Next Article in Journal
Deletion Mutants of Francisella Phagosomal Transporters FptA and FptF Are Highly Attenuated for Virulence and Are Protective Against Lethal Intranasal Francisella LVS Challenge in a Murine Model of Respiratory Tularemia
Next Article in Special Issue
Wastewater Based Epidemiology Perspective as a Faster Protocol for Detecting Coronavirus RNA in Human Populations: A Review with Specific Reference to SARS-CoV-2 Virus
Previous Article in Journal
An Endophytic Fungi-Based Biostimulant Modulates Volatile and Non-Volatile Secondary Metabolites and Yield of Greenhouse Basil (Ocimum basilicum L.) through Variable Mechanisms Dependent on Salinity Stress Level
Previous Article in Special Issue
Seasonal Stability of SARS-CoV-2 in Biological Fluids
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Pathogens
Volume 10
Issue 7
10.3390/pathogens10070798
pathogens-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Occurrence of SARS-CoV-2 RNA in Six Municipal Wastewater Treatment Plants at the Early Stage of COVID-19 Pandemic in The United States

by
Samendra P. Sherchan
1,*,
Shalina Shahin
1,
Jeenal Patel
1,
Lauren M. Ward
1,
Sarmila Tandukar
2,
Sital Uprety
3,
Bradley W. Schmitz
4,
Warish Ahmed
5,
Stuart Simpson
6 and
Pradip Gyawali
7
1
Department of Environmental Health Sciences, Tulane University, 1440 Canal Street, Suite 2100, New Orleans, LA 70112, USA
2
Policy Research Institute, Sano Gaucharan, Kathmandu 44600, Nepal
3
Swiss Federal Institute of Aquatic Science and Technology, Eawag, Überlandstrasse 133, Dübendorf, 8600 Zürich, Switzerland
4
Yuma Center of Excellence for Desert Agriculture (YCEDA), University of Arizona, 6425 W. 8th St., Yuma, AZ 85364, USA
5
CSIRO Land and Water, Ecosciences Precinct, 41 Boggo Road, Dutton Park, QLD 4102, Australia
6
CSIRO Land and Water, Lucas Heights, NSW 2234, Australia
7
Institute of Environmental Science and Research Ltd., Porirua 5240, New Zealand
*
Author to whom correspondence should be addressed.
Pathogens 2021, 10(7), 798; https://doi.org/10.3390/pathogens10070798
Submission received: 23 April 2021 / Revised: 9 June 2021 / Accepted: 16 June 2021 / Published: 23 June 2021
(This article belongs to the Special Issue SARS-CoV-2 in the Water Environment)
Versions Notes

Abstract

:
In this study, we investigated the occurrence of Severe Acute Respiratory Syndrome Coronavirus-2 (SARS-CoV-2) RNA in primary influent (n = 42), secondary effluent (n = 24) and tertiary treated effluent (n = 34) collected from six wastewater treatment plants (WWTPs A–F) in Virginia (WWTP A), Florida (WWTPs B, C, and D), and Georgia (WWTPs E and F) in the United States during April–July 2020. Of the 100 wastewater samples analyzed, eight (19%) untreated wastewater samples collected from the primary influents contained SARS-CoV-2 RNA as measured by reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) assays. SARS-CoV-2 RNA were detected in influent wastewater samples collected from WWTP A (Virginia), WWTPs E and F (Georgia) and WWTP D (Florida). Secondary and tertiary effluent samples were not positive for SARS-CoV-2 RNA indicating the treatment processes in these WWTPs potentially removed SARS-CoV-2 RNA during the secondary and tertiary treatment processes. However, further studies are needed to understand the log removal values (LRVs) and transmission risks of SARS-CoV-2 RNA through analyzing wastewater samples from a wider range of WWTPs.

1. Introduction

Severe Acute Respiratory Syndrome Coronavirus-2 (SARS-CoV-2) is mainly transmitted through respiratory droplets; however, it has been detected in fecal samples and rectal swabs from infected people [1,2,3,4]. Viral shedding in the feces has been reported from day 1 to 33 after a negative nasopharyngeal swab and for up to 47 days after onset of COVID-19 symptoms [5]. Several recent studies have reported the presence of SARS-CoV-2 RNA in untreated wastewater in several countries [2,3,6,7,8,9,10]. Consequently, wastewater monitoring of SARS-CoV-2 RNA has been suggested as a non-invasive early warning tool and is currently being considered as a complementary tool for population-wide surveillance of COVID-19 pandemic [2,11,12].
Despite many reports of SARS-CoV-2 RNA detection in untreated municipal wastewater and primary sludge [2,3,4,6,7,8,9,13,14], data on presence in secondary treated and tertiary effluents are still limited [15]. Only a handful of studies have reported the occurrence of SARS-CoV-2 RNA in secondary treated effluent [8,11], while several studies could not detect SARS-CoV-2 RNA in treated effluents [3,8,9,10,16]. Haramoto and colleagues could not detect SARS-CoV-2 RNA in river water receiving chlorinated effluents [11], while Rimoldi et al. [10] detected SARS CoV-2 RNA in rivers receiving treated wastewaters in Italy during April 2020. Another study from Quito, Ecuador, reported the presence of SARS-CoV-2 RNA in river samples receiving untreated wastewaters [17].
Several papers suggested enteric transmission of SARS-CoV-2 can be possible via human waste and wastewater [18,19]. Therefore, it is important to determine the occurrence of SARS-CoV-2 RNA through wastewater treatment processes. The present study aimed to investigate the prevalence of SARS-CoV-2 RNA in untreated wastewater influents and treated effluents at six wastewater treatment plants (WWTPs) from three states (Virginia, Florida, and Georgia) in the United States in the early stage of the pandemic.

2. Material and Methods

2.1. Wastewater Sample Collection

Wastewater samples consisting of primary influent (n = 42), secondary-treated effluent (n = 24), and final tertiary effluent (n = 34) were collected between 28 April and 8 July 2020 from six WWTPs. These WWTPs are located in Virginia (WWTP A), Florida (WWTPs B, C, D), and Georgia (WWTPs E and F). Information about the treatment plant and the population served are provided by each respective water utility as demonstrated in Table 1. Composite wastewater samples (1L) were collected via 24-h autosamplers from influent and treated effluents in sterile Nalgene bottle bi-weekly during the study period. Sample bottles were kept in a cooler containing ice and shipped overnight to the laboratory at Tulane University. Upon arrival in the laboratory, samples were stored at −80 °C for two weeks due to delay in delivery of consumables.

2.2. SARS-CoV-2 Concentration

Untreated and treated wastewater samples were concentrated using three different techniques: ultrafiltration [7]; adsorption-elution [11]; and adsorption-extraction [20]. Remaining samples from April to July were processed using the adsorption-extraction method due to a shortage of supplies related to other methods. Ultrafiltration (Method A) applied the Centricon® Plus-70 centrifugal filter with a nominal molecular weight limit (NMWL) of 100 kDa (Merck Millipore; part no UFC710008, Burlington, MA, USA). The adsorption-elution method (Method B) used an electronegative membrane as described elsewhere [3,21]. The adsorption-extraction method (Method C) also used an electronegative membrane, as well as a wastewater sample amended with MgCl2 pretreatment as reported previously [20].

2.3. Sample Process Control

Following virus concentration, 200 µL of the concentrated samples from Methods A and B, respectively, were then seeded with Pseudomonas bacteriophage Φ6 (DSM 21518). Φ6 addition acted as a sample process control (SPC) to determine the RNA extraction efficiency and identify the potential Reverse Transcriptase Quantitative Polymerase Chain Reaction (RT-qPCR) inhibition. Briefly, 2 μL of Pseudomonas bacteriophage Φ6 (2.0 × 105 copies/μL) was seeded into 200 μL of concentrated wastewater samples and molecular biology grade water was used as a non-inhibitory control benchmark. The extraction efficiency (E) was calculated using the following equation
E = C/C0 × 100.
where C represents the observed Φ6-cDNA copy numbers per qPCR reaction in a wastewater sample, and Co represents copy numbers per qPCR reaction in the control benchmark. RT-qPCR inhibition was determined by testing neat and 10-fold diluted RNA samples for Φ6. The differences between the neat and 10-fold diluted RNA for Φ6 were ≥ 3 CT values, and therefore considered to be potentially inhibitor free.

2.4. RNA Extraction and cDNA Preparation

Viral RNA was extracted from the concentrated samples and electronegative filter (200 μL) using a ZR Viral DNA/RNA Kit (Zymo Research, Irvine, CA, USA) to obtain a final volume of 100 µL, according to the manufacturer’s protocol. cDNA was prepared from 15 μL RNA using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions. The RT reaction mixture was incubated at 25 °C for 10 min, followed by 37 °C for 120 min, and a final incubation at 85 °C for 5 min to inactivate the enzyme.

2.5. RT-qPCR for SARS-CoV-2

RT-qPCR assays for SARS-CoV-2 was performed in BioRad CFX96 Real-Time PCR Instrument (BioRad Laboratories, Hercules, CA, USA) using CDC N1 and N2 primers and probes [3]. Reaction mixtures (25 μL) consisted of 12.5 μL of PerfecTa qPCR ToughMix (Quantabio, Beverly, MA, USA), 0.1 μL each of 100 μM forward and reverse primers, 0.05 μL of 100 μM TaqMan probe, and 2.5 μL of cDNA template. Details of PCR conditions and primer/probe information are provided in Table 2. The standard curve was generated using serial ten-fold dilution of the standard plasmid of SARS-CoV-2 and gBlock of Φ6 obtained from IDT (Coralville, IA, USA) [3]. Negative controls (DNase and RNase free water) were included to detect false-positive PCR amplification due to potential cross contamination. All RT-qPCR reactions were performed in duplicate. The sample was considered positive when both tubes fluoresced with sufficient intensity and the average cycle threshold (CT) value < 40 [22]. The slope of the standards ranged between −3.01 (CDC N2) to −3.34 (Φ6). Y-intercept values were −41 (Φ6), −39.17 (CDC N1), and −38.49 (CDC N2). The correlation coefficient (R2) values for these assays were 0.996% (CDC N1), 0.991% (CDC N2), and 0.999% (Φ6), respectively [3].

3. Results and Discussion

Several studies have reported the occurrence of SARS-CoV-2 RNA in untreated wastewater [2,3,6,7,8]. However, information regarding the persistence of SARS-CoV-2 and fate of its nucleic acid (RNA) in various stages of wastewater treatment processes is limited [25]. Such information is particularly important for assessing the likelihood of SARS-CoV-2 environmental transmission risk (if any) to humans or wildlife. As summarized in Table 3, SARS-CoV-2 RNA was detected in only eight untreated wastewater (influent) samples. Several factors may have contributed to the lower number of positive detections, including sample volume and type, virus concentration method used and the sensitivity of the assay and detection system [26]. Moreover, concentration of SARS-CoV-2 in wastewater may vary depending on several factors, such as number of infected people in the catchment, the type of sewer system, dilution, stormwater intrusion, and sampling types and time [26].
The concentration of SARS-CoV-2 RNA in wastewater is lower than other common enteric viruses such as noroviruses and adenoviruses [1]. COVID-19 patients may also excrete variable numbers of SARS-CoV-2 depending on the severity of diseases [27]. Therefore, wastewater samples require concentration prior to RNA extraction and RT-qPCR analysis. In this study, we used three virus concentration methods as no single method has been identified as a gold standard for the concentration of SARS-CoV-2 from wastewater. Among the concentration methods used, the adsorption-extraction method (Method C) yielded a greater rate of positive detections. Ahmed et al. [20] reported a greater recovery of murine hepatitis virus (MHV) in wastewater using adsorption-extraction method compared to ultrafiltration. The adsorption-elution method (Method B) did not yield any positive detections. Ahmed et al. [28] reported that the viral adsorption-elution method resulted in underestimation of the concentrations of human adenovirus and polyomavirus in environmental waters.
Notably, the average concentration of SARS-CoV-2 in influent wastewater samples by Method A ranged between 3.63 and 4.27 log10 GC/L, which was greater than Method C (2.93–3.39 log10 GC/L). We did not determine the recovery of concentration methods, but we used Φ6 as an RNA extraction process control. The mean recovery efficiencies of Φ6 were 94, 72, and 73% for Methods A, B, and C, respectively, demonstrating minimal viral genome loss during the RNA extraction. However, the whole recovery of the workflow (i.e., concentration and extraction) could be much lower. Of the six WWTPs, WWTP A, located in Virginia, had greater detection rates of SARS-CoV-2 RNA in influent wastewater compared to other WWTP influents. This was attributed to the fact that this WWTP was sampled in April to May 2020, when the clinical cases of COVID-19 increased in Virginia [29].
Of the two primer sets tested in this study, CDC N2 resulted in a greater frequency of detection (8/8) than CDC N1 (6/8). However, the average concentration (3.52 log10 GC/L) of SARS-CoV-2 RNA in influent wastewater samples determined using CDC N1 was slightly greater than CDC N2 assay (3.33 log10 GC/L). In contrast to our study, Barra et al. [30] and Vogels et al. [31] found a higher positive ratio for CDC N1 compared to that of the CDC N2 assay. Therefore, further validation studies would be useful to determine which assay(s) are generally more sensitive. In this study, SARS-CoV-2 RNA could not be detected in secondary- and tertiary-treated effluent samples, suggesting wastewater treatment processes such as MBR followed by activated carbon (WWTP A), Bardenpho (B) and Modified Ludzack Ettinger (MLE) process (WWTP D), as well as UV (WWTPs A, C), ozonation (E-F) disinfection processes in the studied WWTPs effectively degraded or removed SARS-CoV-2 RNA to concentrations below the detection limit. Studies conducted by Randazzo et al. [8] and Haramoto et al. [11] reported the presence of SARS-CoV-2 in secondary-treated wastewater in Spain and Japan, respectively. Interestingly, Haramoto et al. [11] could not detect SARS-CoV-2 RNA in untreated wastewater. This could be due to the fact that a small volume (200 mL) of untreated wastewater was tested in Haramoto’s study compared to secondary treated (5000 mL) wastewater results in reduced detection sensitivity in untreated wastewater.
Study conducted by Kumar et al. [32] found no SARS-CoV-2 in treated effluent samples in India. Other studies have reported the presence of SARS-CoV-2 RNA in treated wastewater effluents [33] and in river water in Ecuador and Italy [10,17]. However, infections with SARS-CoV-2 from treated wastewater appears unlikely based on no virus RNA being detected in samples after treatment. Rimoldi et al. [10] found no infectious SARS-CoV-2 in wastewater and river water samples in Italy using cell culture. A study of SARS-CoV-2 seeded into municipal wastewater and dechlorinated tap water found that SARS-CoV-2 was not highly persistent in aquatic environments compared to other pathogens [34]. Altogether, these observations suggest that the transmission risk of SARS-CoV-2 via treated wastewater is potentially negligible and requires further research on the infectivity of SARS-CoV-2 in wastewater.
The present study has several limitations, and, therefore, the results presented need to be interpreted with care. First, samples were stored at −80 °C for two weeks due to lack of consumables, and this may have impacted our results. A study reported the potential degradation of SARS-CoV-2 RNA in wastewater [15]. However, Ahmed et al. [34] found the average T90 (time required for 1-log10 reduction) of SARS-CoV-2 RNA ranged from 8.04 to 27.8 days in untreated wastewater. Therefore, SARS-CoV-2 RNA can persist long enough in wastewater for accurate detection. Second, samples were collected from the various stages of treatment processes on the same day due to lack of logistics. It would be better to perform sampling on consecutive days based on retention time to determine the treatment efficacy. The volume of wastewater analyzed from secondary and primary effluent samples may have reduced the detection sensitivity. This study provides a snapshot of the prevalence of SARS-CoV-2 over several months. Further studies with a larger number of samples from different types of wastewater treatment plants would generate a robust dataset on the reduction values of SARS-CoV-2 through a range of WWTPs. Such information will enable facilities and researchers to determine the fate and transport of the virus throughout their treatment process and consider operations that may optimize treatment performance to minimizing virus transmission into the environment.

4. Conclusions

  • Wastewater samples from influents of WWTPs in Virginia, Florida (WWTP D) and Georgia tested positive for SARS-CoV-2 RNA.
  • SARS-CoV-2 RNA was detected in 19% (8/42) untreated wastewater influent samples and tested negative for all 24 secondary- and 34 tertiary-treated effluents.
  • The prevalence of SARS-CoV-2 RNA was low in the studied WWTPs in the early pandemic stage.
  • Both ultrafiltration and adsorption-extraction methods were effective for detecting RNA in wastewater samples.

Author Contributions

S.P.S. conceived the project. S.P.S., S.S. (Shalina Shahin), L.M.W., J.P. collected samples and performed Analysis. S.P.S. and S.S. (Shalina Shahin) analyzed the results and S.P.S. wrote the initial draft. S.U., S.S. (Stuart Simpson), S.T., W.A., P.G. and B.W.S. reviewed and edited the manuscript. All the authors checked, reviewed, and approved the final version of the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was partially supported by the Board of Regents grant number LEQSF (2018-21)-rd-a-21 and NIH grant R21AI157434 to Samendra Sherchan.

Institutional Review Board Statement

Not required.

Informed Consent Statement

Not applicable.

Data Availability Statement

Available upon request.

Acknowledgments

The authors would like to thank the anonymous wastewater treatment facilities for their collaboration.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Amoah, I.D.; Kumari, S.; Bux, F. Coronaviruses in wastewater processes: Source, fate and potential risks. Environ. Int. 2020, 143, 105962. [Google Scholar] [CrossRef] [PubMed]
  2. Ahmed, N.; Angel, J.; Edson, K.; Bibby, A.; Bivins, J.W.; O’Brien, B.T. First confirmed detection of SARS-CoV-2 in untreated wastewater in Australia: A proof of concept for the wastewater surveillance of COVID-19 in the community. Sci. Total Environ. 2020, 728, 138764. [Google Scholar] [CrossRef] [PubMed]
  3. Sherchan, S.P.; Shahin, S.; Ward, L.; Tandukar, S.; Aw, T.G.; Schmitz, B.; Ahmed, W.; Kitajima, M. First detection of SARS-CoV-2 RNA in wastewater in North America: A study in Louisiana, USA. Sci. Total Environ. 2020, 743, 140621. [Google Scholar] [CrossRef] [PubMed]
  4. Maal-Bared, R.; Sobsey, M.; Bibby, K.; Sherchan, S.P.; Fitzmorris, K.B.; Munakata, N.; Gerba, C.; Schaefer, S.; Swift, J.; Gary, L.; et al. Pandemic danger to the deep: The risk of marine mammals contracting SARS-CoV-2 from wastewater. Sci. Total Environ. 2021, 773, 144855. [Google Scholar] [CrossRef]
  5. Xiao, F.; Tang, M.; Zheng, X.; Liu, Y.; Li, X.; Shan, H. Evidence for Gastrointestinal Infection of SARS-CoV-2. Gastroenterology 2020, 158, 1831–1833.e3. [Google Scholar] [CrossRef]
  6. La Rosa, G.; Iaconelli, M.; Mancini, P.; Ferraro, G.B.; Veneri, C.; Bonadonna, L.; Lucentini, L.; Suffredini, E. First detection of SARS-CoV-2 in untreated wastewaters in Italy. Sci. Total Environ. 2020, 736, 139652. [Google Scholar] [CrossRef]
  7. Medema, G.; Heijnen, L.; Elsinga, G.; Italiaander, R.; Brouwer, A. Presence of SARS-Coronavirus-2 RNA in sewage and correlation with reported COVID-19 prevalence in the early stage of the epidemic in The Netherlands. Environ. Sci. Technol. Lett. 2020, 7, 511–516. [Google Scholar] [CrossRef]
  8. Randazzo, W.; Truchado, P.; Ferrando, E.C.; Simon, P.; Allende, A.; Sanchez, G. SARS-CoV-2 RNA titers in wastewater anticipated COVID-19 occurrence in a low prevalence area. Water Res. 2020, 181, 115942. [Google Scholar] [CrossRef]
  9. Kumar, M.; Patel, A.K.; Shah, A.V.; Raval, J.; Rajpara, N.; Joshi, M.; Joshi, C.G. First proof of the capability of wastewater surveillance for COVID-19 in India through detection of genetic material of SARS-CoV-2. Sci. Total Environ. 2020, 746, 141326. [Google Scholar] [CrossRef]
  10. Rimoldi, S.G.; Stefani, F.; Gigantiello, A.; Polesello, S.; Comandatore, F.; Mileto, D.; Maresca, M.; Longobardi, C.; Mancon, A.; Romeri, F.; et al. Presence and infectivity of SARS-CoV-2 virus in wastewaters and rivers. Sci. Total Environ. 2020, 744, 140911. [Google Scholar] [CrossRef]
  11. Haramoto, E.; Malla, B.; Thakali, O.; Kitajima, M. First environmental surveillance for the presence of SARS-CoV-2 RNA in wastewater and river water in Japan. Sci. Total Environ. 2020, 737, 140405. [Google Scholar] [CrossRef] [PubMed]
  12. Kitajima, M.; Ahmed, W.; Bibby, K.; Carducci, A.; Gerba, C.P.; Hamilton, K.A.; Haramoto, E.; Rose, J.B. SARS-CoV-2 in wastewater: State of the knowledge and research needs. Sci. Total Environ. 2020, 739, 139076. [Google Scholar] [CrossRef]
  13. Graham, K.E.; Loeb, S.K.; Wolfe, M.K.; Catoe, D.; Sinnott-Armstrong, N.; Kim, S.; Yamahara, K.M.; Sassoubre, L.M.; Grijalva, L.M.M.; Roldan-Hernandez, L.; et al. SARS-CoV-2 RNA in Wastewater Settled Solids Is Associated with COVID-19 Cases in a Large Urban Sewershed. Environ. Sci. Technol. 2021, 55, 488–498. [Google Scholar] [CrossRef]
  14. Peccia, J.; Zulli, A.; Brackney, D.E.; Grubaugh, N.D.; Kaplan, E.H.; Casanovas-Massana, A.; Ko, A.I.; Malik, A.A.; Wang, D.; Wang, M.; et al. Measurement of SARS-CoV-2 RNA in wastewater tracks community infection dynamics. Nat. Biotechnol. 2020, 38, 1164–1167. [Google Scholar] [CrossRef] [PubMed]
  15. Alygizakis, N.; Markou, A.N.; Rousis, N.I.; Galani, A.; Avgeris, M.; Adamopoulos, P.G.; Scorilas, A.; Lianidou, E.S.; Paraskevis, D.; Tsiodras, S.; et al. Analytical methodologies for the detection of SARS-CoV-2 in wastewater: Protocols and future perspectives. TrAC Trends Anal. Chem. 2021, 134, 116125. [Google Scholar] [CrossRef]
  16. Balboa, S.; Mauricio-Iglesias, M.; Rodríguez, S.; Martínez-Lamas, L.; Vasallo, F.J.; Regueiro, B.; Lema, J.M. The fate of SARS-CoV-2 in WWTPs points out the sludge line as a suitable spot for monitoring. medRxiv 2020. [Google Scholar] [CrossRef]
  17. Guerrero-Latorre, L.; Ballesteros, I.; Villacrés-Granda, I.; Granda, M.G.; Freire-Paspuel, B.; Ríos-Touma, B. SARS-CoV-2 in river water: Implications in low sanitation countries. Sci. Total Environ. 2020, 743, 140832. [Google Scholar] [CrossRef]
  18. Lodder, W.; Husman, A.M.D.R. SARS-CoV-2 in wastewater: Potential health risk, but also data source. Lancet Gastroenterol. Hepatol. 2020, 5, 533–534. [Google Scholar] [CrossRef]
  19. Dada, A.C.; Gyawali, P. Quantitative microbial risk assessment (QMRA) of occupational exposure to SARS-CoV-2 in wastewater treatment plants. Sci. Total Environ. 2021, 763, 142989. [Google Scholar] [CrossRef] [PubMed]
  20. Ahmed, W.; Bertsch, P.M.; Bivins, A.; Bibby, K.; Farkas, K.; Gathercole, A.; Haramoto, E.; Gyawali, P.; Korajkic, A.; McMinn, B.R.; et al. Comparison of virus concentration methods for the RT-qPCR based recovery of murine hepatitis virus, a surrogate for SARS-CoV-2 from untreated wastewater. Sci. Total Environ. 2020, 739, 139960. [Google Scholar] [CrossRef]
  21. Tandukar, S.; Sherchan, S.P.; Haramoto, E. Applicability of crAssphage, pepper mild mottle virus, and tobacco mosaic virus as indicators of reduction of enteric viruses during wastewater treatment. Sci. Rep. 2020, 10, 3616. [Google Scholar] [CrossRef] [Green Version]
  22. Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. CDC. 2019-Novel Coronavirus (2019-nCoV) Real-Time RT-PCR Primer and Probe Information. 2020. Available online: https://www.cdc.gov/coronavirus/2019-ncov/lab/rt-pcr-panel-primer-probes.html (accessed on 5 May 2020).
  24. Gendron, L.; Verreault, D.; Veillette, M.; Moineau, S.; Duchaine, C. Evaluation of Filters for the Sampling and Quantification of RNA Phage Aerosols. Aerosol Sci. Technol. 2010, 44, 893–901. [Google Scholar] [CrossRef]
  25. Saawarn, B.; Hait, S. Occurrence, fate and removal of SARS-CoV-2 in wastewater: Current knowledge and future perspectives. J. Environ. Chem. Eng. 2021, 9, 104870. [Google Scholar] [CrossRef]
  26. Ahmed, A.; Bivins, P.M.; Bertsch, K.; Bibby, P.M.; Choi, K.; Farkas, P.; Gyawali, K.A.; Hamilton, E.; Haramoto, M.; Kitajima, S.L.; et al. Surveillance of SARS-CoV-2 RNA in wastewater: Methods optimisation and quality control are crucial for generating reliable public health information. Curr. Opin. Environ. Sci. Health 2020, 17, 82–93. [Google Scholar] [CrossRef]
  27. Zheng, S.; Fan, J.; Yu, F.; Feng, B.; Lou, B.; Zou, Q.; Xie, G.; Lin, S.; Wang, R.; Yang, X.; et al. Viral load dynamics and disease severity in patients infected with SARS-CoV-2 in Zhejiang province, China, January-March 2020: Retrospective cohort study. BMJ 2020, 369, m1443. [Google Scholar] [CrossRef] [Green Version]
  28. Ahmed, W.; Harwood, V.J.; Gyawali, P.; Sidhu, J.P.S.; Toze, S. Comparison of Concentration Methods for Quantitative Detection of Sewage-Associated Viral Markers in Environmental Waters. Appl. Environ. Microbiol. 2015, 81, 2042–2049. [Google Scholar] [CrossRef] [Green Version]
  29. Gonzalez, R.; Curtis, K.; Bivins, A.; Bibby, K.; Weir, M.H.; Yetka, K.; Thompson, H.; Keeling, D.; Mitchell, J.; Gonzalez, D. COVID-19 surveillance in Southeastern Virginia using wastewater-based epidemiology. Water Res. 2020, 186, 116296. [Google Scholar] [CrossRef] [PubMed]
  30. Barra, G.B.; Santa Rita, T.H.; Mesquita, P.G.; Jacomo, R.H.; Nery, L.F.A. Analytical sensibility and specificity of two RT-qPCR protocols for SARS-CoV-2 detection performed in an automated workflow. Infectious Diseases (except HIV/AIDS). Genes 2020, 11, 1183. [Google Scholar] [CrossRef]
  31. Vogels, C.B.F.; Brito, A.F.; Wyllie, A.L.; Fauver, J.R.; Ott, I.M.; Kalinich, C.C.; Petrone, M.E.; Casanovas-Massana, A.; Muenker, M.C.; Moore, A.J.; et al. Analytical sensitivity and efficiency comparisons of SARS-CoV-2 RT–qPCR primer–probe sets. Nat. Microbiol. 2020, 5, 1299–1305. [Google Scholar] [CrossRef]
  32. Kumar, M.; Kuroda, K.; Patel, A.K.; Patel, N.; Bhattacharya, P.; Joshi, M.; Joshi, C.G. Decay of SARS-CoV-2 RNA along the wastewater treatment outfitted with Upflow Anaerobic Sludge Blanket (UASB) system evaluated through two sample concentration techniques. Sci. Total Environ. 2021, 754, 142329. [Google Scholar] [CrossRef] [PubMed]
  33. Westhaus, S.; Weber, F.-A.; Schiwy, S.; Linnemann, V.; Brinkmann, M.; Widera, M.; Greve, C.; Janke, A.; Hollert, H.; Wintgens, T.; et al. Detection of SARS-CoV-2 in raw and treated wastewater in Germany—Suitability for COVID-19 surveillance and potential transmission risks. Sci. Total Environ. 2021, 751, 141750. [Google Scholar] [CrossRef] [PubMed]
  34. Ahmed, W.; Bertsch, P.M.; Bibby, K.; Haramoto, E.; Hewitt, J.; Huygens, F.; Gyawali, P.; Korajkic, A.; Riddell, S.; Sherchan, S.P.; et al. Decay of SARS-CoV-2 and surrogate murine hepatitis virus RNA in untreated wastewater to inform application in wastewater-based epidemiology. Environ. Res. 2020, 191, 110092. [Google Scholar] [CrossRef] [PubMed]
Table
Table 1. Data on WWTPs in the Studied Areas.
Table 1. Data on WWTPs in the Studied Areas.
WWTPsLocation aPopulation Served bTreatment Train
AVA300,000preliminary screening, grit removal, primary clarification, fine screening, flow equalization, membrane bioreactors (MBR), activated carbon, and UV disinfection.
B/CFL974,996WWTP B uses an advanced Bardenpho process while WWTP C uses UV disinfection
DFL471,826a Modified Ludzack Ettinger (MLE) process configuration with two biological treatment trains.
E/FGA936,250WWTP E uses advanced membrane bioreactor (MBR) wastewater treatment, WWTP F uses biological activated carbon (BAC) and ozonation
a VA: Virginia, FL: Florida, GA: Georgia b provided by each respective water utility.
Table
Table 2. Oligonucleotide sequences of primers and probes used in this study.
Table 2. Oligonucleotide sequences of primers and probes used in this study.
AssayTarget GenePrimer/ProbeSequence (5′ > 3′) aPCR ConditionsReference
N1Nucleocapsid (N)2019-nCoV_N1-FGAC CCC AAA ATC AGC GAA AT95 °C for 10 min and 45 cycles of 95 °C for 10 s and 55 °C for 30 s[23]
2019-nCoV_N1-RTCT GGT TAC TGC CAG TTG AAT CTG
2019-nCoV_N1-PFAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1
N2Nucleocapsid (N)2019-nCoV_N2-FTTA CAA ACA TTG GCC GCA AA95 °C for 10 min and 45 cycles of 95 °C for 10 s and 55 °C for 30 s[23]
2019-nCoV_N2-RGCG CGA CAT TCC GAA GAA
phi6phi-6S 12019-nCoV_N2-P
phi6- F
phi6- R
phi6- P		FAM-ACAATTTGCCCCCAGCGCTTCAG-BHQ1
TGGCGGCGGTCAAGAGC
GGATGATTCTCCAGAAGCTGCTG
FAM/CGGTC GTCG/ZEN/CAGGTCTGACACTCGC/3IABkFQ/		94 °C for 3 min followed by 35 cycles of 94 °C for 15 s and 60 °C for 1 min[24]
a FAM, 6-carboxyfluorescein; BHQ1, black hole quencher 1.
Table
Table 3. Prevalence of SARS-CoV-2 RNA in wastewater.
Table 3. Prevalence of SARS-CoV-2 RNA in wastewater.
StatesWWTPsSampleNo of Samples TestedNo. of Positive (%)GC/L
N1N2N1N2
VirginiaAInfluent10(1/3) a
(2/10) b		(1/3) a
(2/10) b		4.3 × 103 a
3.36 × 103 b
3.43 ×103 b		4.4 × 103 a
1.70 × 103 b
3.30 × 102 b
Effluent12(0/3) a
(0/12) b		(0/3) a
(0/12) b
FloridaBInfluent6(0/2) a
(0/6) b		(0/2) a
(0/6) b
Secondary Effluent4(0/2) a
(0/4) b		(0/2) a
(0/4) b
Effluent4(0/1) a
(0/4) b		(0/1) a
(0/4) b
CInfluent6(0/2) a
(0/6) b		(0/2) a
(0/6) b
Secondary Effluent4(0/2) a
(0/4) b		(0/2) a
(0/4) b
Effluent4(0/2) a
(0/4) b		(0/2) a
(0/4) b
DInfluent10(1/10) b(2/10) b8.70 × 102 b8.0 × 102 b
9.3 × 102 b
Secondary Effluent6(0/6) b(0/6) b
Effluent4(0/6) b(0/6) b
GeorgiaEInfluent6(1/2) a
(1/6) b		(1/2) a
(1/6) b		1.0 × 104 a
1.5 ×103 b		7.8 × 103 a
1.70 × 103 b
Secondary Effluent6(0/1) a
(0/6) b		(0/1) a
(0/6) b
Effluent6(0/1) a
(0/6) b		(0/1) a
(0/6) b
FInfluent4(1/2) a
(0/4) b		(1/2) a
(0/4) b		6.5 × 103 b1.9 × 104 b
Secondary Effluent4(0/2) a
(0/4) b		(0/2) a
(0/4) b
Effluent4(0/2) a
(0/4) b		(0/2) a
(0/4) b
a Ultrafiltration method, b Adsorption-extraction.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Sherchan, S.P.; Shahin, S.; Patel, J.; Ward, L.M.; Tandukar, S.; Uprety, S.; Schmitz, B.W.; Ahmed, W.; Simpson, S.; Gyawali, P. Occurrence of SARS-CoV-2 RNA in Six Municipal Wastewater Treatment Plants at the Early Stage of COVID-19 Pandemic in The United States. Pathogens 2021, 10, 798. https://doi.org/10.3390/pathogens10070798

AMA Style

Sherchan SP, Shahin S, Patel J, Ward LM, Tandukar S, Uprety S, Schmitz BW, Ahmed W, Simpson S, Gyawali P. Occurrence of SARS-CoV-2 RNA in Six Municipal Wastewater Treatment Plants at the Early Stage of COVID-19 Pandemic in The United States. Pathogens. 2021; 10(7):798. https://doi.org/10.3390/pathogens10070798

Chicago/Turabian Style

Sherchan, Samendra P., Shalina Shahin, Jeenal Patel, Lauren M. Ward, Sarmila Tandukar, Sital Uprety, Bradley W. Schmitz, Warish Ahmed, Stuart Simpson, and Pradip Gyawali. 2021. "Occurrence of SARS-CoV-2 RNA in Six Municipal Wastewater Treatment Plants at the Early Stage of COVID-19 Pandemic in The United States" Pathogens 10, no. 7: 798. https://doi.org/10.3390/pathogens10070798

APA Style

Sherchan, S. P., Shahin, S., Patel, J., Ward, L. M., Tandukar, S., Uprety, S., Schmitz, B. W., Ahmed, W., Simpson, S., & Gyawali, P. (2021). Occurrence of SARS-CoV-2 RNA in Six Municipal Wastewater Treatment Plants at the Early Stage of COVID-19 Pandemic in The United States. Pathogens, 10(7), 798. https://doi.org/10.3390/pathogens10070798

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop