Next Article in Journal
Specific Mycobacterium tuberculosis Strain Circulating in Prison Revealed by Cost-Effective Amplicon Sequencing
Next Article in Special Issue
Adaptive Evolution for the Efficient Production of High-Quality d-Lactic Acid Using Engineered Klebsiella pneumoniae
Previous Article in Journal
Study of the Impact of the Parasitic Microalgae Coccomyxa parasitica on the Health of Bivalve Modiolus kurilensis
Previous Article in Special Issue
Differential Selection for Translation Efficiency Shapes Translation Machineries in Bacterial Species
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microorganisms
Volume 12
Issue 5
10.3390/microorganisms12050998
microorganisms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Improving Surfactin Production in Bacillus subtilis 168 by Metabolic Engineering

by
Zihao Guo
,
Jiuyu Sun
,
Qinyuan Ma
,
Mengqi Li
,
Yamin Dou
,
Shaomei Yang
* and
Xiuzhen Gao
*
School of Life Sciences and Medicine, Shandong University of Technology, 266 Xincun West Road, Zibo 255049, China
*
Authors to whom correspondence should be addressed.
Microorganisms 2024, 12(5), 998; https://doi.org/10.3390/microorganisms12050998
Submission received: 21 April 2024 / Revised: 13 May 2024 / Accepted: 13 May 2024 / Published: 15 May 2024
(This article belongs to the Special Issue Bacterial Engineering and Metabolism Regulation)
Browse Figures
Versions Notes

Abstract

:
Surfactin is widely used in the petroleum extraction, cosmetics, biopharmaceuticals and agriculture industries. It possesses antibacterial and antiviral activities and can reduce interfacial tension. Bacillus are commonly used as production chassis, but wild-type Bacillus subtilis 168 cannot synthesise surfactin. In this study, the phosphopantetheinyl transferase (PPTase) gene sfp* (with a T base removed) was overexpressed and enzyme activity was restored, enabling B. subtilis 168 to synthesise surfactin with a yield of 747.5 ± 6.5 mg/L. Knocking out ppsD and yvkC did not enhance surfactin synthesis. Overexpression of predicted surfactin transporter gene yfiS increased its titre to 1060.7 ± 89.4 mg/L, while overexpression of yerP, ycxA and ycxA-efp had little or negative effects on surfactin synthesis, suggesting YfiS is involved in surfactin efflux. By replacing the native promoter of the srfA operon encoding surfactin synthase with three promoters, surfactin synthesis was significantly reduced. However, knockout of the global transcriptional regulator gene codY enhanced the surfactin titre to 1601.8 ± 91.9 mg/L. The highest surfactin titre reached 3.89 ± 0.07 g/L, with the yield of 0.63 ± 0.02 g/g DCW, after 36 h of fed-batch fermentation in 5 L fermenter. This study provides a reference for further understanding surfactin synthesis and constructing microbial cell factories.

1. Introduction

Surfactin is a lipopeptide biosurfactant with a cyclic structure composed of seven amino acid residues (both L- and D-amino acids) connected to a long β-hydroxyl fatty acid chain (usually C13−C15) by a lactone bond, making it an amphiphilic molecule [1,2,3]. Due to its strong ability to reduce interfacial tension between oil and water, surfactin is used to reduce the emulsification and viscosity of crude oil for enhanced oil recovery in the petroleum extraction industry [4,5,6]. Moreover, it can be effectively applied in cosmetics in the form of solvents, soaps and facial cleansers due to its emulsification, washing, foaming, solubilisation, wetting, penetration, dispersion and low toxicity characteristics [7,8]. The long-chain fatty acid of surfactin can penetrate into the interior of cell membranes, causing dissolution and damage, which is the basis for its antibacterial activity [9,10]. Surfactin can also break down viral lipid membranes, and it has antiviral properties [11]. Therefore, it can be applied as a biological preservative to effectively control the growth of harmful microorganisms in food [12], and it may prevent fungal infections and skin diseases [13]. In addition, it has broad application prospects in the agricultural field [14], such as controlling apple scab [15].
Currently, the main production methods for surfactin include chemical synthesis and microbial fermentation, with the latter favoured due to superior environmental friendliness and biocompatibility. However, low productivity of surfactin remains an important limiting factor in its industrial production [16,17]. For instance, combinatorial metabolic engineering of Bacillus subtilis ATCC 21332, including enhanced nitrate reduction, fatty acid hydroxylation, rational transporter engineering and feeding, yielded 14.4 g/L of surfactin, with the productivity of 0.6 g/L/h, the highest reported productivity to date [18]. Therefore, the development of microbial cell factories is crucial for its overproduction. Surfactin was first discovered in the fermentation broth of B. subtilis in 1968, with four isomers identified [19]. Moreover, B. subtilis, a model Gram-positive bacterium, grows fast and is easy to cultivate. It has excellent expression systems with good genetic stability, excellent protein secretion ability, no strong codon preferences and mature gene modification technologies. It has been recognised by the USA Food and Drug Administration (FDA) as a ‘Generally Recognised as Safe’ (GRAS) strain [20]. Therefore, B. subtilis is commonly used as a chassis for producing surfactin through metabolic engineering [18,21,22].
In B. subtilis, the biosynthesis of surfactin mainly involves the synthesis and structural assembly of precursors (fatty acids and amino acids). B. subtilis synthesises the corresponding precursors through primary metabolism, such as glycolysis, the tricarboxylic acid cycle, protein metabolism, lipid metabolism and other pathways (Figure 1). The assembly of surfactin is then catalysed by a non-ribosomal peptide synthase (NRPS) system, which includes initiation, peptide chain extension, cyclisation and release [23,24]. The NRPS, also known as surfactin synthase, is a multi-domain protein composed of multiple modules, including the SrfAA, SrfAB, SrfAC and SrfAD subunits. They are encoded by srfAA, srfAB, srfAC and srfAD, respectively, together forming the 27 kb srfA operon [24]. Transcription of the srfA operon is regulated by the quorum sensing system ComQXPA, and phosphorylated ComA binds to a specific region of its promoter, activating its transcription [25,26,27]. In addition, downstream of the srfA operon, there is a phosphopantetheinyl transferase (PPTase) gene sfp that is essential for surfactin synthesis, which functions to activate surfactin synthase [28]. However, sfp is an inactive pseudogene in wild-type B. subtilis 168, which cannot synthesise surfactin. Wu et al., (2019) integrated the sfp gene from Bacillus amyloliquefaciens MT45 into the genome of B. subtilis 168 at the same locus, resulting in a surfactin titre of 400 mg/L [21]. Subsequently, biofilm formation-related genes were knocked out, potential self-resistance associated proteins were overexpressed, the branched-chain fatty acid biosynthesis pathway was engineered, comQXPA from B. amyloliquefaciens MT45 was overexpressed and the global transcriptional regulator gene codY was knocked out, resulting in a surfactin titre of 12.8 g/L [21]. Wang et al., (2019) integrated sfp from B. amyloliquefaciens DSM7 into the ydeO (encoding an unknown protein) locus of the genome of B. subtilis 168, resulting in a surfactin titre of 450 mg/L [29]. The clustered regularly interspersed short palindromic repeat interference (CRISPRi) technology was used to inhibit the expression of L-glutamate racemase genes yrpC and racE, resulting in a surfactin titre of 750 mg/L [29]. Hu et al., (2020) integrated sfp from Bacillus velezensis BS-37 into the genome of B. subtilis 168 at the same locus, resulting in a surfactin titre of 982 ± 98 mg/L [30]. Medium-chain acyl-acyl carrier protein (ACP) thioesterase (encoded by bte) and fatty acyl CoA ligase (encoded by yhfL) were overexpressed, and acyl-CoA dehydrogenase gene fadE was knocked out, resulting in a surfactin titre of 2203 mg/L, with xylose as the carbon source [30]. However, there have been no studies on the overexpression of endogenous active sfp in B. subtilis 168. In addition, the efflux of surfactin is an important factor limiting its synthesis. Overexpression of three putative lipopeptide transporters genes: yerP (endogenous), ycxA and krsE (heterologous) in B. subtilis THY-7 resulted in a 145%, 89% and 52% increase in surfactin production, respectively [31], and overexpression of endogenous yerP in B. subtilis 168 resulted in a 35.3% increase in surfactin production [21], demonstrating that YerP acts as the major surfactin exporter. Research by Xia et al., (2024) showed that preprotein translocase SecA, signal recognition particle receptor FtsY and cell division ATP-binding protein FtsE are also involved in the transport of surfactin in B. subtilis ATCC 21332 [18].
The present study used B. subtilis 168 as the parent strain. To facilitate gene knockout or integrated expression [32], strain BS168N integrated with Para-neo on the genome was employed. Firstly, the excess T base of endogenous sfp was removed, and the modified gene was integrated into the genome of BS168N for overexpression. The resulting recombinant strain was fermented and surfactin synthesis assessed. Next, plipastatin synthase gene ppsD and phosphotransferase gene yvkC were knocked out to reduce the consumption of amino acids, hydroxy fatty acids and ATP, and their effects on surfactin synthesis were investigated. Thirdly, endogenous yerP, ycxA and predicted surfactin transporter gene yfiS were integrated into the same locus of the genome for overexpression, and their effects on surfactin secretion were evaluated. Fourthly, the native promoter of the srfA operon was replaced in situ by constitutive promoters, and codY was knocked out, so their impacts on the transcriptional level of the srfA operon and surfactin synthesis were explored. Finally, the final recombinant strain was subjected to fed-batch fermentation, and strain growth and surfactin production were measured.

2. Materials and Methods

2.1. Microorganisms, Media and Culture Conditions

Bacillus subtilis 168 (BS168) and BS168N were provided by Tianjin University. All recombinant B. subtilis strains were constructed based on BS168N. The strains and plasmids used in this study are listed in Table 1. Luria–Bertani (LB) medium (10 g/L tryptone, 5 g/L yeast extract and 10 g/L NaCl) was used for strain cultivation. After adding the fragments to the competent cells, they were coated on LBC8 solid plates (added with 15 g/L of agar and 8 μg/mL of chloramphenicol to LB liquid medium) for preliminary screening of the transformants. After culturing the transformants in LB liquid medium for 4 h, they were coated on LBN16 solid plates (added with 15 g/L of agar and 16 μg/mL of neomycin to LB liquid medium) for secondary screening of the recombinant bacteria. A medium (50 mL, containing 25 g/L glucose, 10 g/L tryptone, 3 g/L beef extract, 1 g/L KH2PO4, 1 g/L K2HPO4, 1 g/L NaCl, 0.5 g/L (NH4)2SO4, 0.2 g/L L-leucine, 0.05 g/L sodium glutamate, 0.05 g/L MgSO4·7H2O, 0.05 g/L MnSO4·H2O and 7.5 mg/L FeSO4·7H2O, pH 7.0) was used for the fermentation experiments. Each B. subtilis strain was transferred into a 250 mL flask with 30 mL LB liquid medium and incubated at 37 °C with shaking at 200 rpm for 12 h as the seed culture. Next, 2.5 mL of seed culture was inoculated into 250 mL flasks containing 50 mL fermentation medium and incubated at 37 °C with shaking at 220 rpm for 48 h.

2.2. Construction of B. subtilis Knockout Mutants

For the knockout of yrpC, the 5039 bp UDCRG fragment was amplified from the genome of BSD1-ΔyrpCm [33] using primer pair yrpC-U1/yrpC-G2 (Table 2). U refers to the upstream homologous arm, G refers to the downstream homologous arm, D refers to the homologous recombinant fragment, C refers to the fragment containing the chloramphenicol resistance gene cat and R refers to the fragment containing gene araR encoding the transcriptional repressor of the arabinose operon [32]. AraR could inhibit the transcription of Para-neo, resulting in the strain not exhibiting neomycin resistance but exhibiting chloramphenicol resistance [32]. This UDCRG fragment was used to transform competent cells of BS168N as previously described [35], and the cells were cultured on chloramphenicol resistance plates. The yrpC knockout strain BSSF1 was obtained by a two-step screening process as previously described [32].
For the knockout of ppsD, 1101 bp U, 1089 bp D and 919 bp G fragments were amplified from the genome of BS168 using primer pairs ppsD-U1/ppsD-U2, ppsD-D1q/ppsD-D2 and ppsD-G1q/ppsD-G2, respectively. A 2136 bp cat-araR (CR) fragment was amplified from BSD1-ΔyrpCm using primer pair ppsD-CR1q/ppsD-CR2. These four fragments were spliced in the order of U-D-CR-G by two rounds of overlap extension PCR (OE-PCR) using primer pairs ppsD-U1/ppsD-D2 and ppsD-U1/ppsD-G2, respectively. Finally, this UDCRG fragment was used to transform competent cells of BSSF2. The resulting ppsD knockout strain BSSF3 was obtained by a two-step screening process.
For the knockout of yvkC, the 5259 bp UDCRG fragment was amplified from the genome of BSD1-ΔyvkCm [33] using primer pair yvkC-U1/yvkC-G2. This UDCRG fragment was used to transform competent cells of BSSF3. The resulting yrpC knockout strain BSSF4 was obtained by a two-step screening process.
For the knockout of codY, the 1116 bp U, 1092 bp D and 605 bp G fragments were amplified from the genome of BS168 using primer pairs codY-U1/codY-U2, codY-D1q/codY-D2 and codY-G1q/codY-G2, respectively. A 2189 bp CR fragment was amplified from BSD1-ΔyrpCm using primer pair codY-CR1q/codY-CR2. These four fragments were spliced in the order of U-D-CR-G by two rounds of OE-PCR. Finally, this UDCRG fragment was used to transform competent cells of BSSF52. The resulting codY knockout strain BSSF64 was obtained by a two-step screening process.

2.3. Construction of B. subtilis Overexpression Mutants

For overexpression of sfp*, 1062 bp U and 507 bp S1 fragments containing the partial nucleotide sequence of sfp, and the 204 bp S2 fragment containing the residual nucleotide sequence of sfp, were amplified from the genome of B. subtilis 168 using primer pairs yrpC-U1/yrpC-U2q, sfp1-1q/sfp1-2 and sfp2-1/sfp2-2, respectively. A 183 bp P fragment containing the constitutive promoter TP2 expression cassette [36] was amplified from plasmid pUC57-simple-VHb [34] using primer pair TP2-1/TP2-2. A 3978 bp DCRG fragment was amplified from BSD1-ΔyrpCm using primer pair yrpC-D1q/yrpC-G2. Fragments P, S1 and S2 were then spliced in the order of P-S1-S2 using primer pair TP2-1/sfp2-2, and fragments U, PS1S2 and DCRG were spliced in the order of U-PS1S2-DCRG using primer pair yrpC-U1/yrpC-G2. Finally, this fragment was used to transform competent cells of BS168N. The resulting strain BSSF2 overexpressing sfp* was obtained by a two-step screening process.
For overexpression of yerP, a 1399 bp fragment of UP containing the upstream homologous arm U and the constitutive P43 promoter [37], and a 3270 bp fragment of yerP containing the complete nucleotide sequence and terminator sequence of yerP, were amplified from the genome of BSΔ6-AD1m [33] using primer pairs yvkC-U1/yvkC-P2 and yerP-1q/yerP-2, respectively. A 3999 bp DCRG fragment was amplified from BSD1-ΔyvkCm using primer pair yvkC-yerP-D1q/yvkC-yerP-G2. These three fragments were spliced in the order of UP-yerP-DCRG using primer pair yvkC-U1/yvkC-yerP-G2. Finally, this fragment was used to transform competent cells of BSSF3. The resulting strain BSSF51 overexpressing yerP was obtained by a two-step screening process.
For overexpression of yfiS, a 1399 bp fragment of UP, a 1332 bp fragment of yfiS containing the complete nucleotide sequence of yfiS and a 3954 bp fragment of DCRG were amplified from the genome of BSSF51m using primer pairs yvkC-U1/yvkC-P2, yfiS-1q/yfiS-2 and yvkC-yfiS-D1q/yvkC-yfiS-G2, respectively. These three fragments were spliced in the order of UP-yfiS-DCRG using primer pair yvkC-U1/yvkC-yfiS-G2. Finally, this fragment was used to transform competent cells of BSSF3. The resulting strain BSSF52 overexpressing yfiS was obtained by a two-step screening process.
For overexpression of ycxA, a 1399 bp fragment of UP, a 1489 bp fragment of ycxA containing the complete nucleotide sequence and terminator sequence of ycxA and a 3847 bp fragment of DCRG were amplified from the genome of BSSF51m using primer pairs yvkC-U1/yvkC-P2, ycxA-1q/ycxA-2 and yvkC-ycxA-D1q/yvkC-yfiS-G2, respectively. These three fragments were spliced in the order of UP-ycxA-DCRG using primer pair yvkC-U1/yvkC-yfiS-G2. Finally, this fragment was used to transform competent cells of BSSF3. The resulting strain BSSF53 overexpressing ycxA was obtained by a two-step screening process.
For overexpression of ycxA-efp, a 2631 bp fragment of UPA containing the upstream homologous arm U, the P43 promoter the complete nucleotide sequence of ycxA, a 689 bp fragment of efp containing the nucleotide sequence and terminator sequence and a 3872 bp fragment of DCRG were amplified from the genome of BSSF53m using primer pairs yvkC-U1/2-ycxA-2, efp-1q/efp-2 and yvkC-efp-D1q/yvkC-yfiS-G2, respectively. These three fragments were spliced in the order of UPA-efp-DCRG using primer pair yvkC-U1/yvkC-yfiS-G2. Finally, this fragment was used to transform competent cells of BSSF3. The resulting strain BSSF54 overexpressing ycxA-efp was obtained by a two-step screening process.

2.4. In Situ Substitution of the Native Promoter of the srfA Operon

The native promoter of the srfA operon was replaced in situ by the PHpaII promoter. First, 1346 bp U, 850 bp C and 820 bp D fragments were amplified from the genome of BSD1-ΔyrpCm using primer pairs srf-U1/srf-2, srf-C1q/srf-C2 and srf-D1q/srf-D2, respectively. A 274 bp P1 fragment containing the constitutive PHpaII promoter was amplified from plasmid pMA5 using primer pair srf-P1-1q/srf-P1-2. These four fragments were spliced in the order of U-C-P1-D using primer pair srf-U1/srf-D2. Finally, this fragment was used to transform competent cells of BSSF52. The resulting strain BSSF61 was obtained by a one-step screening process.
The native promoter of the srfA operon was replaced in situ by the P43 promoter. First, 2196 bp UC and 820 bp D fragments were amplified from the genome of BSSF61 using primer pairs srf-U1/2-srf-C2 and 2-srf-D1q/srf-D2, respectively. A 267 bp P2 fragment containing the P43 promoter was amplified from the genome of BSΔ6-AD1m using primer pair srf-P2-1q/srf-P2-2. These three fragments were spliced in the order of UC-P2-D using primer pair srf-U1/srf-D2. Finally, this fragment was used to transform competent cells of BSSF52. The resulting strain BSSF62 was obtained by a one-step screening process.
The native promoter of the srfA operon was replaced in situ by the PSB expression cassette. First, 2196 bp UC and 820 bp D fragments were amplified from the genome of BSSF61 using primer pairs srf-U1/2-srf-C2 and 3-srf-D1q/srf-D2, respectively. A 128 bp P3 fragment containing the constitutive promoter PSB expression cassette [38] was amplified from plasmid pUC57-simple-PyrGE156K [33] using primer pair srf-P3-1q/srf-P3-2. These three fragments were spliced in the order of UC-P3-D using primer pair srf-U1/srf-D2. Finally, this fragment was used to transform competent cells of BSSF52. The resulting strain BSSF63 was obtained by a one-step screening process.

2.5. Extraction and Detection of Surfactin

The surfactin standard was purchased from Sigma-Aldrich (St. Louis, MO, USA). A 20 mL volume of fermentation broth was centrifuged at 8000 rpm for 10 min, and the pH of the supernatant was adjusted to 2.0 with HCl. After incubating overnight at 4 °C, centrifuging at 8000 rpm for 10 min and discarding the supernatant, the precipitate was dried at room temperature, 5 mL of methanol was added to dissolve the precipitate and the sample was filtered through a 0.22 μm organic filter. The concentration of surfactin was measured using an LC-2030 reversed-phase high-performance liquid chromatography (HPLC) system (Shimadzu, Kyoto, Japan) equipped with a ZORBAX SB-C18 column (250 mm × 4.6 mm, 5 μm; Agilent, Santa Clara, CA, USA) and a UV detector (Shimadzu) at 205 nm. The column temperature was set to 30 °C. The mobile phase consisted of methanol/water/trifluoroacetic acid solution (90:10:0.1, v/v/v) and the flow rate was 1.0 mL/min.

2.6. Quantitative Real-Time PCR (qRT-PCR)

A 1 mL volume of fermentation broth was collected after 24 h of fermentation, and the total RNA was extracted using a Bacterial Total RNA Rapid Extraction Kit (HLingene, Shanghai, China). Reverse-transcription was performed using a NG Script I cDNA Synthesis Kit (HLingene) to obtain the cDNA libraries. qRT-PCR was carried out using a LightCycler 480 instrument (Roche, Mannheim, Germany) using the 2× SYBR Green qPCR Mixture (HLingene). The relative transcriptional levels were calculated according to Pfaffl [39], with the carbon catabolite control protein A gene ccpA serving as an internal control.

2.7. Fed-Batch Fermentation

Fed-batch fermentation was conducted in a 5 L fermenter at the National Center of Bio-Engineering & Technology (Shanghai, China). A single colony of strain BSFF64 was inoculated into 5 mL LB medium and cultured at 37 °C, with shaking at 200 rpm overnight. The preculture was transferred into 100 mL fresh fermentation medium and cultured at 37 °C and 220 rpm for 12 h. Next, 100 mL seed culture was transferred to 1.9 L fermentation medium in a 5 L bioreactor, and fermentation was carried out at 37 °C with the pH maintained at 7.0 using NaOH (1 mol/L) and HCl (1 mol/L). The airflow was set at 2 vvm, with agitation at 300−500 rpm. The feed solution containing 240 g/L glucose, 30 g/L tryptone, 25 g/L beef extract, 5 g/L L-leucine and 75 mg/L FeSO4·7H2O was added automatically to maintain the dissolved oxygen (DO) at 40−50%. Duplicate samples were collected to determine the cell density and surfactin titre.

2.8. Statistical Analysis

Analysis of the response variables was performed using SPSS statistics 17.0 [40]. One-way analysis of variance (ANOVA) and Tukey’s test based on p < 0.05 were performed to determine the significance of the differences in response variables between strains.

3. Results and Discussion

3.1. Overexpression of Active PPTase to Endow B. subtilis 168 with the Ability to Synthesise Surfactin

PPTase encoded by sfp is responsible for connecting the long arm of coenzyme A (CoA), 4′-phosphopantothenamine, to the conserved serine residue in the peptidyl carrier protein (PCP), which converts PCP from an inactive apo-form to active holo-form, thereby initiating surfactin synthesis [41]. Due to the presence of an additional T496 base in the nucleotide sequence of sfp in B. subtilis 168, its transcription is terminated prematurely (Figure S1). Therefore, sfp is an inactive pseudogene in B. subtilis 168. Indeed, no surfactin was detected in the supernatant of its fermentation broth (Figure 2A and Figure S2A). To make the PPTase active, we designed primers to amplify the preceding and following nucleotide sequences of the sfp gene, removing the T496 base in the process. These two nucleotide sequences were spliced together through overlapping PCR, then spliced with the strong TP2 promoter [36] to integrate into the yrpC locus of the genome of strain BS168N, yielding recombinant strain BSSF2 (Table 1). In addition, we constructed yrpC gene knockout strain BSSF1 as a control for BSSF2. In B. subtilis, yrpC encodes glutamate racemase, which catalyses the racemisation of L-glutamate to produce D-glutamate [42]. L-glutamate is one of the precursors for synthesising surfactin, so the knockout of yrpC should reduce the consumption of L-glutamate. Moreover, Wang et al. [29] inhibited the expression of yrpC using CRISPRi technology, which indeed promoted surfactin synthesis.
After 48 h of fermentation, strain BSSF2 produced 747.5 ± 6.5 mg/L of surfactin (Figure 2A and Figure S2B). There were four components of the surfactin standards, corresponding to peaks 1, 2, 3 and 4 (Figure S2C,D). The differences between them were the amino acid residues at positions 2, 4 and 7 of the circular peptide (leucine, isoleucine or valine) and the length of the carbon chain (C13 to C15) [31]. The relative transcriptional level of sfp in BSSF2 was increased 17.8-fold relative to BSSF1 (Figure 2B). Compared to previous studies [21,29,30], overexpression of PPTase led to different levels of surfactin production, possibly due to the varying activities or expression levels of PPTases from different sources. The amino acid sequences of PPTase from B. amyloliquefaciens MT45 (GenBank: ASF27580.1), B. amyloliquefaciens DSM7 (GenBank: CBI41443.1), B. velezensis BS-37 (GenBank: AWG39808.1) and the active PPTase from B. subtilis 168 are not completely identical, as shown in the alignment (Figure S3). The above results indicated that PPTase was the key enzyme for B. subtilis to synthesise surfactin, and the recovery of endogenous PPTase activity endowed B. subtilis 168 with the ability to produce surfactin.

3.2. Effects of Plipastatin Synthetase and Phosphotransferase Deficiency on Surfactin Synthesis

In B. subtilis, the ppsABCDE operon encodes plipastatin synthase that catalyses the synthesis of plipastatin from ten amino acids, including L-glutamate, D-alanine and L-tyrosine, along with hydroxyl fatty acids [43]. To increase the flow of amino acids and hydroxyl fatty acids towards surfactin synthesis, the ppsD gene in the ppsABCDE operon was knocked out, resulting in knockout strain BSSF3. The fermentation results showed that there was almost no change in surfactin production (Figure 3). Coutte et al. [44] inserted the spectacomycin resistance gene spc into ppsA to disrupt plipastatin synthesis in B. subtilis, resulting in a 80.7% increase in surfactin production after 24 h of fermentation in a Landy medium and a 2.9% decrease after 48 h of fermentation. The above results indicated that the effect of pps disruption on surfactin production was related to the fermentation medium and fermentation time.
In B. subtilis 168, YvkC may consume ATP and catalyse the synthesis of pyruvate to phosphoenolpyruvate. In addition, the yvkC gene encodes flavonoid phosphate synthetase, which catalyses the ATP-dependent phosphorylation of flavonoids to generate flavonoid monophosphates, AMP and orthophosphate [45]. To block gluconeogenesis and flavonoid monophosphate synthesis and reduce ATP consumption, the yvkC gene in the genome of BSSF3 was knocked out, resulting in knockout strain BSSF4. The fermentation results indicated that this had no significant positive effect on the synthesis of surfactin (Figure 3). Although surfactin synthesis requires ATP, the weaker activity of YvkC may result in less ATP consumption by its catalytic reaction and its knockout having no significant positive effect on surfactin synthesis.

3.3. Overexpression and Identification of a Surfactin Transporter to Enhance Surfactin Synthesis

Since surfactin accumulates excessively in cells, it may disrupt the integrity of cell membranes [31], thereby affecting normal cell function and even leading to cell death, which is obviously disadvantageous for the sustained synthesis of surfactin. Therefore, promoting surfactin secretion may improve surfactin production. In B. subtilis 168, yerP (also known as swrC) encodes a protein similar to the acriflavin resistance protein that is involved in surfactin efflux [46], and the ycxA gene, located downstream of the srfA operon, encodes a protein homologous to members of the major facilitator superfamily (MFS) [47]. In Bacillus thuringiensis, the krsE gene encodes an efflux protein involved in lipopeptide efflux [48]. The amino acid sequence of KrsE (GenBank: AIG20548.1) of B. thuringiensis was BLAST in the B. subtilis genome database, and it was found that YfiS shares the highest homology with KrsE (Figure S4). In B. subtilis 168, yfiS encodes a protein similar to multidrug resistance proteins.
The endogenous genes yerP, yfiS and ycxA were separately integrated into the yvkC locus of the BSSF3 genome under the control of the P43 promoter [37], resulting in strains BSSF51, BSSF52 and BSSF53. After 48 h of fermentation, their surfactin production reached 809.3 ± 24.8 mg/L, 1060.7 ± 89.4 mg/L and 798.7 ± 61.4 mg/L, respectively, increased by 4.9%, 37.4% and 3.5%, respectively, compared to that of control strain BSSF4 (771.7 ± 17.3 mg/L; Figure 4A). Moreover, the growth of strain BSSF52 overexpressing yfiS was better than that of control strain BSSF4 and recombinant strains BSSF51 and BSSF53, during the first 24 h of fermentation (Figure S5C). The qRT-PCR results showed that adding one copy number to the genome resulted in a 0.70-fold (Figure 4B), 1.09-fold (Figure 4C) and 2.88-fold (Figure 4D) increase in the relative transcriptional levels of mRNAs of genes yerP, yfiS and ycxA, respectively. Overexpressing ycxA resulted in the largest increase in the transcriptional level, but its promotion effect on surfactin synthesis was the weakest. Considering that the translation of ycxA is likely to require elongation factor P (Efp) due to the presence of several consecutive proline residues [49], we constructed artificial operon P43-ycxA-efp and integrated it into the yvkC locus of the BSSF3 genome to obtain strain BSSF54. Although the relative transcriptional level of efp was increased by 1.81-fold (Figure 4E), co-expression of ycxA and efp resulted in a 46.3% decrease in surfactin production compared to control strain BSSF53 overexpressing ycxA alone (Figure 4F) and a slight decrease in strain growth (Figure S5D). The above results indicated that YfiS was mainly responsible for surfactin efflux under the culture conditions of this study.

3.4. Enhancing Transcription of the srfA Operon to Promote Surfactin Synthesis

The nucleotide sequence of the srfA operon is up to 27 kb, making it difficult to increase its transcriptional level through overexpression. However, the promoter can determine the gene transcriptional level, so we attempted replacing the native promoter of the srfA operon. To this end, we used constitutive promoters PHpaII, P43 and PSB [38] to replace the native promoter of the srfA operon in the genome of strain BSSF52, resulting in recombinant strains BSSF61, BSSF62 and BSSF63. The fermentation results showed that the surfactin production was only 16.5 ± 1.3 mg/L, 3.1 ± 0.2 mg/L and 7.1 ± 0.1 mg/L, respectively (Figure 5A), decreased by 98.4%, 99.7% and 99.3% compared to BSSF52. The qRT-PCR results showed that the relative transcriptional levels of srfAA and srfAB in the srfA operon decreased by varying degrees (Figure 5B). This was consistent with the previous research by Willenbacher et al. [50] and Jiao et al. [51]. The surfactin production of B. subtilis DSM 10T was decreased to 0.04 g/L from 0.62 g/L when the Pveg promoter replaced the promoter of the srfA operon [50]. The ability of B. subtilis THY-7 to synthesise surfactin was lost when the PgroE promoter induced by L-arabinose was used as a replacement [51]. Therefore, the initial transcription effect of these three promoters was not as strong as that of the native promoter of the srfA operon.
The global regulatory factor CodY recognises GTP and branched-chain amino acids (BCAAs) as specific signals and affects the expression of >100 genes associated with metabolism [52]. CodY binds to the promoter of the srfA operon, occupying the binding site between DNA and positive regulatory proteins, leading to inhibition of the transcription of this operon [53]. We knocked out the codY gene of strain BSSF52 to generate knockout strain BSSF64. Its surfactin titre was 1601.8 ± 91.9 mg/L (Figure 5C), 51% higher than that of control strain BSSF52, as in accordance with a previous report, in which this knockout resulted in a 17.3% increase [21]. The relative transcriptional levels of srfAA and srfAB increased by 1.31-fold and 0.97-fold, respectively (Figure 5D). This indicated that the knockout of codY could indeed alleviate the partial regulation of the srfA operon, thereby increasing its transcription and promoting the expression of surfactin synthase, significantly improving surfactin synthesis.

3.5. Increasing Surfactin Production through Fed-Batch Fermentation

To improve the fermentation level of surfactin, we performed fed-batch fermentation of recombinant strain BSSF64 in a 5 L fermenter. After 6 h of fermentation, a large number of bubbles were evident, and the addition of soybean oil and polyether defoamer had no defoaming effect. Hence, fermentation could not proceed normally. A defoaming effect could only be achieved by adding organosilicon defoamer. After 36 h of fermentation, the maximum OD600 value of BSSF64 was 11.54 ± 1.83 (Figure 6A). Although its growth was almost twice that of flask fermentation, it was far below the growth achieved when using engineered B. subtilis for fed-batch fermentation to produce other high value-added chemicals [34,54]. The surfactin titres (yields) after fermentation for 12, 24, 36 and 48 h were 0.94 ± 0.15 g/L (0.22 ± 0.01 g/g DCW), 1.94 g/L (0.25 ± 0.01 g/g DCW), 3.89 ± 0.07 g/L (0.63 ± 0.02 g/g DCW) and 3.35 ± 0.17 g/L (0.52 ± 0.04 g/g DCW), respectively (Figure 6B). This might be due to inappropriate fermentation conditions leading to poor growth or to the toxicity of surfactin or organosilicon defoamer toward cells, which may have inhibited bacterial growth and surfactin synthesis. By optimising the fermentation medium and conditions alone, the OD600 of B. subtilis ATCC 21332 reached 60, and surfactin production was increased from 335 mg/L to 5.3 g/L [18]. Therefore, optimising the fermentation conditions, including carbon sources, nitrogen sources, pH, inoculum size and metal ions by adding Fe nanoparticles [55] or EDTA-Fe2+ [56], may be crucial for improving surfactin production in the future. Regarding the foaming phenomenon, a two-compartment biofilm bioreactor [57] or a foam trap [58] could be designed to avoid the addition of organosilicon defoamer.

4. Conclusions

The wild-type B. subtilis 168 strain cannot synthesise surfactin due to the presence of a frameshift mutation in the nucleotide sequence of sfp encoding PPTase, resulting in its inactivation. This study first removed the T496 base and integrated the overexpression of sfp*, which restored the activity of PPTase and increased the surfactin titre from zero to 747.5 ± 6.5 mg/L. The knockout of ppsD and yvkC had a minimal effect on surfactin synthesis. Overexpression of yerP, yfiS, ycxA and ycxA-efp indicated that YfiS might be the main surfactin transporter, and its overexpression increased surfactin production by 37.4% compared to the control strain. Replacing the native promoter of the srfA operon with three constitutive promoters significantly reduced the ability to synthesise surfactin, with yields ranging from 3.1 ± 0.2 mg/L to 16.5 ± 1.3 mg/L. However, the knockout of codY increased the surfactin titre by 51% to 1601.8 ± 91.9 mg/L. Finally, fed-batch fermentation was carried out in a 5 L fermenter without the need for antibiotics and inducers, and the highest titre of surfactin was 3.89 ± 0.07 g/L, with a yield of 0.63 ± 0.02 g/g DCW. Although the liquid production of surfactin was relatively low, production by dry weight was higher, indicating that engineered B. subtilis has the potential to become a cell factory for producing surfactin.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/microorganisms12050998/s1: Figure S1: Nucleotide sequences of the sfp gene in Bacillus subtilis. (A) Nucleotide sequence of the inactive pseudogene sfp in wild-type B. subtilis 168. (B) Nucleotide sequence of the active sfp gene; Figure S2: HPLC profiles of the samples and standards. (A) HPLC profile of the supernatant of wild-type B. subtilis 168 fermented for 48 h, concentrated 4-fold after treatment. (B) HPLC profile of the supernatant of recombinant strain BSSF2 fermented for 48 h, concentrated 4-fold after treatment. (C) HPLC profile of the 0.2 g/L surfactin standard. (D) HPLC profile of the 5.0 g/L surfactin standard; Figure S3: Alignment results of the amino acid sequences of PPTase from different sources. GenBank: ASF27580.1, PPTase from Bacillus amyloliquefaciens MT45; GenBank: CBI41443.1, PPTase from Bacillus amyloliquefaciens DSM7; GenBank: AWG39808.1, PPTase from Bacillus velezensis BS-37 DSM7; GenBank: P39135.2, active PPTase from Bacillus subtilis 168; Figure S4: Alignment results of the amino acid sequences of KrsE from Bacillus thuringiensis (GenBank: AIG20548.1) and YfiS of B. subtilis 168 (GenBank: CAL0278229.1); Figure S5: Effects of different gene modifications on bacterial growth. (A) Growth curves of wild-type Bacillus subtilis 168 (BS168), parental strain BS168N, yrpC gene knockout strain BSSF1 and sfp gene overexpression strain BSSF2. (B) Growth curves of control strain BSSF2, pssD gene knockout strain BSSF3 and yvkC gene knockout strain BSSF4. (C) Growth curves of control strain BSSF4, yerP gene overexpression strain BSSF51, yfiS gene overexpression strain BSSF52 and ycxA gene overexpression strain BSSF53. (D) Growth curves of control strain BSSF53 and ycxA-efp gene overexpression strain BSSF54. (E) Growth curves of control strain BSSF52 and strains BSSF61, BSSF62 and BSSF63 obtained by replacing the native promoter of the srfA operon with promoters PHpaII, P43 and PSB, respectively. (F) Growth curves of control strain BSSF52 and codY gene knockout strain BSSF64.

Author Contributions

Conceptualisation, S.Y. and X.G.; methodology, S.Y.; validation, Z.G., J.S., M.L., Y.D. and S.Y.; formal analysis, Z.G., J.S. and S.Y.; investigation, Z.G., J.S. and S.Y.; data curation, Z.G., J.S. and S.Y.; writing—original draft preparation, Z.G. and S.Y.; writing—review and editing, S.Y. and X.G.; visualisation, S.Y.; supervision, Q.M.; project administration, Q.M. and X.G.; funding acquisition, S.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Natural Science Foundation of Shandong Province, grant number ZR2022QC078.

Data Availability Statement

All data are contained within the article and the Supplementary Materials.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Sumi, C.D.; Yang, B.W.; Yeo, I.C.; Hahm, Y.T. Antimicrobial peptides of the genus Bacillus: A new era for antibiotics. Can. J. Microbiol. 2015, 61, 93–103. [Google Scholar] [CrossRef] [PubMed]
  2. C, F.C.; Kumar, P.S.; Ngueagni, P.T. A review on new aspects of lipopeptide biosurfactant: Types, production, properties and its application in the bioremediation process. J. Hazard. Mater. 2021, 407, 124827. [Google Scholar]
  3. Bonmatin, J.M.; Laprevote, O.; Peypoux, F. Diversity among microbial cyclic lipopeptides: Iturins and surfactins. Activity-structure relationships to design new bioactive agents. Comb. Chem. High Throughput Screen. 2003, 6, 541–556. [Google Scholar] [CrossRef]
  4. Zhao, F.; Zhu, H.B.; Cui, Q.F.; Wang, B.X.; Su, H.; Zhang, Y. Anaerobic production of surfactin by a new Bacillus subtilis isolate and the in situ emulsification and viscosity reduction effect towards enhanced oil recovery applications. J. Petrol. Sci. Eng. 2021, 201, 108508. [Google Scholar] [CrossRef]
  5. Datta, P.; Tiwari, P.; Pandey, L.M. Experimental investigation on suitability of surfactin for enhanced oil recovery: Stability, adsorption equilibrium and kinetics studies. J. Environ. Chem. Eng. 2022, 10, 107083. [Google Scholar] [CrossRef]
  6. Liu, Q.; Niu, J.J.; Yu, Y.; Wang, C.Y.; Lu, S.J.; Zhang, S.W.; Lv, J.; Peng, B. Production, characterization and application of biosurfactant produced by Bacillus licheniformis L20 for microbial enhanced oil recovery. J. Clean. Prod. 2021, 307, 127193. [Google Scholar] [CrossRef]
  7. Ferreira, A.; Vecino, X.; Ferreira, D.; Cruz, J.M.; Moldes, A.B.; Rodrigues, L.R. Novel cosmetic formulations containing a biosurfactant from Lactobacillus paracasei. Colloids Surf. B Biointerfaces 2017, 155, 522–529. [Google Scholar] [CrossRef]
  8. Fei, D.; Zhou, G.W.; Yu, Z.Q.; Gang, H.Z.; Liu, J.F.; Yang, S.Z.; Ye, R.Q.; Mu, B.Z. Low-toxic and nonirritant biosurfactant surfactin and its performances in detergent formulations. J. Surfactants Deterg. 2020, 23, 109–118. [Google Scholar] [CrossRef]
  9. Deleu, M.; Lorent, J.; Lins, L.; Brasseur, R.; Braun, N.; Kirat, K.E.; Nylander, T.; Dufrêne, Y.F.; Mingeot-Leclercq, M.P. Effects of surfactin on membrane models displaying lipid phase separation. BBA Biomembr. 2013, 1828, 801–815. [Google Scholar] [CrossRef] [PubMed]
  10. Lilge, L.; Ersig, N.; Hubel, P.; Aschern, M.; Pillai, E.; Klausmann, P.; Pfannstiel, J.; Henkel, M.; Heravi, K.M.; Hausmann, R. Surfactin shows relatively low antimicrobial activity against Bacillus subtilis and other bacterial model organisms in the absence of synergistic metabolites. Microorganisms 2022, 10, 779. [Google Scholar] [CrossRef] [PubMed]
  11. Jung, M.; Lee, S.; Kim, H. Recent studies on natural products as anti-HIV agents. Curr. Med. Chem. 2000, 7, 649–661. [Google Scholar] [CrossRef] [PubMed]
  12. Huang, X.Q.; Gao, X.P.; Zheng, L.Y.; Hao, G.Z. Optimization of sterilization of Salmonella enteritidis in meat by surfactin and iturin using a response surface method. Int. J. Pept. Res. Ther. 2009, 15, 61–67. [Google Scholar] [CrossRef]
  13. Zouari, R.; Moalla-Rekik, D.; Sahnoun, Z.; Rebai, T.; Ellouze-Chaabouni, S.; Ghribi-Aydi, D. Evaluation of dermal wound healing and in vitro antioxidant efficiency of Bacillus subtilis SPB1 biosurfactant. Biomed. Pharmacother. 2016, 84, 878–891. [Google Scholar] [CrossRef] [PubMed]
  14. Kisil, O.V.; Trefilov, V.S.; Sadykova, V.S.; Zvereva, M.E.; Kubareva, E.A. Surfactin: Its biological activity and possibility of application in agriculture. Appl. Biochem. Microbiol. 2023, 59, 1–13. [Google Scholar] [CrossRef]
  15. Leconte, A.; Tournant, L.; Muchembled, J.; Paucellier, J.; Héquet, A.; Deracinois, B.; Deweer, C.; Krier, F.; Deleu, M.; Oste, S.; et al. Assessment of lipopeptide mixtures produced by Bacillus subtilis as biocontrol products against apple scab (Venturia inaequalis). Microorganisms 2022, 10, 1810. [Google Scholar] [CrossRef] [PubMed]
  16. Mgbechidinma, C.L.; Akan, O.D.; Zhang, C.F.; Huang, M.Z.; Linus, N.; Zhu, H.; Wakil, S.M. Integration of green economy concepts for sustainable biosurfactant production-a review. Bioresour. Technol. 2022, 364, 128021. [Google Scholar] [CrossRef] [PubMed]
  17. Gaur, V.K.; Sharma, P.; Sirohi, R.; Varjani, S.; Taherzadeh, M.J.; Chang, J.S.; Ng, H.Y.; Wong, J.W.C.; Kim, S.H. Production of biosurfactants from agro-industrial waste and waste cooking oil in a circular bioeconomy: An overview. Bioresour. Technol. 2022, 343, 126059. [Google Scholar] [CrossRef] [PubMed]
  18. Xia, L.; Hou, Z.J.; Zhu, F.Z.; Wen, J.P. Enhancing surfactin production in Bacillus subtilis: Insights from proteomic analysis of nitrate-induced overproduction and strategies for combinatorial metabolic engineering. Bioresour. Technol. 2024, 397, 130499. [Google Scholar] [CrossRef] [PubMed]
  19. Arima, K.; Kakinuma, A.; Tamura, G. Surfactin, a crystalline peptidelipid surfactant produced by Bacillus subtilis: Isolation, characterization and its inhibition of fibrin clot formation. Biochem. Biophys. Res. Commun. 1968, 31, 488–494. [Google Scholar] [CrossRef] [PubMed]
  20. Su, Y.; Liu, C.; Fang, H.; Zhang, D.W. Bacillus subtilis: A universal cell factory for industry, agriculture, biomaterials and medicine. Microb. Cell Fact. 2020, 19, 173. [Google Scholar] [CrossRef]
  21. Wu, Q.; Zhi, Y.; Xu, Y. Systematically engineering the biosynthesis of a green biosurfactant surfactin by Bacillus subtilis 168. Metab. Eng. 2019, 52, 87–97. [Google Scholar] [CrossRef] [PubMed]
  22. Wang, M.M.; Yu, H.M.; Li, X.; Shen, Z.Y. Single-gene regulated non-spore-forming Bacillus subtilis: Construction, transcriptome responses, and applications for producing enzymes and surfactin. Metab. Eng. 2020, 62, 235–248. [Google Scholar] [CrossRef] [PubMed]
  23. Schwarzer, D.; Finking, R.; Marahiel, M.A. Nonribosomal peptides: From genes to products. Nat. Prod. Rep. 2003, 20, 275–287. [Google Scholar] [CrossRef] [PubMed]
  24. Nakano, M.M.; Marahiel, M.A.; Zuber, P. Identification of a genetic locus required for biosynthesis of the lipopeptide antibiotic surfactin in Bacillus subtilis. J. Bacteriol. 1988, 170, 5662–5668. [Google Scholar] [CrossRef] [PubMed]
  25. Marahiel, M.A.; Stachelhaus, T.; Mootz, H.D. Modular peptide synthases involved in nonribosomal peptide synthesis. Chem. Rev. 1997, 97, 2651–2674. [Google Scholar] [CrossRef] [PubMed]
  26. Tran, L.S.; Nagai, T.; Itoh, Y. Divergent structure of the ComQXPA quorum-sensing components: Molecular basis of strain-specific communication mechanism in Bacillus subtilis. Mol. Microbiol. 2010, 37, 1159–1171. [Google Scholar] [CrossRef]
  27. Comella, N.; Grossman, A.D. Conservation of genes and processes controlled by the quorum response in bacteria: Characterization of genes controlled by the quorum-sensing transcription factor ComA in Bacillus subtilis. Mol. Microbiol. 2005, 57, 1159–1174. [Google Scholar] [CrossRef]
  28. Reuter, K.; Mofid, M.R.; Marahiel, M.A.; Ficner, R. Crystal structure of the surfactin synthetase-activating enzyme sfp: A prototype of the 4′-phosphopantetheinyl transferase superfamily. EMBO J. 1999, 18, 6823–6831. [Google Scholar] [CrossRef]
  29. Wang, C.Y.; Cao, Y.X.; Wang, Y.P.; Sun, L.M.; Song, H. Enhancing surfactin production by using systematic CRISPRi repression to screen amino acid biosynthesis genes in Bacillus subtilis. Microb. Cell Fact. 2019, 18, 90. [Google Scholar] [CrossRef]
  30. Hu, F.X.; Liu, Y.Y.; Lin, J.Z.; Wang, W.D.; Li, S. Efficient production of surfactin from xylose-rich corncob hydrolysate using genetically modified Bacillus subtilis 168. Appl. Microbiol. Biotechnol. 2020, 104, 4017–4026. [Google Scholar] [CrossRef]
  31. Li, X.; Yang, H.; Zhang, D.L.; Li, X.; Yu, H.M.; Shen, Z.Y. Overexpression of specific proton motive force-dependent transporters facilitate the export of surfactin in Bacillus subtilis. J. Ind. Microbiol. Biotechnol. 2015, 42, 93–103. [Google Scholar] [CrossRef] [PubMed]
  32. Liu, S.H.; Endo, K.; Ara, K.; Ozaki, K.; Ogasawara, N. Introduction of marker-free deletions in Bacillus subtilis using the AraR repressor and the ara promoter. Microbiology 2008, 154, 2562–2570. [Google Scholar] [CrossRef] [PubMed]
  33. Yang, S.M.; Li, J.C.; Meng, R.; Yu, T.T.; Wang, Z.J.; Xiong, P.; Gao, Z.Q. Screening and identification of genes involved in β-alanine biosynthesis in Bacillus subtilis. Arch. Biochem. Biophys. 2023, 743, 109664. [Google Scholar] [CrossRef] [PubMed]
  34. Anagnostopoulos, C.; Spizizen, J. Requirements for transformation in Bacillus subtilis. J. Bacteriol. 1961, 81, 741–746. [Google Scholar] [CrossRef] [PubMed]
  35. Liu, D.Y.; Mao, Z.T.; Guo, J.X.; Wei, L.Y.; Ma, H.W.; Tand, Y.J.; Chen, T.; Wang, Z.W.; Zhao, X.M. Construction, model-based analysis and characterization of a promoter library for fine-tuned gene expression in Bacillus subtilis. ACS Synth. Biol. 2018, 7, 1785–1797. [Google Scholar] [CrossRef] [PubMed]
  36. Yang, S.M.; Wang, Y.P.; Cai, Z.G.; Zhang, G.Y.; Song, H. Metabolic engineering of Bacillus subtilis for high-titer production of menaquinone-7. AIChE J. 2020, 66, e16754. [Google Scholar] [CrossRef]
  37. Song, B.H.; Neuhard, J. Chromosomal location, cloning and nucleotide sequence of the Bacillus subtilis cdd gene encoding cytidine/deoxycytidine deaminase. Mol. Gen. Genet. 1989, 216, 462–468. [Google Scholar] [CrossRef] [PubMed]
  38. Zhu, H.; Yang, S.M.; Yuan, Z.M.; Ban, R. Metabolic and genetic factors affecting the productivity of pyrimidine nucleoside in Bacillus subtilis. Microb. Cell Fact. 2015, 14, 54. [Google Scholar] [CrossRef] [PubMed]
  39. Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]
  40. Norusis, M.J. SPSS Statistics 17.0: Guide to Data Analysis; Prentice Hall: Englewood Cliffs, NJ, USA, 2008. [Google Scholar]
  41. Quadri, L.E.; Weinreb, P.H.; Lei, M.; Nakano, M.M.; Zuber, P.; Walsh, C.T. Characterization of Sfp, a Bacillus subtilis phosphopantetheinyl transferase for peptidyl carrier protein domains in peptide synthetases. Biochemistry 1998, 37, 1585–1595. [Google Scholar] [CrossRef] [PubMed]
  42. Kimura, K.; Tran, L.S.P.; Itoh, Y. Roles and regulation of the glutamate racemase isogenes, racE and yrpC, in Bacillus subtilis. Microbiology 2004, 150, 2911–2920. [Google Scholar] [CrossRef] [PubMed]
  43. Gao, L.; Guo, J.P.; Fan, Y.; Ma, Z.; Lu, Z.X.; Zhang, C.; Zhao, H.Z.; Bie, X.M. Module and individual domain deletions of NRPS to produce plipastatin derivatives in Bacillus subtilis. Microb. Cell Fact. 2018, 17, 84. [Google Scholar] [CrossRef] [PubMed]
  44. Coutte, F.; Leclère, V.; Béchet, M.; Guez, J.S.; Lecouturier, D.; Chollet-Imbert, M.; Dhulster, P.; Jacques, P. Effect of pps disruption and constitutive expression of srfA on surfactin productivity, spreading and antagonistic properties of Bacillus subtilis 168 derivatives. J. Appl. Microbiol. 2010, 109, 480–491. [Google Scholar] [CrossRef] [PubMed]
  45. Hsu, C.; Tsai, H.Y.; Chang, C.F.; Yang, C.C.; Su, N.W. Discovery of a novel phosphotransferase from Bacillus subtilis that phosphorylates a broad spectrum of flavonoids. Food Chem. 2023, 400, 134001. [Google Scholar] [CrossRef] [PubMed]
  46. Tsuge, K.; Ohata, Y.; Shoda, M. Gene yerP, involved in surfactin self-resistance in Bacillus subtilis. Antimicrob. Agents Chemother. 2001, 45, 3566–3573. [Google Scholar] [CrossRef] [PubMed]
  47. Saier, M.H., Jr.; Goldman, S.R.; Maile, R.R.; Moreno, M.S.; Weyler, W.; Yang, N.; Paulsen, I.T. Transport capabilities encoded within the Bacillus subtilis genome. J. Mol. Microbiol. Biotechnol. 2002, 4, 37–67. [Google Scholar] [PubMed]
  48. Béchet, M.; Caradec, T.; Hussein, W.; Abderrahmani, A.; Chollet, M.; Leclère, V.; Dubois, T.; Lereclus, D.; Pupin, M.; Jacques, P. Structure, biosynthesis, and properties of kurstakins, nonribosomal lipopeptides from Bacillus spp. Appl. Microbiol. Biotechnol. 2012, 95, 593–600. [Google Scholar] [CrossRef] [PubMed]
  49. Doerfel, L.K.; Wohlgemuth, I.; Kothe, C.; Peske, F.; Urlaub, H.; Rodnina, M.V. EF-P is essential for rapid synthesis of proteins containing consecutive proline residues. Science 2013, 339, 85–88. [Google Scholar] [CrossRef]
  50. Willenbacher, J.; Mohr, T.; Henkel, M.; Gebhard, S.; Mascher, T.; Syldatk, C.; Hausmann, R. Substitution of the native srfA promoter by constitutive Pveg in two B. subtilis strains and evaluation of the effect on surfactin production. J. Biotechnol. 2016, 224, 14–17. [Google Scholar] [CrossRef] [PubMed]
  51. Jiao, S.; Li, X.; Yu, H.M.; Yang, H.; Li, X.; Shen, Z.Y. In situ enhancement of surfactin biosynthesis in Bacillus subtilis using novel artificial inducible promoters. Biotechnol. Bioeng. 2017, 114, 832–842. [Google Scholar] [CrossRef] [PubMed]
  52. Han, A.R.; Kang, H.R.; Son, J.; Kwon, D.H.; Kim, S.; Lee, W.C.; Song, H.K.; Song, M.J.; Hwang, K.Y. The structure of the pleiotropic transcription regulator CodY provides insight into its GTP-sensing mechanism. Nucleic Acids Res. 2016, 44, 9483–9493. [Google Scholar] [CrossRef] [PubMed]
  53. Serror, P.; Sonenshein, A.L. CodY is required for nutritional repression of Bacillus subtilis genetic competence. J. Bacteriol. 1996, 178, 5910–5915. [Google Scholar] [CrossRef] [PubMed]
  54. Yang, S.M.; Wang, A.L.; Li, J.C.; Shao, Y.H.; Sun, F.J.; Li, S.C.; Cao, K.; Liu, H.L.; Xiong, P.; Gao, Z.G. Improved biosynthesis of heme in Bacillus subtilis through metabolic engineering assisted fed-batch fermentation. Microb. Cell Fact. 2023, 22, 102. [Google Scholar] [CrossRef] [PubMed]
  55. Yang, N.; Wu, Q.; Xu, Y. Fe nanoparticles enhanced surfactin production in Bacillus amyloliquefaciens. ACS Omega 2020, 5, 6321–6329. [Google Scholar] [CrossRef] [PubMed]
  56. Mei, Y.W.; Yang, Z.Y.; Kang, Z.H.; Yu, F.; Long, X.W. Enhanced surfactin fermentation via advanced repeated fed-batch fermentation with increased cell density stimulated by EDTA–Fe (II). Food Bioprod. Process. 2021, 127, 288–294. [Google Scholar] [CrossRef]
  57. Brück, H.L.; Coutte, F.; Dhulster, P.; Gofflot, S.; Jacques, P.; Delvigne, F. Growth dynamics of bacterial populations in a two-compartment biofilm bioreactor designed for continuous surfactin biosynthesis. Microorganisms 2020, 8, 679. [Google Scholar] [CrossRef] [PubMed]
  58. Klausmann, P.; Hennemann, K.; Hoffmann, M.; Treinen, C.; Aschern, M.; Lilge, L.; Heravi, K.M.; Henkel, M.; Hausmann, R. Bacillus subtilis high cell density fermentation using a sporulation-deficient strain for the production of surfactin. Appl. Microbiol. Biotechnol. 2021, 105, 4141–4151. [Google Scholar] [CrossRef]
Microorganisms 12 00998 g001
Figure 1. Schematic diagram of the biosynthetic pathway and the overall engineering strategy of surfactin in Bacillus subtilis. yvkC, gene encoding phosphotransferase; ppsABCDE, the operon encoding plipastatin synthetase; yrpC, gene encoding L-glutamate racemase (non-essential gene); racE, gene encoding L-glutamate racemase (essential gene); sfp*, gene encoding active phosphopantetheinyl transferase; srfAA-srfAB-srfAC-srfAD, the operon encoding surfactin synthetase; yfiS, gene encoding the surfactin transporter.
Figure 1. Schematic diagram of the biosynthetic pathway and the overall engineering strategy of surfactin in Bacillus subtilis. yvkC, gene encoding phosphotransferase; ppsABCDE, the operon encoding plipastatin synthetase; yrpC, gene encoding L-glutamate racemase (non-essential gene); racE, gene encoding L-glutamate racemase (essential gene); sfp*, gene encoding active phosphopantetheinyl transferase; srfAA-srfAB-srfAC-srfAD, the operon encoding surfactin synthetase; yfiS, gene encoding the surfactin transporter.
Microorganisms 12 00998 g001
Microorganisms 12 00998 g002
Figure 2. Surfactin titre and growth of wild-type Bacillus subtilis 168 (BS168), parent strain BS168N, yrpC gene knockout strain BSSF1 and sfp gene overexpression strain BSSF2, and the relative transcriptional levels of the sfp gene. (A) Surfactin titre and growth of the BS168, BS168N, BSSF1 and BSSF2 strains after 48 h of fermentation; (B) transcriptional level of sfp in strain BSSF2 relative to that in control strain BSSF1 (defined as 1). Significant differences were determined by SPSS statistics 17.0 based on p < 0.05 (*) and p < 0.001 (***).
Figure 2. Surfactin titre and growth of wild-type Bacillus subtilis 168 (BS168), parent strain BS168N, yrpC gene knockout strain BSSF1 and sfp gene overexpression strain BSSF2, and the relative transcriptional levels of the sfp gene. (A) Surfactin titre and growth of the BS168, BS168N, BSSF1 and BSSF2 strains after 48 h of fermentation; (B) transcriptional level of sfp in strain BSSF2 relative to that in control strain BSSF1 (defined as 1). Significant differences were determined by SPSS statistics 17.0 based on p < 0.05 (*) and p < 0.001 (***).
Microorganisms 12 00998 g002
Microorganisms 12 00998 g003
Figure 3. Surfactin titre and growth of control strain BSSF2, pssD gene knockout strain BSSF3 and yvkC gene knockout strain BSSF4 after 48 h of fermentation.
Figure 3. Surfactin titre and growth of control strain BSSF2, pssD gene knockout strain BSSF3 and yvkC gene knockout strain BSSF4 after 48 h of fermentation.
Microorganisms 12 00998 g003
Microorganisms 12 00998 g004
Figure 4. Surfactin titre, growth and relative transcriptional level of control strain BSSF4, and recombinant strains BSSF51 overexpressing yerP, BSSF52 overexpressing yfiS, BSSF53 overexpressing ycxA and BSSF54 overexpressing ycxA-efp. (A) Surfactin titre and growth of BSSF4, BSSF51, BSSF52 and BSSF53 after 48 h of fermentation; (B) transcriptional level of yerP in strain BSSF51 relative to that in control strain BSSF4 (defined as 1); (C) transcriptional level of yfiS in strain BSSF52 relative to that in strain BSSF4 (defined as 1); (D) transcriptional level of ycxA in strain BSSF53 relative to that in strain BSSF4 (defined as 1); (E) transcriptional level of efp in strain BSSF54 relative to that in control strain BSSF53 (defined as 1); (F) surfactin titre and growth of BSSF53 and BSSF54 after 48 h of fermentation. Significant differences were determined by SPSS statistics 17.0 based on p < 0.01 (**) and p < 0.001 (***).
Figure 4. Surfactin titre, growth and relative transcriptional level of control strain BSSF4, and recombinant strains BSSF51 overexpressing yerP, BSSF52 overexpressing yfiS, BSSF53 overexpressing ycxA and BSSF54 overexpressing ycxA-efp. (A) Surfactin titre and growth of BSSF4, BSSF51, BSSF52 and BSSF53 after 48 h of fermentation; (B) transcriptional level of yerP in strain BSSF51 relative to that in control strain BSSF4 (defined as 1); (C) transcriptional level of yfiS in strain BSSF52 relative to that in strain BSSF4 (defined as 1); (D) transcriptional level of ycxA in strain BSSF53 relative to that in strain BSSF4 (defined as 1); (E) transcriptional level of efp in strain BSSF54 relative to that in control strain BSSF53 (defined as 1); (F) surfactin titre and growth of BSSF53 and BSSF54 after 48 h of fermentation. Significant differences were determined by SPSS statistics 17.0 based on p < 0.01 (**) and p < 0.001 (***).
Microorganisms 12 00998 g004
Microorganisms 12 00998 g005
Figure 5. Surfactin titre, growth and relative transcriptional level of control strain BSSF52 and strains BSSF61, BSSF62 and BSSF63 obtained by replacing the native promoter of the srfA operon with promoters PHpaII, P43 and PSB, respectively, and codY knockout strain BSSF64. (A) Surfactin titre and growth of BSSF52, BSSF61, BSSF62 and BSSF63 after 48 h of fermentation; (B) transcriptional levels of srfAA and srfAB in strains BSSF61, BSSF62 and BSSF63 relative to those in BSSF52 (defined as 1); (C) surfactin titre and growth of BSSF52 and BSSF64 after 48 h of fermentation; (D) transcriptional levels of srfAA and srfAB in strain BSSF64 relative to those in strain BSSF52 (defined as 1). Significant differences were determined by SPSS statistics 17.0 based on p < 0.05 (*), p < 0.01 (**) and p < 0.001 (***).
Figure 5. Surfactin titre, growth and relative transcriptional level of control strain BSSF52 and strains BSSF61, BSSF62 and BSSF63 obtained by replacing the native promoter of the srfA operon with promoters PHpaII, P43 and PSB, respectively, and codY knockout strain BSSF64. (A) Surfactin titre and growth of BSSF52, BSSF61, BSSF62 and BSSF63 after 48 h of fermentation; (B) transcriptional levels of srfAA and srfAB in strains BSSF61, BSSF62 and BSSF63 relative to those in BSSF52 (defined as 1); (C) surfactin titre and growth of BSSF52 and BSSF64 after 48 h of fermentation; (D) transcriptional levels of srfAA and srfAB in strain BSSF64 relative to those in strain BSSF52 (defined as 1). Significant differences were determined by SPSS statistics 17.0 based on p < 0.05 (*), p < 0.01 (**) and p < 0.001 (***).
Microorganisms 12 00998 g005
Microorganisms 12 00998 g006
Figure 6. Growth curve, surfactin titre and yield of the final recombinant strain BSSF64 during fed-batch fermentation. (A) Growth curve of BSSF64 during fed-batch fermentations in a 5 L fermenter; (B) surfactin titre and yield of BSSF64 during fed-batch fermentations in a 5 L fermenter.
Figure 6. Growth curve, surfactin titre and yield of the final recombinant strain BSSF64 during fed-batch fermentation. (A) Growth curve of BSSF64 during fed-batch fermentations in a 5 L fermenter; (B) surfactin titre and yield of BSSF64 during fed-batch fermentations in a 5 L fermenter.
Microorganisms 12 00998 g006
Table 1. Bacterial strains and plasmids used in this study.
Table 1. Bacterial strains and plasmids used in this study.
NameGenotypeSource
Strain
 Bacillus subtilis 168 (BS168)trpC2Provided by Tianjin University
 BS168NtrpC2, ΔaraR::Para-neoProvided by Tianjin University
 BSD1-ΔyrpCmBS168N, ΔyrpC::cat-araR, pHY300PLK-P43-panD[33]
 BSD1-ΔyvkCmBS168N, ΔyvkC::cat-araR, pHY300PLK-P43-panD[33]
 BSΔ6-AD1mBSΔ6, ΔyvkC::P43-pfkA::cat-araR, pHY300PLK-P43-panD[33]
 BSSF1BS168N, ΔyrpCThis study
 BSSF2BS168N, ΔyrpC::TP2-sfp*This study
 BSSF3BS168N, ΔyrpC::TP2-sfp*, ΔppsDThis study
 BSSF4BS168N, ΔyrpC::TP2-sfp*, ΔppsD, ΔyvkCThis study
 BSSF51BS168N, ΔyrpC::TP2-sfp*, ΔppsD, ΔyvkC::P43-yerPThis study
 BSSF51mBS168N, ΔyrpC::TP2-sfp*, ΔppsD, ΔyvkC::P43-yerP::cat-araRThis study
 BSSF52BS168N, ΔyrpC::TP2-sfp*, ΔppsD, ΔyvkC::P43-yfiSThis study
 BSSF53BS168N, ΔyrpC::TP2-sfp*, ΔppsD, ΔyvkC::P43-ycxAThis study
 BSSF53mBS168N, ΔyrpC::TP2-sfp*, ΔppsD, ΔyvkC::P43-ycxA::cat-araRThis study
 BSSF54BS168N, ΔyrpC::TP2-sfp*, ΔppsD, ΔyvkC::P43-ycxA-efpThis study
 BSSF61BS168N, ΔyrpC::TP2-sfp*, ΔppsD, ΔyvkC::P43-yfiS, PHpaII-srfAThis study
 BSSF62BS168N, ΔyrpC::TP2-sfp*, ΔppsD, ΔyvkC::P43-yfiS, P43-srfAThis study
 BSSF63BS168N, ΔyrpC::TP2-sfp*, ΔppsD, ΔyvkC::P43-yfiS, PSB-srfAThis study
 BSSF64BS168N, ΔyrpC::TP2-sfp*, ΔppsD, ΔyvkC::P43-yfiS, ΔcodYThis study
Plasmid
 pUC57-simple-VHbAmpR, containing the constitutive promoter TP2 expression cassette[34]
 pMA5AmpR, containing the constitutive PHpaII promoterLaboratory stock
 pUC57-simple-PyrGE156KAmpR, containing the constitutive promoter PSB expression cassette[34]
AmpR, ampicillin resistance; *, base T496 in the sfp gene sequence was removed.
Table 2. Sequences of the primers used in this study.
Table 2. Sequences of the primers used in this study.
PrimerSequence (5′→3′)
Knockout of the yrpC gene
yrpC-U1CTTACGCCAGACCTCCTA
yrpC-G2ATCCTAACACAATCCTTCCAT
yrpC-D2GTTGCCTGAGACTGTTACT
Overexpression of the sfp* gene
yrpC-U2qACCATCAACGCAACCATAAACTCGCATCCTATCAATGTGA
TP2-1GTTTATGGTTGCGTTGATGG
TP2-2CATTCTTTACCCTCTCCTTTTAA
sfp1-1qTTAAAAGGAGAGGGTAAAGAATGAAGATTTACGGAATTTATATGGAC
sfp1-2TGAAAAGGAATCAGCGGAAG
sfp2-1CTTCCGCTGATTCCTTTTCA
sfp2-2ACTGTTGATGAGCCATTTATA
yrpC-D1qTATAAATGGCTCATCAACAGTAACGGGCTCAATCACCTT
Knockout of the ppsD gene
ppsD-U1TTGCTCATCCGACTGTTG
ppsD-U2GCAGTTCCATATTCTGAAGG
ppsD-D1qTCCTTCAGAATATGGAACTGCTGTTGCCAGAGGTTATTTGA
ppsD-D2AATAGGTGCCGCTCATCT
ppsD-CR1qCAGATGAGCGGCACCTATTTCTTCAACTAAAGCACCCAT
ppsD-CR2TTATTCATTCAGTTTTCGTG
ppsD-G1qCGCACGAAAACTGAATGAATAATTGAACGAACAGGCTACC
ppsD-G2GCATCCGCTGATTCTGAT
Knockout of the yvkC gene
yvkC-U1CAATGGCTTTCGGCTGAT
yvkC-G2TCTCCTTGAATGTCCTGATAC
yvkC-D2AGTGGAGACGGTGAATGA
Overexpression of genes yerP, yfiS, ycxA and ycxA-efp
yvkC-P2TTGTAAATTCCTCTCTTACCTAT
yerP-1qTATAGGTAAGAGAGGAATTTACACATGACCAGTCAGTCAATAAAAA
yerP-2GCAGACCAGACAACGAAT
yvkC-yerP-D1qCATTCGTTGTCTGGTCTGCTGCTGTGATAGAGGATGAA
yvkC-yerP-G2TGTCCTGATACATCGCTTG
CX-P43-1ATACAGCCTTTGAACATACG
CX-yerP-2ATCACAACGATGGAGTCAT
CX-yerP-3GCCATCTTCGGTGCTATT
CX-yerP-5AAGCGAAAGAACACAAACC
yfiS-1qTATAGGTAAGAGAGGAATTTACAAATGGAAAAACCGTTGTTTCG
yfiS-2ACATCCTTCATCGTCGTTAA
yvkC-yfiS-D1qATTAACGACGATGAAGGATGTATGAAGTATTGGCGAAGTTC
yvkC-yfiS-G2GGGAGGTATGTGTGATTGAT
ycxA-1qTATAGGTAAGAGAGGAATTTACAAATGCGCACGTCTCCCAGGT
ycxA-2CATATACACTGAACCAAGAAGG
ycxA-D1qTCCTTCTTGGTTCAGTGTATATGATTCGTTGTCTGGTCTGC
2-ycxA-2TTTTATATTGAATGGTGGGTTTCT
efp-1qAAGAAACCCACCATTCAATATAAAATGTGATTGGAATATAGGAGGAC
efp-2GCTTGCTGAAGTAGTCTTGT
yvkC-efp-D1qGACAAGACTACTTCAGCAAGCATTCCTTCGTGGTTCAGTGT
CX-efp1TTACTGATTGTCGCTGTGT
In situ substitution of promoter of srfA operon
srf-U1GAGTTATCCTTGGACAATCAG
srf-U2ACTGCTGCGTTGAATCTT
srf-C1qAAAGATTCAACGCAGCAGTTCATCAAGTAAAGCACCCAT
srf-C2ACAGTCGGCATTATCACATA
srf-P1-1qATATGTGATAATGCCGACTGTAATACTTCCTGTCCCTTGCT
srf-P1-2TTGTAAATCGCTCCTTTTTAGG
srf-D1qCCTAAAAAGGAGCGATTTACAAATGGAAATAACTTTTTACCCTTTAAC
srf-D2CCGTCACAACATCATTCTG
CX-P1-1AATACTTCCTGTCCCTTGCT
2-srf-C2ACAGTCGGCATTATCACTTA
srf-P2-1qATAAGTGATAATGCCGACTGTATTCAGCCATAGAACATACG
srf-P2-2TTGTAAATTCCTCTCTTTCCTAT
2-srf-D1qTATAGGAAAGAGAGGAATTTACAAATGGAAATAACTTTTTACCCTTTAAC
CX-P2-1ATTCAGCCATAGAACATACG
srf-P3-1qATAAGTGATAATGCCGACTGTAAAACGAAGAGAGAACATAGTAG
srf-P3-2TTTGAAATCCTCCTTTTGTCC
3-srf-D1qGGACAAAAGGAGGATTTCAAAATGGAAATAACTTTTTACCCATTAAC
CX-P3-1ACCCATTATTACAGCAGGAA
Knockout of the codY gene
codY-U1GAGACTTCTGTTCGGCTTAT
codY-U2ACCTCCTAAACATTCCTCAT
codY-D1qTATGAGGAATGTTTAGGAGGTGCTTTATTTGCTGGGTTGAA
codY-D2TATGATCTAGTGCTGCTGAC
codY-CR1qTGTCAGCAGCACTAGATCATAACTTCAACTAAAGCACCCAT
codY-CR2GTCTTCTTCCACCACTTG
codY-G1qTCAAGTGGTGGAAGAAGACGGTAAACTACAAGGAAATGG
codY-G2TTCTGAGTGCGTTCACAATA
Quantitative RT-PCR
RT-ccpA1ACGAGCATGTGGCGGAATT
RT-ccpA2CGATAGCGACTGACGGTGTT
RT-sfp1ATAAGCAGGCAGTATCAGTT
RT-sfp2CGGAGTGAGAAATGTTGAAA
RT-yerP1ATGACTCCATCGTTGTGAT
RT-yerP2ATTTCCTTCGTCGCTTCA
RT-yfiS1TTCTTTCTTTCCGCTGTCA
RT-yfiS2TAGAAGTAAGTGCTGCTGTT
RT-ycxA1GCAGAGCACCTATACCATT
RT-ycxA2ACGCCGAAGTACAGGATA
RT-efp1GGATGAAACACTTGGTATCG
RT-efp2CTGACGCTGTATCACCTT
RT-srfAA1GGTCAGCAATACGGAAGTA
RT-srfAA2TCTGGACGGTTGTAATAGC
RT-srfAB1GCTCCATATCGTCCAGAAG
RT-srfAB2GGCGGTGTTCACTATTGT
*, base T496 in the sfp gene sequence was removed.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Guo, Z.; Sun, J.; Ma, Q.; Li, M.; Dou, Y.; Yang, S.; Gao, X. Improving Surfactin Production in Bacillus subtilis 168 by Metabolic Engineering. Microorganisms 2024, 12, 998. https://doi.org/10.3390/microorganisms12050998

AMA Style

Guo Z, Sun J, Ma Q, Li M, Dou Y, Yang S, Gao X. Improving Surfactin Production in Bacillus subtilis 168 by Metabolic Engineering. Microorganisms. 2024; 12(5):998. https://doi.org/10.3390/microorganisms12050998

Chicago/Turabian Style

Guo, Zihao, Jiuyu Sun, Qinyuan Ma, Mengqi Li, Yamin Dou, Shaomei Yang, and Xiuzhen Gao. 2024. "Improving Surfactin Production in Bacillus subtilis 168 by Metabolic Engineering" Microorganisms 12, no. 5: 998. https://doi.org/10.3390/microorganisms12050998

APA Style

Guo, Z., Sun, J., Ma, Q., Li, M., Dou, Y., Yang, S., & Gao, X. (2024). Improving Surfactin Production in Bacillus subtilis 168 by Metabolic Engineering. Microorganisms, 12(5), 998. https://doi.org/10.3390/microorganisms12050998

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop