. The primers used were the same as those used for the microfluidic real-time PCR, except for Escherichia coli, which was not amplified.
The target vector-borne pathogens were detected using a BioMarkTM real-time PCR system (Fluidigm, South San Francisco, CA, USA) for high-throughput microfluidic real-time PCR amplification using 48.48 dynamic arrays (Fluidigm). Fluidigm chips can be used to perform 2304 real-time PCR reactions thanks to 48 PCR mixes and 48 samples placed into individual wells, prior to transfer into individual chambers for the reaction. The thermal cycling conditions were 50 °C for 2 min, 95 °C for 10 min, and 40 cycles at 95 °C for 15 s and 60 °C for 1 min. One negative water control, one inhibitory molecule control (Escherichia coli EDL933 strain), and one DNA extraction control (animal targeting primers) were added to each chip. Specific primers and probes of E. coli were used.

4.5. Confirmation of Pathogen Detection

Confirmation of pathogen detection was performed by nested PCR or real-time PCR. As for the assay design, most of the primers were selected from the literature if they fit into the confirmation design. The positive sequences after gel migration from the nested PCR products were sent to sequencing at Eurofins MWG Operon (Germany) and assembled using BioEdit software (Ibis Biosciences, version 7.2.5, Carlsbad, CA, USA). An online BLAST (NCBI; National Center for Biotechnology Information) was used to identify the sequenced organisms. All the target genes and primer sequences from the literature were described in the studies by Gondard et al. and Michelet et al. [95,96]. The primer/probe sets used for confirmation of detection in this study are listed in Table 4.

Author Contributions

Conceptualization, B.D., S.M., C.P. and Y.Q.; Data curation, B.D.; Formal analysis, B.D. and C.G.; Investigation, B.D.; Methodology, B.D., S.M., C.G., S.G.-A. and Y.Q.; Project administration, V.P. and Y.Q.; Resources, S.M., V.P. and Y.Q.; Supervision, V.P. and Y.Q.; Validation, S.M., V.P. and Y.Q.; Visualization, B.D.; Writing—original draft, B.D.; Writing—review and editing, S.M., C.P., S.G.-A., V.P. and Y.Q. All authors have read and agreed to the published version of the manuscript.

Funding

B.D.’s, Y.Q.’s and V.P.’s research was supported by UMR 6134, University of Corsica and the CNRS. B.D. was awarded a grant from the Corsican Regional Council. This study was supported by funding from the French Government and from the Corsican Regional Council (CPER project) and also by the GERHYCO interdisciplinary project dedicated to water management, ecology and hydro-ecosystem services in insular context. S.M.’s research was supported by the French Agency for Food, Environmental and Occupational Health and Safety (ANSES). UMR BIPAR is supported by the French Government’s Investissement d’Avenir program, Laboratoire d’Excellence “Integrative Biology of Emerging Infectious Diseases” (grant No. ANR-10LABEX-62-IBEID).

Institutional Review Board Statement

Ethical review and approval were waived for this study. The wild boars were killed by hunters for hunting reason during the legal hunting season and not specifically for this study. The study complies with the current French laws and there is in accordance with the conservation guidelines. Therefore, approval of the ethics committee was not required.

Informed Consent Statement

Not applicable.

Acknowledgments

The authors are grateful to the hunters who are members of the “Fédération départementale des chasseurs de Haute-Corse” and who provided the tissue and tick samples from hunted wild boar, and also to Lieutenant Dominique Fieschi and all the “Lieutenant de louveterie”, the hunting association of Aléria of Ange Battesti, who allowed the authors to accompany them during administrative hunting sessions. They are also grateful to Oscar Maestrini of the INRAE for providing wild boar samples. We thank the “Tiques et Maladies à Tiques (TMT)” group of the CNRS “Réseau Ecologie des Interactions Durables” for stimulating discussions and support.

Conflicts of Interest

The authors declare that they have no competing interest.

References

  1. Massei, G.; Genov, P.V. The environmental impact of Wild Boar. Galemys 2004, 16, 135–145. [Google Scholar]
  2. Courchamp, F.; Chapuis, J.-L.; Pascal, M. Mammal invaders on islands: Impact, control and control impact. Biol. Rev. 2003, 78, 347–383. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Goulding, M.J. Possible genetic sources of free-living wild boar (Sus scrofa) in southern England. Mammal. Rev. 2001, 31, 245–248. [Google Scholar] [CrossRef]
  4. Massei, G.; Genov, P.V.; Staines, B.W. Diet, food availability and reproduction of wild boar in a mediterranean coastal area. Acta Theriol. 1996, 41, 307–320. [Google Scholar] [CrossRef] [Green Version]
  5. Barth, S.A.; Blome, S.; Cornelis, D.; Pietschmann, J.; Laval, M.; Maestrini, O.; Geue, L.; Charrier, F.; Etter, E.; Menge, C.; et al. Faecal Escherichia coli as biological indicator of spatial interaction between domestic pigs and wild boar (Sus scrofa) in Corsica. Transbound. Emerg. Dis. 2018, 65, 746–757. [Google Scholar] [CrossRef] [Green Version]
  6. Barasona, J.A.; Latham, M.C.; Acevedo, P.; Armenteros, J.A.; Latham, A.D.M.; Gortazar, C.; Carro, F.; Soriguer, R.C.; Vicente, J. Spatiotemporal interactions between wild boar and cattle: Implications for cross-species disease transmission. Vet. Res. 2014, 45, 122. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  7. Cowie, C.E.; Hutchings, M.R.; Barasona, J.A.; Gortázar, C.; Vicente, J.; White, P.C.L. Interactions between four species in a complex wildlife: Livestock disease community: Implications for Mycobacterium bovis maintenance and transmission. Eur. J. Wildl. Res. 2016, 62, 51–64. [Google Scholar] [CrossRef] [Green Version]
  8. Kazimírová, M.; Hamšíková, Z.; Špitalská, E.; Minichová, L.; Mahríková, L.; Caban, R.; Sprong, H.; Fonville, M.; Schnittger, L.; Kocianová, E. Diverse tick-borne microorganisms identified in free-living ungulates in Slovakia. Parasit. Vectors 2018, 11, 495. [Google Scholar] [CrossRef]
  9. Kriz, B.; Daniel, M.; Benes, C.; Maly, M. The role of game (wild boar and roe deer) in the spread of tick-borne encephalitis in the Czech Republic. Vector-Borne Zoonotic Dis. 2014, 14, 801–807. [Google Scholar] [CrossRef] [Green Version]
  10. Naranjo, V.; Gortazar, C.; Vicente, J.; de la Fuente, J. Evidence of the role of european wild boar as a reservoir of Mycobacterium tuberculosis complex. Vet. Microbiol. 2008, 127, 1–9. [Google Scholar] [CrossRef]
  11. Silaghi, C.; Pfister, K.; Overzier, E. Molecular investigation for bacterial and protozoan tick-borne pathogens in wild boars (Sus scrofa) from southern Germany. Vector-Borne Zoonotic Dis. 2014, 14, 371–373. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Charrier, F.; Rossi, S.; Jori, F.; Maestrini, O.; Richomme, C.; Casabianca, F.; Ducrot, C.; Jouve, J.; Pavio, N.; Le Potier, M.-F. Aujeszky’s disease and Hepatitis E Viruses transmission between domestic pigs and wild boars in corsica: Evaluating the importance of wild/domestic interactions and the efficacy of management measures. Front. Vet. Sci. 2018, 5, 1. [Google Scholar] [CrossRef] [Green Version]
  13. Vanschoenwinkel, B.; Waterkeyn, A.; Vandecaetsbeek, T.; Pineau, O.; Grillas, P.; Brendonck, L. Dispersal of freshwater invertebrates by large terrestrial mammals: A case study with wild boar (Sus scrofa) in mediterranean wetlands. Freshw. Biol. 2008, 53, 2264–2273. [Google Scholar] [CrossRef]
  14. Bacon, P.R. Use of wetlands for tourism in the insular caribbean. Ann. Tour. Res. 1987, 14, 104–117. [Google Scholar] [CrossRef]
  15. Hammer, D.A. Constructed Wetlands for Wastewater Treatment: Municipal, Industrial and Agricultural; CRC Press: Boca Raton, FL, USA, 1989. [Google Scholar]
  16. Jourdain, E.; Gauthier-Clerc, M.; Bicout, D.; Sabatier, P. Bird migration routes and risk for pathogen dispersion into western mediterranean wetlands. Emerg. Infect. Dis. 2007, 13, 365–372. [Google Scholar] [CrossRef]
  17. Rabou, A.F.N.A.; Yassin, M.M.; Sharif, F.A.; Al-Agha, M.R.; Daher, K.S.A.; Ali, A.K.S.; Hamad, D.M. Inhabitants knowledge on mosquito proliferation and control in the wetland ecosystem of Wadi Gaza, Gaza Strip, Palestine. IUG J. Nat. Stud. 2015, 16, 41–61. [Google Scholar]
  18. Rey, J.R.; Walton, W.E.; Wolfe, R.J.; Connelly, R.; O’Connell, S.M.; Berg, J.; Sakolsky-Hoopes, G.E.; Laderman, A.D. North american wetlands and mosquito control. Int. J. Environ. Res. Public. Health 2012, 9, 4537–4605. [Google Scholar] [CrossRef] [PubMed]
  19. Dudek, K. Impact of biodiversity on tick-borne diseases. Przegl. Epidemiol. 2014, 68, 681–684. [Google Scholar] [PubMed]
  20. De la Fuente, J.; Gortazar, C. Wild Boars as hosts of human-pathogenic Anaplasma Phagocytophilum variants. Emerg. Infect. Dis. 2012, 18, 2094–2095. [Google Scholar] [CrossRef] [Green Version]
  21. Fredriksson-Ahomaa, M. Wild boar: A reservoir of foodborne zoonoses. Foodborne Pathog. Dis. 2018, 16, 153–165. [Google Scholar] [CrossRef]
  22. De la Fuente, J.; Naranjo, V.; Ruiz-Fons, F.; Vicente, J.; Estrada-Peña, A.; Almazán, C.; Kocan, K.M.; Martín, M.P.; Gortázar, C. Prevalence of tick-borne pathogens in ixodid ticks (Acari: Ixodidae) collected from european wild boar (Sus scrofa) and iberian red deer (Cervus elaphus hispanicus) in central Spain. Eur. J. Wildl. Res. 2004, 50, 187–196. [Google Scholar] [CrossRef]
  23. Grech-Angelini, S.; Hervé, S.; Rose, N.; Barbier, N.; Casabianca, F.; Maestrini, O.; Falchi, A.; Simon, G. Serological survey of influenza a viruses in domestic and wild suidae in Corsica (France), a mediterranean island environment. Prev. Vet. Med. 2018, 157, 94–98. [Google Scholar] [CrossRef]
  24. Foata, J.; Mouillot, D.; Culioli, J.-L.; Marchand, B. Influence of season and host age on wild boar parasites in Corsica using indicator species analysis. J. Helminthol. 2006, 80, 41–45. [Google Scholar] [CrossRef] [PubMed]
  25. Oncfs—Grands Ongulés—Tableaux de Chasse Départementaux. Available online: http://www.oncfs.gouv.fr/Grands-ongules-Tableaux-de-chasse-ru248/Grands-ongules-Tableaux-de-chasse-departementaux-ar1480 (accessed on 18 February 2020).
  26. Pavio, N.; Laval, M.; Maestrini, O.; Casabianca, F.; Charrier, F.; Jori, F. Possible foodborne transmission of hepatitis e virus from domestic pigs and wild boars from Corsica. Emerg. Infect. Dis. 2016, 22, 2194–2199. [Google Scholar] [CrossRef] [Green Version]
  27. Richomme, C.; Lacour, S.A.; Ducrot, C.; Gilot-Fromont, E.; Casabianca, F.; Maestrini, O.; Vallée, I.; Grasset, A.; van der Giessen, J.; Boireau, P. Epidemiological survey of trichinellosis in wild boar (Sus scrofa) and fox (Vulpes vulpes) in a french insular region, Corsica. Vet. Parasitol. 2010, 172, 150–154. [Google Scholar] [CrossRef]
  28. Umhang, G.; Richomme, C.; Hormaz, V.; Boucher, J.-M.; Boué, F. Pigs and wild boar in Corsica harbor Echinococcus canadensis G6/7 at levels of concern for public health and local economy. Acta Trop. 2014, 133, 64–68. [Google Scholar] [CrossRef]
  29. Richomme, C.; Aubert, D.; Gilot-Fromont, E.; Ajzenberg, D.; Mercier, A.; Ducrot, C.; Ferté, H.; Delorme, D.; Villena, I. Genetic characterization of Toxoplasma gondii from wild boar (Sus scrofa) in France. Vet. Parasitol. 2009, 164, 296–300. [Google Scholar] [CrossRef]
  30. Richomme, C.; Afonso, E.; Tolon, V.; Ducrot, C.; Halos, L.; Alliot, A.; Perret, C.; Thomas, M.; Boireau, P.; Gilot-Fromont, E. Seroprevalence and factors associated with Toxoplasma gondii infection in wild boar (Sus scrofa) in a mediterranean island. Epidemiol. Infect. 2010, 138, 1257–1266. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  31. Grech-Angelini, S.; Stachurski, F.; Lancelot, R.; Boissier, J.; Allienne, J.-F.; Marco, S.; Maestrini, O.; Uilenberg, G. Ticks (Acari: Ixodidae) infesting cattle and some other domestic and wild hosts on the french mediterranean island of Corsica. Parasit. Vectors 2016, 9, 582. [Google Scholar] [CrossRef]
  32. Cicculli, V.; Maestrini, O.; Casabianca, F.; Villechenaud, N.; Charrel, R.; de Lamballerie, X.; Falchi, A. Molecular detection of spotted-fever group Rickettsiae in ticks collected from domestic and wild animals in Corsica, France. Pathogens 2019, 8, 138. [Google Scholar] [CrossRef] [Green Version]
  33. Grech-Angelini, S.; Stachurski, F.; Vayssier-Taussat, M.; Devillers, E.; Casabianca, F.; Lancelot, R.; Uilenberg, G.; Moutailler, S. Tick-borne pathogens in ticks (Acari: Ixodidae) collected from various domestic and wild hosts in corsica (France), a mediterranean island environment. Transbound. Emerg. Dis. 2020, 67, 745–757. [Google Scholar] [CrossRef]
  34. Selmi, M.; Ballardini, M.; Salvato, L.; Ricci, E. Rickettsia Spp. in Dermacentor marginatus ticks: Analysis of the host-vector-pathogen interactions in a northern mediterranean area. Exp. Appl. Acarol. 2017, 72, 79–91. [Google Scholar] [CrossRef] [PubMed]
  35. Hrazdilová, K.; Lesiczka, P.M.; Bardoň, J.; Vyroubalová, Š.; Šimek, B.; Zurek, L.; Modrý, D. Wild boar as a potential reservoir of zoonotic tick-borne pathogens. Ticks Tick-Borne Dis. 2021, 12, 101558. [Google Scholar] [CrossRef] [PubMed]
  36. Parola, P.; Raoult, D. Ticks and tickborne bacterial diseases in humans: An emerging infectious threat. Clin. Infect. Dis. Off. Publ. Infect. Dis. Soc. Am. 2001, 32, 897–928. [Google Scholar] [CrossRef] [PubMed]
  37. Nicholson, W.L.; Sonenshine, D.E.; Noden, B.H.; Brown, R.N. Chapter 27—Ticks (Ixodida). In Medical and Veterinary Entomology, 3rd ed.; Mullen, G.R., Durden, L.A., Eds.; Academic Press: Cambridge, MA, USA, 2019; pp. 603–672. [Google Scholar] [CrossRef]
  38. De la Fuente, J.; Estrada-Pena, A.; Venzal, J.M.; Kocan, K.M.; Sonenshine, D.E. Overview: Ticks as vectors of pathogens that cause disease in humans and animals. Front. Biosci. J. Virtual Libr. 2008, 13, 6938–6946. [Google Scholar] [CrossRef] [Green Version]
  39. Sonenshine, E.D. Biology of Ticks; Oxford University Press: New York, NY, USA; Oxford, UK, 1991; Volume 1. [Google Scholar]
  40. Eldridge, B.F.; Edman, J. Medical Entomology: A Textbook on Public Health and Veterinary Problems Caused by Arthropods; Springer Science & Business Media: Berlin, Germany, 2003. [Google Scholar]
  41. Pérez-Eid, C. Les Tiques: Identification, Biologie, Importance Médicale et Vétérinaire; Lavoisier: Cachan, France, 2007. [Google Scholar]
  42. Cicculli, V.; Capai, L.; Quilichini, Y.; Masse, S.; Fernández-Alvarez, A.; Minodier, L.; Bompard, P.; Charrel, R.; Falchi, A. Molecular investigation of tick-borne pathogens in ixodid ticks infesting domestic animals (cattle and sheep) and small rodents (black rats) of Corsica, France. Ticks Tick-Borne Dis. 2019, 10, 606–613. [Google Scholar] [CrossRef]
  43. Cicculli, V.; de Lamballerie, X.; Charrel, R.; Falchi, A. First molecular detection of Rickettsia africae in a tropical bont tick, Amblyomma variegatum, collected in Corsica, France. Exp. Appl. Acarol. 2019, 77, 207–214. [Google Scholar] [CrossRef] [Green Version]
  44. Estrada-Peña, A. Ticks of Domestic Animals in the Mediterranean Region: A Guide to Identification of Species; University of Zaragoza: Zaragoza, Aragon, Spain, 2004. [Google Scholar]
  45. Raad, M.; Azar, D.; Perotti, M.A. First report of the ticks Haemaphysalis punctata Canestrini et Fanzago, 1878, Haemaphysalis parva (Neumann, 1897) and Dermacentor marginatus (Sulzer, 1776) (Acari, Amblyommidae) from humans in Lebanon. Acta Parasitol. 2020, 65, 541–545. [Google Scholar] [CrossRef] [Green Version]
  46. Leulmi, H.; Aouadi, A.; Bitam, I.; Bessas, A.; Benakhla, A.; Raoult, D.; Parola, P. Detection of Bartonella tamiae, Coxiella burnetii and Rickettsiae in arthropods and tissues from wild and domestic animals in northeastern Algeria. Parasit. Vectors 2016, 9, 27. [Google Scholar] [CrossRef]
  47. Zeroual, F.; Leulmi, H.; Bitam, I.; Benakhla, A. Molecular evidence of Rickettsia slovaca in spleen of wild boars in northeastern Algeria. New Microbes New Infect. 2018, 24, 17–20. [Google Scholar] [CrossRef]
  48. Matsumoto, K.; Parola, P.; Brouqui, P.; Raoult, D. Rickettsia aeschlimannii in Hyalomma ticks from Corsica. Eur. J. Clin. Microbiol. Infect. Dis. 2004, 23, 732–734. [Google Scholar] [CrossRef]
  49. Bournez, L.; Umhang, G.; Faure, E.; Boucher, J.-M.; Boué, F.; Jourdain, E.; Sarasa, M.; Llorente, F.; Jiménez-Clavero, M.A.; Moutailler, S.; et al. Exposure of wild ungulates to the Usutu and Tick-borne encephalitis viruses in France in 2009-2014: Evidence of undetected flavivirus circulation a decade ago. Viruses 2019, 12, 10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  50. Dugat, T.; Zanella, G.; Véran, L.; Lesage, C.; Girault, G.; Durand, B.; Lagrée, A.-C.; Boulouis, H.-J.; Haddad, N. Multiple-locus variable-number tandem repeat analysis potentially reveals the existence of two groups of Anaplasma phagocytophilum circulating in cattle in France with different wild reservoirs. Parasit. Vectors 2016, 9, 596. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  51. Sanogo, Y.O.; Davoust, B.; Parola, P.; Camicas, J.L.; Brouqui, P.; Raoult, D. Prevalence of Rickettsia spp. in Dermacentor marginatus ticks removed from game pigs (Sus scrofa) in southern France. Ann. N. Y. Acad. Sci. 2003, 990, 191–195. [Google Scholar] [CrossRef] [PubMed]
  52. Keysary, A.; Eremeeva, M.E.; Leitner, M.; Din, A.B.; Wikswo, M.E.; Mumcuoglu, K.Y.; Inbar, M.; Wallach, A.D.; Shanas, U.; King, R.; et al. Spotted fever group Rickettsiae in ticks collected from wild animals in Israel. Am. J. Trop. Med. Hyg. 2011, 85, 919–923. [Google Scholar] [CrossRef] [Green Version]
  53. Waner, T.; Keysary, A.; Eremeeva, M.E.; Din, A.B.; Mumcuoglu, K.Y.; King, R.; Atiya-Nasagi, Y. Rickettsia africae and Candidatus Rickettsia barbariae in ticks in Israel. Am. J. Trop. Med. Hyg. 2014, 90, 920–922. [Google Scholar] [CrossRef] [Green Version]
  54. Ebani, V.; Bertelloni, F.; Cecconi, G.; Sgorbini, M.; Cerri, D. Zoonotic tick-borne bacteria among wild boars (Sus scrofa) in central Italy. Asian Pac. J. Trop. Dis. 2017, 7, 141–143. [Google Scholar] [CrossRef]
  55. Raele, D.A.; Galante, D.; Pugliese, N.; Salandra, G.L.; Cafiero, M.A. Spotted fever group Rickettsiae associated with ixodid ticks in wild environment in southern Italy. MicrobiologyOpen 2018, 7, e527. [Google Scholar] [CrossRef] [Green Version]
  56. Chisu, V.; Masala, G.; Foxi, C.; Socolovschi, C.; Raoult, D.; Parola, P. Rickettsia conorii israelensis in Rhipicephalus sanguineus ticks, Sardinia, Italy. Ticks Tick-Borne Dis. 2014, 5, 446–448. [Google Scholar] [CrossRef] [PubMed]
  57. Chisu, V.; Foxi, C.; Mannu, R.; Satta, G.; Masala, G. A five-year survey of tick species and identification of tick-borne bacteria in Sardinia, Italy. Ticks Tick-Borne Dis. 2018, 9, 678–681. [Google Scholar] [CrossRef]
  58. Pascucci, I.; Di Domenico, M.; Curini, V.; Cocco, A.; Averaimo, D.; D’Alterio, N.; Cammà, C. Diversity of Rickettsia in ticks collected in Abruzzi and Molise regions (central Italy). Microorganisms 2019, 7, 696. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  59. Satta, G.; Chisu, V.; Cabras, P.; Fois, F.; Masala, G. Pathogens and symbionts in ticks: A survey on tick species distribution and presence of tick-transmitted micro-organisms in Sardinia, Italy. J. Med. Microbiol. 2011, 60, 63–68. [Google Scholar] [CrossRef] [Green Version]
  60. Zanet, S.; Trisciuoglio, A.; Bottero, E.; de Mera, I.G.F.; Gortazar, C.; Carpignano, M.G.; Ferroglio, E. Piroplasmosis in wildlife: Babesia and Theileria affecting free-ranging ungulates and carnivores in the italian alps. Parasit Vectors 2014, 7, 70. [Google Scholar] [CrossRef] [Green Version]
  61. Smrdel, K.S.; Bidovec, A.; Malovrh, T.; Petrovec, M.; Duh, D.; Zupanc, T.A. Detection of Anaplasma phagocytophilum in wild boar in Slovenia. Clin. Microbiol. Infect. 2009, 15, 50–52. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  62. Zele, D.; Avberšek, J.; Gruntar, I.; Ocepek, M.; Vengušt, G. Evidence of Anaplasma phagocytophilum in game animals from Slovenia. Acta Vet. Hung. 2012, 60, 441–448. [Google Scholar] [CrossRef] [Green Version]
  63. Astobiza, I.; Barral, M.; Ruiz-Fons, F.; Barandika, J.F.; Gerrikagoitia, X.; Hurtado, A.; García-Pérez, A.L. Molecular investigation of the occurrence of Coxiella burnetii in wildlife and ticks in an endemic area. Vet. Microbiol. 2011, 147, 190–194. [Google Scholar] [CrossRef] [PubMed]
  64. Oteo, J.A.; Portillo, A.; Santibáñez, S.; Pérez-Martínez, L.; Blanco, J.R.; Jiménez, S.; Ibarra, V.; Pérez-Palacios, A.; Sanz, M. Prevalence of spotted fever group Rickettsia species detected in ticks in La Rioja, Spain. Ann. N. Y. Acad. Sci. 2006, 1078, 320–323. [Google Scholar] [CrossRef]
  65. Ortuño, A.; Quesada, M.; López, S.; Miret, J.; Cardeñosa, N.; Castellà, J.; Anton, E.; Segura, F. Prevalence of Rickettsia slovaca in Dermacentor marginatus ticks removed from wild boar (Sus scrofa) in northeastern Spain. Ann. N. Y. Acad. Sci. 2006, 1078, 324–327. [Google Scholar] [CrossRef]
  66. Márquez, F.J. Spotted fever group Rickettsia in ticks from southeastern Spain natural parks. Exp. Appl. Acarol. 2008, 45, 185–194. [Google Scholar] [CrossRef]
  67. Orkun, Ö.; Karaer, Z. Molecular characterization of Babesia species in wild animals and their ticks in Turkey. Infect. Genet. Evol. 2017, 55, 8–13. [Google Scholar] [CrossRef]
  68. Beuglet, F.; Moreau, Y. Babesiosis. New Dev. Major Vector-Borne Dis. Part 2 Important Dis. Vet. 2015, 34, 627–639. [Google Scholar] [CrossRef]
  69. Vannier, E.G.; Diuk-Wasser, M.A.; Ben Mamoun, C.; Krause, P.J. Babesiosis. Infect. Dis. Clin. N. Am. 2015, 29, 357–370. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  70. Davoust, B.; Mediannikov, O.; Marié, J.-L.; Socolovschi, C.; Parola, P.; Raoult, D. Les animaux vertébrés sont-ils réservoirs de rickettsies? Bull. Académie Vét. Fr. 2010, 163, 291–302. [Google Scholar] [CrossRef] [Green Version]
  71. Blanton, L.S. The rickettsioses: A practical update. Infect. Dis. Clin. N. Am. 2019, 33, 213–229. [Google Scholar] [CrossRef] [PubMed]
  72. Raoult, D.; Nicolas, D.; De Micco, P.; Gallais, H.; Casanova, P. Epidemiologic aspects of mediterranean boutonneuse fever in the south of Corsica. Bull. Soc. Pathol. Exot. Filiales 1985, 78, 446–451. [Google Scholar] [PubMed]
  73. Rehácěk, J. Rickettsia slovaca, the Organism and Its Ecology; Academia: San Francisco, CA, USA, 1984. [Google Scholar]
  74. De Sousa, R.; Pereira, B.I.; Nazareth, C.; Cabral, S.; Ventura, C.; Crespo, P.; Marques, N.; da Cunha, S. Rickettsia slovaca infection in humans, Portugal. Emerg. Infect. Dis. 2013, 19, 1627–1629. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  75. Brouqui, P.; Parola, P.; Fournier, P.E.; Raoult, D. Spotted fever rickettsioses in southern and eastern europe. FEMS Immunol. Med. Microbiol. 2007, 49, 2–12. [Google Scholar] [CrossRef] [Green Version]
  76. Selmi, M.; Martello, E.; Bertolotti, L.; Bisanzio, D.; Tomassone, L. Rickettsia slovaca and Rickettsia raoultii in Dermacentor marginatus ticks collected on wild boars in Tuscany, Italy. J. Med. Entomol. 2009, 46, 1490–1493. [Google Scholar] [CrossRef]
  77. Spitalská, E.; Stefanidesová, K.; Kocianová, E.; Boldiš, V. Rickettsia slovaca and Rickettsia raoultii in Dermacentor marginatus and Dermacentor reticulatus ticks from Slovak Republic. Exp. Appl. Acarol. 2012, 57, 189–197. [Google Scholar] [CrossRef] [PubMed]
  78. Blanda, V.; Torina, A.; La Russa, F.; D’Agostino, R.; Randazzo, K.; Scimeca, S.; Giudice, E.; Caracappa, S.; Cascio, A.; de la Fuente, J. A retrospective study of the characterization of Rickettsia species in ticks collected from humans. Ticks Tick-Borne Dis. 2017, 8, 610–614. [Google Scholar] [CrossRef]
  79. Masala, G.; Chisu, V.; Satta, G.; Socolovschi, C.; Raoult, D.; Parola, P. Rickettsia slovaca from Dermacentor marginatus ticks in Sardinia, Italy. Ticks Tick-Borne Dis. 2012, 3, 393–395. [Google Scholar] [CrossRef] [PubMed]
  80. Chisu, V.; Leulmi, H.; Masala, G.; Piredda, M.; Foxi, C.; Parola, P. Detection of Rickettsia hoogstraalii, Rickettsia helvetica, Rickettsia massiliae, Rickettsia slovaca and Rickettsia aeschlimannii in ticks from Sardinia, Italy. Ticks Tick-Borne Dis. 2017, 8, 347–352. [Google Scholar] [CrossRef]
  81. Beati, L.; Meskini, M.; Thiers, B.; Raoult, D. Rickettsia aeschlimannii Sp. Nov., a New spotted fever group Rickettsia associated with Hyalomma marginatum ticks. Int. J. Syst. Bacteriol. 1997, 47, 548–554. [Google Scholar] [CrossRef] [Green Version]
  82. Raoult, D.; Fournier, P.-E.; Abboud, P.; Caron, F. First documented human Rickettsia aeschlimannii infection. Emerg. Infect. Dis. 2002, 8, 748–749. [Google Scholar] [CrossRef] [PubMed]
  83. Fernández-Soto, P. Rickettsia aeschlimannii in Spain: Molecular evidence in Hyalomma marginatum and five other tick species that feed on humans. Emerg. Infect. Dis. 2003, 9, 889–890. [Google Scholar] [CrossRef]
  84. Battisti, E.; Urach, K.; Hodžić, A.; Fusani, L.; Hufnagl, P.; Felsberger, G.; Ferroglio, E.; Duscher, G.G. Zoonotic Pathogens in ticks from migratory birds, Italy. Emerg. Infect. Dis. 2020, 26, 2986–2988. [Google Scholar] [CrossRef]
  85. Wallménius, K.; Barboutis, C.; Fransson, T.; Jaenson, T.G.; Lindgren, P.-E.; Nyström, F.; Olsen, B.; Salaneck, E.; Nilsson, K. Spotted fever Rickettsia species in Hyalomma and Ixodes ticks infesting migratory birds in the european mediterranean area. Parasit. Vectors 2014, 7, 318. [Google Scholar] [CrossRef] [Green Version]
  86. Madison-Antenucci, S.; Kramer, L.D.; Gebhardt, L.L.; Kauffman, E. Emerging tick-borne diseases. Clin. Microbiol. Rev. 2020, 33, e00083-18. [Google Scholar] [CrossRef] [PubMed]
  87. Baldridge, G.D.; Scoles, G.A.; Burkhardt, N.Y.; Schloeder, B.; Kurtti, T.J.; Munderloh, U.G. Transovarial transmission of Francisella-like endosymbionts and Anaplasma phagocytophilum variants in Dermacentor albipictus (Acari: Ixodidae). J. Med. Entomol. 2009, 46, 625. [Google Scholar] [CrossRef] [Green Version]
  88. Taank, V.; Ramasamy, E.; Sultana, H.; Neelakanta, G. An efficient microinjection method to generate human anaplasmosis agent Anaplasma phagocytophilum-infected ticks. Sci. Rep. 2020, 10, 15994. [Google Scholar] [CrossRef]
  89. Guzman, N.; Yarrarapu, S.N.S.; Beidas, S.O. Anaplasma phagocytophilum. In StatPearls; StatPearls Publishing: Treasure Island, FL, USA, 2021. [Google Scholar]
  90. Kocan, K.M.; De La Fuente, J.; Cabezas-Cruz, A. The genus Anaplasma: New challenges after reclassification. Rev. Sci. Tech. 2015, 34, 577. [Google Scholar] [CrossRef]
  91. Nguyen, A.H.L.; Tiawsirisup, S.; Kaewthamasorn, M. Molecular Detection and genetic characterization of Anaplasma marginale and Anaplasma platys-like (rickettsiales: Anaplasmataceae) in water buffalo from eight provinces of Thailand. BMC Vet. Res. 2020, 16, 380. [Google Scholar] [CrossRef] [PubMed]
  92. Cicculli, V.; Decarreaux, D.; Ayhan, N.; Casabianca, F.; Lamballerie, X.; Charrel, R.; Falchi, A. Molecular screening of Anaplasmataceae in ticks collected from cattle in Corsica, France. Exp. Appl. Acarol. 2020, 81, 561–574. [Google Scholar] [CrossRef] [PubMed]
  93. Cabezas-Cruz, A.; Gallois, M.; Fontugne, M.; Allain, E.; Denoual, M.; Moutailler, S.; Devillers, E.; Zientara, S.; Memmi, M.; Chauvin, A.; et al. Epidemiology and genetic diversity of Anaplasma ovis in goats in Corsica, France. Parasit. Vectors 2019, 12, 3. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  94. Dahmani, M.; Davoust, B.; Tahir, D.; Raoult, D.; Fenollar, F.; Mediannikov, O. Molecular investigation and phylogeny of Anaplasmataceae species infecting domestic animals and ticks in Corsica, France. Parasit. Vectors 2017, 10, 302. [Google Scholar] [CrossRef] [Green Version]
  95. Gondard, M.; Michelet, L.; Nisavanh, A.; Devillers, E.; Delannoy, S.; Fach, P.; Aspan, A.; Ullman, K.; Chirico, J.; Hoffmann, B.; et al. Prevalence of tick-borne viruses in Ixodes ricinus assessed by high-throughput real-time PCR. Pathog. Dis. 2018, 76, fty083. [Google Scholar] [CrossRef] [Green Version]
  96. Michelet, L.; Delannoy, S.; Devillers, E.; Umhang, G.; Aspan, A.; Juremalm, M.; Chirico, J.; van der Wal, F.J.; Sprong, H.; Boye Pihl, T.P.; et al. High-throughput screening of tick-borne pathogens in europe. Front. Cell. Infect. Microbiol. 2014, 4, 103. [Google Scholar] [CrossRef]
Pathogens 10 01643 g001 550
Figure 1. Map of Corsica showing the locations of positive samples from wild boars and ticks (1. Aléria, 2. Appietto, 3. Bonifacio, 4. Chiatra, 5. Ersa, 6. Ghisonaccia, 7. Linguizetta, 8. Luciana, 9. Penta-di-casinca, 10. Pianottoli-Caldarello, 11. Prunelli-di-Casaconi, 12. Solaro, 13. Taglio-Isolaccio, 14. Tallone, 15. Vescovato, 16. Ventiseri, 17. Volpajola).
Figure 1. Map of Corsica showing the locations of positive samples from wild boars and ticks (1. Aléria, 2. Appietto, 3. Bonifacio, 4. Chiatra, 5. Ersa, 6. Ghisonaccia, 7. Linguizetta, 8. Luciana, 9. Penta-di-casinca, 10. Pianottoli-Caldarello, 11. Prunelli-di-Casaconi, 12. Solaro, 13. Taglio-Isolaccio, 14. Tallone, 15. Vescovato, 16. Ventiseri, 17. Volpajola).
Pathogens 10 01643 g001
Pathogens 10 01643 g002 550
Figure 2. Distribution of Rickettsiae species found in ticks collected from wild boars (Sus scrofa) in the Mediterranean Rim (data from the literature).
Figure 2. Distribution of Rickettsiae species found in ticks collected from wild boars (Sus scrofa) in the Mediterranean Rim (data from the literature).
Pathogens 10 01643 g002
Table
Table 1. Tick-borne pathogen distribution in wild boar and their ticks in the Corsican wetlands.
Table 1. Tick-borne pathogen distribution in wild boar and their ticks in the Corsican wetlands.
Municipalities (No)Sampled Wild Boar/PositiveD. marginatusHy. marginatumHy. scupenseRh. sanguineus s.l.Total Ticks
-Total/Positive (A/B/R/Ra/Rs)Total/Positive (A/B/R/Ra/Rs)Total/Positive (A/B/R/Ra/Rs)Total/Positive (A/B/R/Ra/Rs)Total/Positive (A/B/R/Ra/Rs)Total/Positive (A/B/R/Ra/Rs)
Aléria (1)73/047/39 (Rs)---47/39 (Rs)
Appietto (2)2/0-----
Bonifacio (3)3/0-----
Chiatra (4)11/3 (B)24/1 (R), 24 (Rs)2/1 (Ra)-1/1 (Ra)27/1 (R), 2 (Ra), 24 (Rs)
Ersa (5)3/05/1 (A), 4 (Rs)---5/1 (A), 4 (Rs)
Ghisonaccia (6)10/0-----
Linguizetta (7)11/04/1 (Rs)-1/1 (Ra)-5/1 (Rs), 1(Ra)
Luciana (8)1/0-----
Penta di casinca (9)2/08/4 (Rs)---8/4 (Rs)
Pianottoli-Caldarello (10)1/0-----
Prunelli-di-Casaconi (11)2/0-----
Solaro (12)5/07/1 (Ra), 1 (Rs)---7/1 (Ra), 1 (Rs)
Taglio-Isolaccio (13)2/05/1 (R), 3 (Rs)---5/1 (R), 3 (Rs)
Tallone (14)20/08/1 (R), 2 (Ra), 4 (Rs)---8/1 (R), 2 (Ra), 4 (Rs)
Vescovato (15)3/0-----
Ventiseri (16)7/01/1---1
Volpajola (17)2/0-----
Total/Positive 158/3 (B)109/1 (A), 3 (R), 3 (Ra), 80 (Rs)2/1 (Ra)1/1 (Ra)1/1 (Ra)113/1 (A), 3 (R), 6 (Ra), 80 (Rs)
A: Anaplasma spp., B: Babesia spp., R: Rickettsia spp., Ra: R. aeschlimannii, Rs: R. slovaca.
Table
Table 3. List of pathogens, targets and primer/probe sets created.
Table 3. List of pathogens, targets and primer/probe sets created.
PathogenNameSequenceLength (Nucleotide)GenesGenes References
Aujeszky’s virusAujv_gp50_FCTTTATCGAGTACGCCGACTG225gp50Y14834.1
Av_gp50_RAACGGGCACTCTTGCCCC
Av_gp50_PCAGATCTTTGGGCGCTGCCGGC
Ch. psitacciChl_psi_16S-23S_FACGCCGTGAATACGTTCCC21416S-23S rRNAU68450.1
Chl_psi_16S-23S_RAGTCAAACCGTCCTAAGACAG
Chl_psi_16S-23S_PCCTTGTACACACCGCCCGTCACATC
Haemoproteus spp.Hae_cytB_FATATGCATGCTACTGGTGCTAC240cytochrome BAF465579.1
Hae_cytB_RCAAATCCATGAAACAAGTCCAGG
Hae_cytB_PCGGTTGCACCCCAGAAACTCATTGAC
Leptospira spp.Lep_Lipl32_FCTCTATGTTTGGATTCCTGCC158LipL32MK541891.1
Lep_Lipl32_RCCAAGTATCAAACCAATGTGGC
Lep_Lipl32_PATTGATTTTTCTTCTGGGGTAGCCGCTTTG
Leucocytozoon spp.Leu_cytB_FGGGTTATGTCTTACCATGGGG177cytochrome BKF717066.1
Leu_cytB_RAATTGCTAGTGCTACGAATGGG
Leu_cytB_PAAATGAGTTTTTGGGGAGCAACCGTTATTAC
Plasmodium spp.Pla_ssrRNA_FATATAGAAACTGCGAACGGCTC339ssrRNAMK650620.1
Pla_ssrRNA_RTTTCTCAGGCTCCCTCTCC
Pla_ssrRNA_PCTCTAATTCCCCGTTACCCGTCATAGC
R. monacensisRic_mon_FCTCGGTGCCGGTACTTTAAAC192ompBKU961543.1
Ric_mon_RGAGCACCGCCAATAAGAGC
Ric_mon_PAGTGCCGATGCAAATACTCCGGTGAC
Trypanosoma spp.Try_18SRNA_FGTAATTCCAGCTCCAAAAGCG17818SRNAEU596263.1
Try_18SRNA_RTCAGGAAGGAACCACTCCC
Try_18SRNA_PACCTCAAGGGCATGGGTCACCAATCC
Table
Table 4. List of pathogens, targets and primer/probe sets used for confirmation.
Table 4. List of pathogens, targets and primer/probe sets used for confirmation.
PathogenNameSequenceLength (Nucleotide)GenesGenes References
Aujeszky’s virusAujv_gp50_F2AACATCCTCACCGACTTCATG 158gp50Y14834.1
Av_gp50_R2CTGGTAGAACGGCGTCAGG
Av_gp50_P2AATCGCATCACGTCCACGCCCCC
Ch. psitacciChl_psi_16S-23S_F2AGTAATCTTCGGCGAGCTGG17716S-23S rRNAU68450.1
Chl_psi_16S-23S_R2CGCTACTTAGGGAATCTCTTT G
Chl_psi_16S-23S_P2TATAAAGCTATGACCCGGAGGTCTCCG
Haemoproteus spp.Hae_cytB_F2CCTTGGGGTCAAATGAGTTTC 231cytochrome BAF465579.1
Hae_cytB_R2AAGCCGTATCATATCCTAAAGG
Hae_cytB_P2CCTGGACTTGTTTCATGGATTTGTGGAGG
Leucocytozoon spp.Leu_cytB_F2GAGTTTCTGGGGAGCTACTG 197cytochrome BKU842391.1
Leu_cytB_R2GGATTAGTGCTACCTTGAATATG
Leu_cytB_P2TGAATAAATACAATTGCTAGTGCTACGAATGG
Plasmodium spp.Pla_ssrRNA_F2TCGAGTTTCTGACCTATCAGC 264ssrRNAMK650620.1
Pla_ssrRNA_R2AGACTTGCCCTCCAATTGTTA C
Pla_ssrRNA_P2TGGCCTTGCATTGTTATTTCTTGTCACTACC
Trypanosoma spp.Try_18SRNA_F2CAACACGGGGAACTTTACCAG 14118SRNAEU596263.1
Try_18SRNA_R2ATCCTACTGGGCAGCTTGG
Try_18SRNA_P2CAGGGTGAGGATTGACAGATTGAGTGTTC
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Defaye, B.; Moutailler, S.; Pietri, C.; Galon, C.; Grech-Angelini, S.; Pasqualini, V.; Quilichini, Y. Molecular Detection of Zoonotic and Non-Zoonotic Pathogens from Wild Boars and Their Ticks in the Corsican Wetlands. Pathogens 2021, 10, 1643. https://doi.org/10.3390/pathogens10121643

AMA Style

Defaye B, Moutailler S, Pietri C, Galon C, Grech-Angelini S, Pasqualini V, Quilichini Y. Molecular Detection of Zoonotic and Non-Zoonotic Pathogens from Wild Boars and Their Ticks in the Corsican Wetlands. Pathogens. 2021; 10(12):1643. https://doi.org/10.3390/pathogens10121643

Chicago/Turabian Style

Defaye, Baptiste, Sara Moutailler, Christian Pietri, Clemence Galon, Sébastien Grech-Angelini, Vanina Pasqualini, and Yann Quilichini. 2021. "Molecular Detection of Zoonotic and Non-Zoonotic Pathogens from Wild Boars and Their Ticks in the Corsican Wetlands" Pathogens 10, no. 12: 1643. https://doi.org/10.3390/pathogens10121643

APA Style

Defaye, B., Moutailler, S., Pietri, C., Galon, C., Grech-Angelini, S., Pasqualini, V., & Quilichini, Y. (2021). Molecular Detection of Zoonotic and Non-Zoonotic Pathogens from Wild Boars and Their Ticks in the Corsican Wetlands. Pathogens, 10(12), 1643. https://doi.org/10.3390/pathogens10121643

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop