The Bile Acid Metabolism of Intestinal Microorganisms Mediates the Effect of Different Protein Sources on Muscle Protein Deposition in Procambarus clarkii
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethics Statement and Experimental Design
2.2. Crayfish Feeding, Growth Assay and Sampling
2.3. Muscle Quality Analysis
2.4. Morphological Analysis of Muscle Tissue
2.5. Determination of Muscle Molecular Indicators
2.6. 16S rDNA Sequencing and Metabolomics Analysis of Chyme
2.7. In Vitro Anaerobic Fermentation of Chyme and BAs File Analysis
2.8. Statistical Analysis
3. Results
3.1. Growth Performance and Proximate Analysis of Muscle
3.2. Amino Acid Composition in the Muscle
3.3. Muscle Histological Morphology
3.4. Muscle Texture Analysis
3.5. Muscle Development Related Genes Expression
3.6. 16S rDNA Analysis and Metabolites Profile of the Intestinal Chyme
3.7. Correlation Analysis
3.8. Bile Acid Profile Quantity of In Vitro Intestinal Anaerobic Fermentation Broth
4. Discussion
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bureau of Fisheries and Administration, Ministry of Agriculture and Rural Affairs of the People’s Republic of China. China Fishery Statistical Yearbook; China Agriculture Press: Beijing, China, 2024. [Google Scholar]
- Mente, E.; Coutteau, P.; Houlihan, D.; Davidson, I.; Sorgeloos, P. Protein turnover, amino acid profile and amino acid flux in juvenile shrimp Litopenaeus vannamei: Effects of dietary protein source. J. Exp. Biol. 2002, 205, 3107–3122. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.K.; Mitra, A.; Rahimnejad, S.; Chi, S.Y.; Kumar, V.; Tan, B.P.; Niu, J.; Xie, S.W. Retrospect of fish meal substitution in Pacific white shrimp (Litopenaeus vannamei) feed: Alternatives, limitations and future prospects. Rev. Aquac. 2024, 16, 382–409. [Google Scholar] [CrossRef]
- Qian, Y.F.; Limbu, S.M.; Qiao, F.; Luo, Y.; Chen, L.Q.; Zhang, M.L.; Du, Z.Y. Seeking the best alternatives: A systematic review and meta-analysis on replacing fishmeal with plant protein sources in carnivorous fish species. Rev. Aquac. 2024, 16, 1099–1126. [Google Scholar] [CrossRef]
- Li, X.; Wang, S.D.; Zhang, M.Z.; Jiang, H.B.; Qian, Y.X.; Wang, R.X.; Li, M. Comprehensive analysis of metabolomics on flesh quality of yellow catfish (Pelteobagrus fulvidraco) fed plant-based protein diet. Front. Nutr. 2023, 10, 1166393. [Google Scholar] [CrossRef]
- Zhang, H.J.; Dai, J.H.; Cai, M.L.; Cheng, K.M.; Hu, Y.; Luo, Z. Effects of dietary replacement of fishmeal by cottonseed meal on the growth performance, immune and antioxidant responses, and muscle quality of juvenile crayfish Procambarus clarkii. Aquac. Rep. 2023, 31, 101639. [Google Scholar] [CrossRef]
- Delzenne, N.M.; Cani, P.D. Interaction Between Obesity and the Gut Microbiota: Relevance in Nutrition. Annu. Rev. Nutr. 2011, 31, 15–31. [Google Scholar] [CrossRef]
- Bindels, L.B.; Delzenne, N.M. Muscle wasting: The gut microbiota as a new therapeutic target? Int. J. Biochem. Cell Biol. 2013, 45, 2186–2190. [Google Scholar] [CrossRef]
- Lahiri, S.; Kim, H.; Garcia-Perez, I.; Reza, M.M.; Martin, K.A.; Kundu, P.; Cox, L.M.; Selkrig, J.; Posma, J.M.; Zhang, H.B.; et al. The gut microbiota influences skeletal muscle mass and function in mice. Sci. Transl. Med. 2019, 11, eaan5662. [Google Scholar] [CrossRef]
- Mo, X.X.; Shen, L.H.; Cheng, R.J.; Wang, P.; Wen, L.; Sun, Y.H.; Wang, Q.; Chen, J.; Lin, S.; Liao, Y.X.; et al. Faecal microbiota transplantation from young rats attenuates age-related sarcopenia revealed by multiomics analysis. J. Cachexia Sarcopenia Muscle 2023, 14, 2168–2183. [Google Scholar] [CrossRef]
- Yan, H.L.; Yu, B.; Degroote, J.; Spranghers, T.; Van Noten, N.; Majdeddin, M.; Van Poucke, M.; Peelman, L.; De Vrieze, J.; Boon, N.; et al. Antibiotic affects the gut microbiota composition and expression of genes related to lipid metabolism and myofiber types in skeletal muscle of piglets. BMC Vet. Res. 2020, 16, 392. [Google Scholar] [CrossRef]
- Dukes, A.; Davis, C.; El Refaey, M.; Upadhyay, S.; Mork, S.; Arounleut, P.; Johnson, M.H.; Hill, W.D.; Isales, C.M.; Hamrick, M.W.; et al. The aromatic amino acid tryptophan stimulates skeletal muscle IGF1/p70s6k/mTor signaling in vivo and the expression of myogenic genes in vitro. Nutrition 2015, 31, 1018–1024. [Google Scholar] [CrossRef] [PubMed]
- De Spiegeleer, A.; Elewaut, D.; Van Den Noortgate, N.; Janssens, Y.; Debunne, N.; Van Langenhove, S.; Govindarajan, S.; De Spiegeleer, B.; Wynendaele, E. Quorum sensing molecules as a novel microbial factor impacting muscle cells. Biochim. Biophys. Acta Mol. Basis Dis. 2020, 1866, 165646. [Google Scholar] [CrossRef] [PubMed]
- Liu, R.X.; Hong, J.; Xu, X.Q.; Feng, Q.; Zhang, D.Y.; Gu, Y.Y.; Shi, J.; Zhao, S.Q.; Liu, W.; Wang, X.K.; et al. Gut microbiome and serum metabolome alterations in obesity and after weight-loss intervention. Nat. Med. 2017, 23, 859–868. [Google Scholar] [CrossRef]
- Aoi, W.; Inoue, R.; Mizushima, K.; Honda, A.; Björnholm, M.; Takagi, T.; Naito, Y. Exercise-acclimated microbiota improves skeletal muscle metabolism via circulating bile acid deconjugation. iScience 2023, 26, 106251. [Google Scholar] [CrossRef]
- Lv, W.Q.; Lin, X.; Shen, H.; Liu, H.M.; Qiu, X.; Li, B.Y.; Shen, W.D.; Ge, C.L.; Lv, F.Y.; Shen, J.; et al. Human gut microbiome impacts skeletal muscle mass via gut microbial synthesis of the short-chain fatty acid butyrate among healthy menopausal women. J. Cachexia Sarcopenia Muscle 2021, 12, 1860–1870. [Google Scholar] [CrossRef]
- Wu, J.Y.; Feng, L.; Wu, P.; Liu, Y.; Ren, H.M.; Jin, X.W.; Jiang, J.; Kuang, S.Y.; Li, S.W.; Tang, L.; et al. Modification of beneficial fatty acid composition and physicochemical qualities in the muscle of sub-adult grass carp (Ctenopharyngodon idella): The role of lipids. Aquaculture 2022, 561, 738656. [Google Scholar] [CrossRef]
- AOAC. Official Methods of Analysis of the Association of Official Analytical Chemists, 20th ed.; AOAC Inc.: Washington, DC, USA, 2016. [Google Scholar]
- Horwitz, W.; AOAC International (Eds.) Official Methods of Analysis of AOAC International, 18th ed.; Current through Rev. 1; AOAC International: Gaithersburg, MD, USA, 2006. [Google Scholar]
- Zheng, X.C.; Liu, W.B.; Liu, J.D.; Zhang, C.Y.; Zhang, L.; Gao, F.; Zhang, D.D.; Chi, C. Dietary Supplementation With Icariin Affects Estrogen Synthesis, Vitellogenesis, and Oocyte Development in the Chinese Mitten Crab, Eriocheir sinensis. Front. Mar. Sci. 2020, 7, 161. [Google Scholar] [CrossRef]
- Wen, C.; Ma, S.; Tian, H.Y.; Jiang, W.B.; Jia, X.Y.; Zhang, W.X.; Jiang, G.Z.; Li, X.F.; Chi, C.; He, C.F.; et al. Evaluation of the protein-sparing effects of carbohydrates in the diet of the crayfish, Procambarus clarkii. Aquaculture 2022, 556, 738275. [Google Scholar] [CrossRef]
- Cai, M.L.; Zhang, Y.; Zhu, J.Q.; Li, H.H.; Tian, H.Y.; Chu, W.Y.; Hu, Y.; Liu, B.; Wang, A.M. Intervention of re-feeding on growth performance, fatty acid composition and oxidative stress in the muscle of red swamp crayfish (Procambarus clarkii) subjected to short-term starvation. Aquaculture 2021, 545, 737110. [Google Scholar] [CrossRef]
- Yang, H.J.; Mo, A.J.; Yi, L.Y.; Wang, J.H.; He, X.G.; Yuan, Y.C. Selenium attenuated food borne cadmium-induced intestinal inflammation in red swamp crayfish (Procambarus clarkii) via regulating PI3K/Akt/NF-κB pathway. Chemosphere 2024, 349, 140814. [Google Scholar] [CrossRef]
- Zhu, M.R.; Zhan, M.; Xi, C.J.; Gong, J.; Shen, H.S. Molecular characterization and expression of the autophagy-related gene Atg14 in WSSV-infected Procambarus clarkii. Fish Shellfish. Immunol. 2022, 125, 200–211. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Du, H.; Liu, T.; Chen, C.; Yan, Y.; Liu, T.Q.; Liu, L.; Wang, E.L. Accurate reflection of hepatopancreas antioxidation and detoxification in Procambarus clarkii during virus infection and drug treatment: Reference gene selection, evaluation and expression analysis. Aquaculture 2022, 556, 738283. [Google Scholar] [CrossRef]
- Zheng, X.C.; Xu, X.D.; Liu, M.Y.; Yang, J.; Yuan, M.; Sun, C.X.; Zhou, Q.L.; Chen, J.M.; Liu, B. Bile acid and short chain fatty acid metabolism of gut microbiota mediate high-fat diet induced intestinal barrier damage in Macrobrachium rosenbergii. Fish Shellfish. Immunol. 2024, 146, 109376. [Google Scholar] [CrossRef]
- Zheng, X.C.; Liu, B.; Wang, N.; Yang, J.; Zhou, Q.L.; Sun, C.X.; Zhao, Y.F. Low fish meal diet supplemented with probiotics ameliorates intestinal barrier and immunological function of Macrobrachium rosenbergii via the targeted modulation of gut microbes and derived secondary metabolites. Front. Immunol. 2022, 13, 1074399. [Google Scholar] [CrossRef]
- De la Higuera, M.; Akharbach, H.; Hidalgo, M.C.; Peragón, J.; Lupiáñez, J.A.; García-Gallego, M. Liver and white muscle protein turnover rates in the European eel (Anguilla anguilla): Effects of dietary protein quality. Aquaculture 1999, 179, 203–216. [Google Scholar] [CrossRef]
- Ibrahim, R.E.; Tolba, S.A.; Younis, E.M.; Abdel-Warith, A.W.A.; Shalaby, S.I.; Osman, A.; Khamis, T.; Eissa, M.A.; Davies, S.J.; Amer, S.A. Kidney bean protein hydrolysate as a fish meal replacer: Effects on growth, digestive enzymes, metabolic functions, immune-antioxidant parameters and their related gene expression, intestinal and muscular gene expression. Aquaculture 2023, 575, 739803. [Google Scholar] [CrossRef]
- Olsen, R.E.; Hansen, A.C.; Rosenlund, G.; Hemre, G.I.; Mayhew, T.M.; Knudsen, D.L.; Eroldogan, O.T.; Myklebust, R.; Karlsen, O. Total replacement of fish meal with plant proteins in diets for Atlantic cod (Gadus morhua L.) II-Health aspects. Aquaculture 2007, 272, 612–624. [Google Scholar] [CrossRef]
- Espe, M.; Lemme, A.; Petri, A.; El-Mowafi, A. Assessment of lysine requirement for maximal protein accretion in Atlantic salmon using plant protein diets. Aquaculture 2007, 263, 168–178. [Google Scholar] [CrossRef]
- Yang, H.; Rahman, M.M.; Li, X.; Sharifuzzaman, S.M.; Leng, X. Dietary leucine requirement of juvenile largemouth bass (Micropterus salmoides) based on growth, nutrient utilization and growth-related gene analyses. Aquaculture 2022, 555, 738207. [Google Scholar] [CrossRef]
- Ji, K.; Liang, H.L.; Ge, X.P.; Ren, M.C.; Pan, L.K.; Huang, D.Y. Optimal methionine supplementation improved the growth, hepatic protein synthesis and lipolysis of grass carp fry (Ctenopharyngodon idella). Aquaculture 2022, 554, 738125. [Google Scholar] [CrossRef]
- Zhang, K.K.; Mai, K.S.; Xu, W.; Zhou, H.H.; Liufu, Z.G.; Zhang, Y.J.; Peng, M.; Ai, Q.H. Proline with or without hydroxyproline influences collagen concentration and regulates prolyl 4-hydroxylase α (I) gene expression in juvenile turbo (Scophthalmus maximus L.). J. Ocean Univ. China 2015, 14, 541–548. [Google Scholar] [CrossRef]
- Dong, M.; Zhang, L.; Wu, P.; Feng, L.; Jiang, W.D.; Liu, Y.; Kuang, S.Y.; Li, S.W.; Mi, H.F.; Tang, L.; et al. Dietary protein levels changed the hardness of muscle by acting on muscle fiber growth and the metabolism of collagen in sub-adult grass carp (Ctenopharyngodon idella). J. Anim. Sci. Biotechnol. 2022, 13, 109. [Google Scholar] [CrossRef] [PubMed]
- Johnston, I.A.; Alderson, R.; Sandham, C.; Dingwall, A.; Mitchell, D.; Selkirk, C.; Nickell, D.; Baker, R.; Robertson, B.; Whyte, D.; et al. Muscle fibre density in relation to the colour and texture of smoked Atlantic salmon (Salmo salar L). Aquaculture 2000, 189, 335–349. [Google Scholar] [CrossRef]
- Chen, L.; Shi, Y.H.; Li, J.B.; Shao, C.M.; Ma, S.; Shen, C.; Zhao, R.Q. Dietary bile acids improve breast muscle growth in chickens through FXR/IGF2 pathway. Poult. Sci. 2024, 103, 103346. [Google Scholar] [CrossRef]
- Fan, Z.; Li, C.H.; Wu, D.; Li, J.N.; Wang, L.S.; Cao, D.C.; Miao, L.H.; Xie, S.Q. Evaluation of four novel protein sources as alternatives to soybean meal for two specifications of cage-farmed grass carp (Ctenopharyngodon idellus) deeds: Effect on growth performance, flesh quality, and expressions of muscle-related genes. Front. Mar. Sci. 2022, 9, 935651. [Google Scholar] [CrossRef]
- Yoon, M.S. mTOR as a Key Regulator in Maintaining Skeletal Muscle Mass. Front. Physiol. 2017, 8, 788. [Google Scholar] [CrossRef]
- Chen, C.L.; Qin, H.Y.; Tan, J.Q.; Hu, Z.P.; Zeng, L.W. The Role of Ubiquitin-Proteasome Pathway and Autophagy-Lysosome Pathway in Cerebral Ischemia. Oxidative Med. Cell. Longev. 2020, 2020, 5457049. [Google Scholar] [CrossRef]
- Milan, G.; Romanello, V.; Pescatore, F.; Armani, A.; Paik, J.H.; Frasson, L.; Seydel, A.; Zhao, J.H.; Abraham, R.; Goldberg, A.L.; et al. Regulation of autophagy and the ubiquitin–proteasome system by the FoxO transcriptional network during muscle atrophy. Nat. Commun. 2015, 6, 6670. [Google Scholar] [CrossRef]
- Elkina, Y.; Von Haehling, S.; Anker, S.D.; Springer, J. The role of myostatin in muscle wasting: An overview. J. Cachexia Sarcopenia Muscle 2011, 2, 143–151. [Google Scholar] [CrossRef]
- Rodriguez, J.; Vernus, B.; Chelh, I.; Cassar-Malek, I.; Gabillard, J.C.; Sassi, A.H.; Seiliez, I.; Picard, B.; Bonnieu, A. Myostatin and the skeletal muscle atrophy and hypertrophy signaling pathways. Cell. Mol. Life Sci. 2014, 71, 4361–4371. [Google Scholar] [CrossRef]
- Kong, J.; Yan, Y.J.; Lu, X.; Luan, S.; Meng, X.H.; Dai, P.; Chen, B.L.; Cao, B.X.; Qian, G.F.; Luo, K. Integrative phenotypic and gene expression data identify myostatin as a muscle growth inhibitor in Chinese shrimp Fenneropenaeus chinensis. Sci. Rep. 2020, 10, 5985. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.J.; Li, J.T.; Ge, Q.Q.; Li, J. A potential negative regulation of myostatin in muscle growth during the intermolt stage in Exopalaemon carinicauda. Gen. Comp. Endocrinol. 2021, 314, 113902. [Google Scholar] [CrossRef] [PubMed]
- Easwvaran, S.P.; Bhassu, S.; Maningas, M.B.B.; Othman, R.Y. Enhanced muscle regeneration in freshwater prawn Macrobrachium rosenbergii achieved through in vivo silencing of the myostatin gene. J. World Aquac. Soc. 2019, 50, 1026–1039. [Google Scholar] [CrossRef]
- Shen, W.Y.; Ren, G.; Zhu, Y.R.; Zhang, X.D. Characterization of MSTN/GDF11 gene from shrimp Macrobrachium nipponense and its expression profiles during molt cycle and after eyestalk ablation. Genes Genom. 2015, 37, 441–489. [Google Scholar] [CrossRef]
- Liu, C.R.; Cheung, W.H.; Li, J.; Chow, S.K.H.; Yu, J.; Wong, S.H.; Ip, M.; Sung, J.J.Y.; Wong, R.M.Y. Understanding the gut microbiota and sarcopenia: A systematic review. J. Cachexia Sarcopenia Muscle 2021, 12, 1393–1407. [Google Scholar] [CrossRef]
- Li, P.L.; Feng, J.L.; Jiang, H.F.; Feng, X.H.; Yang, J.P.; Yuan, Y.X.; Ma, Z.W.; Xu, G.L.; Xu, C.; Zhu, C.J.; et al. Microbiota derived d-malate inhibits skeletal muscle growth and angiogenesis during aging via acetylation of Cyclin A. EMBO Rep. 2024, 25, 524–543. [Google Scholar] [CrossRef]
- Li, P.L.; Feng, X.H.; Ma, Z.W.; Yuan, Y.X.; Jiang, H.F.; Xu, G.L.; Zhu, Y.L.; Yang, X.; Wang, Y.J.; Zhu, C.J.; et al. Microbiota-derived 3-phenylpropionic acid promotes myotube hypertrophy by Foxo3/NAD+ signaling pathway. Cell Biosci. 2024, 14, 62. [Google Scholar] [CrossRef]
- He, Z.L.; Wang, T.H.; Zhang, S.C.; ShiM, K.J.; Wang, F.; Li, Y.Z.; Lin, C.Q.; Chen, J.G. Evaluation of cholesterol transformation abilities and probiotic properties of Bacteroides dorei YGMCC0564. Front. Microbiol. 2023, 14, 1279996. [Google Scholar] [CrossRef]
- Li, L.; Liu, C.; Mao, W.; Tumen, B.; Li, P.F. Taurochenodeoxycholic Acid Inhibited AP-1 Activation via Stimulating Glucocorticoid Receptor. Molecules 2019, 24, 4513. [Google Scholar] [CrossRef]
- Qi, Y.C.; Duan, G.Z.; Mao, W.; Liu, Q.; Zhang, Y.L.; Li, P.F. Taurochenodeoxycholic acid mediates cAMP-PKA-CREB signaling pathway. Chin. J. Nat. Med. 2020, 18, 898–906. [Google Scholar] [CrossRef]
- Qiu, Y.X.; Yu, J.M.; Li, Y.; Yang, F.; Yu, H.Y.; Xue, M.J.; Zhang, F.; Jiang, X.; Ji, X.Y.; Bao, Z.J.; et al. Depletion of gut microbiota induces skeletal muscle atrophy by FXR-FGF15/19 signalling. Ann. Med. 2021, 53, 508–522. [Google Scholar] [CrossRef] [PubMed]
- Abrigo, J.; Gonzalez, F.; Aguirre, F.; Tacchi, F.; Gonzalez, A.; Meza, M.P.; Simon, F.; Cabrera, D.; Arrese, M.; Karpen, S.; et al. Cholic acid and deoxycholic acid induce skeletal muscle atrophy through a mechanism dependent on TGR5 receptor. J. Cell. Physiol. 2021, 236, 260–272. [Google Scholar] [CrossRef] [PubMed]
- Orozco-Aguilar, J.; Tacchi, F.; Aguirre, F.; Valero-Breton, M.; Castro-Sepulveda, M.; Simon, F.; Cabello-Verrugio, C. Ursodeoxycholic acid induces sarcopenia associated with decreased protein synthesis and autophagic flux. Biol. Res. 2023, 56, 28. [Google Scholar] [CrossRef] [PubMed]
- Sun, L.J.; Li, F.; Tan, W.H.; Zhao, W.J.; Li, Y.X.; Zhu, X.T.; Gao, P.; Shu, G.; Wang, S.B.; Jiang, Q.Y.; et al. Lithocholic acid promotes skeletal muscle regeneration through the TGR5 receptor. Acta Biochim. Biophys. Sin. 2023, 55, 51–61. [Google Scholar] [CrossRef] [PubMed]
AP | PP | |
---|---|---|
Components (% dry matter) | ||
Fish meal | 17.0 | 0.0 |
Chicken meal | 15.0 | 0.0 |
Hydrolyzed feather meal | 3.0 | 0.0 |
Pork powder | 3.0 | 0.0 |
Spray-dried blood cell powder | 5.0 | 0.0 |
Shrimp meal | 5.0 | 0.0 |
Soybean meal | 0.0 | 25.0 |
Rapeseed meal | 0.0 | 18.0 |
Rice protein concentrate | 0.0 | 8.0 |
Soybean protein concentrate | 0.0 | 5.0 |
Peanut meal | 0.0 | 5.0 |
DDGS | 0.0 | 3.0 |
Rice bran | 4.0 | 4.0 |
Salt | 0.3 | 0.3 |
Starch | 36.99 | 18.79 |
Soybean oil | 0.8 | 3.0 |
Squid paste | 3.0 | 3.0 |
Ecdysone (2%) | 0.01 | 0.01 |
Vitamin premix a | 1.0 | 1.0 |
Mineral premix a | 1.0 | 1.0 |
Choline chloride (50%) | 0.5 | 0.5 |
Calcium dihydrogen phosphate | 2.0 | 2.0 |
Carboxymethyl cellulose | 0.5 | 0.5 |
Bicarbonate | 1.5 | 1.5 |
Microcrystalline methionine | 0.4 | 0.4 |
Total | 100.0 | 100.0 |
Proximate analysis (%) | ||
DM | 83.49 | 83.27 |
CP | 33.29 | 33.21 |
EE | 5.91 | 6.08 |
Gross energy (MJ/kg) | 16.69 | 16.09 |
Gene | Forward (5′-3′) | Reverse (5′-3′) | PL (bp) | Reference |
---|---|---|---|---|
House keeping gene | ||||
EIF | GGAATAAGGGGACGAAGACC | GCAAACACACGCTGGGAT | 126 | [21] |
Protein synthesis signaling molecules | ||||
TOR | GAAGGCATGCTGCGGTATTG | CGCAGGCTTTGGGTCTCTTA | 122 | [21] |
S6K | ACAGCCGAGAATCGCAAGAA | ATCACCATTATCGGGTCCGC | 153 | [21] |
4E-BP1 | ACCTGCCAGTGATACCAGGA | TGGCTCCTCTGAAATCGTTCC | 80 | [21] |
AKT | CCTTGGGGCGTCTACTCCTA | TCCTCATAATCCTCACTTTCCT | 176 | database |
Muscle regulatory factors | ||||
MyHC | AAGCCAACCGTACCCTCAA | AGTAGCACGTTCTCTGCATTCA | 174 | database |
MLC1 | TGAGAAGGTCGGAGGCAAG | TGCCATTCTCAGATTTGTCGT | 155 | [22] |
MEF2A | CATCTTCCAACCATCCTGGG | GTTTGCTCAACGGGGTATCA | 125 | [22] |
MEF2B | ACCAGCACCACCTTCACATT | GAAGATGGACCCAAATGTGAA | 133 | [22] |
MSTN | AGCAACAGCAACAACAAGGA | GCAGGAAGGGACATTTACCG | 136 | [22] |
Autophagy related factors | ||||
FOXO | ACGCGCTAACACCATGGAAG | GACTCTCACTCAGCGACGAA | 158 | [23] |
LC3 | TGAGTAGTCCGTCTCGGTGT | CCATGTAGAGGAACCCGTCG | 169 | [24] |
ATG2 | GTACTTCCCGTGGTCGGATG | CCATCCACGAACCTGAGAGG | 175 | [24] |
ATG3 | GCCAAGACAACCACCATAGC | AGAGCCGAGGTGTCTGGTAG | 201 | database |
ATG9 | TCATACATCCAGGGTTCGCC | GGGCAAAGGAACAAACGTCC | 189 | database |
ATG12 | TGGAGGGGAAGGACTTACGG | AGCTTTCCCTTAGCAGTCTTC | 203 | [24] |
ATG16 | AGATGGATGGCACAGAAGGC | GTTCACTTGCTTGGGCTCAC | 178 | database |
ATG18 | CGTGTTGTAGTGGAGGAGCA | CGTGGCTGCTTTTGAATCGT | 194 | database |
Ubiquitination related factors | ||||
ub | TCCAGCCTCTCCTGCCTT | CCTTCCTTATCCTGAATCTTTGCC | 172 | [25] |
Psma1 | CTTTACCTCATTGACCCATCT | CACAACCATAGTATCCATTACACAT | 149 | database |
psmd1 | ACTCATACAGCAAACAGAATCC | CGTCCACCAGCATCAATAA | 147 | database |
psmd6 | AGCTTTTGCTAAAACCTACG | TCCCAATCTCCTCCCTCT | 159 | database |
Psmc1 | TGTCTCCATTCTCTCCTTTGT | TTGAGGTGCCTTCTCTAGCT | 148 | database |
Indicators | AP | PP | p-Value |
---|---|---|---|
IW (g) | 4.93 ± 0.014 | 4.92 ± 0.028 | 0.833 |
FW (g) | 30.84 ± 0.295 | 34.88 ± 1.389 | 0.059 |
WGR (%) | 525.91 ± 7.130 | 609.23 ± 30.671 | 0.069 |
SGR (%/day) | 3.53 ± 0.022 | 3.77 ± 0.084 | 0.064 |
SR (%) | 89.17 ± 2.52 | 90.04 ± 2.00 | 0.766 |
FI (g) | 22.57 ± 0.932 | 22.26 ± 0.832 | 0.807 |
FCR | 0.87 ± 0.026 | 0.74 ± 0.025 | 0.011 |
HSI (%) | 7.32 ± 0.236 | 6.74 ± 0.213 | 0.071 |
Meat rate (%) | 10.13 ± 0.434 | 11.62 ± 0.905 | 0.098 |
Proximate analysis of muscle (%) | |||
Moisture content | 76.16 ± 0.302 | 75.37 ± 0.314 | 0.065 |
Crude protein | 18.09 ± 0.217 | 19.10 ± 0.303 | 0.030 |
Ether extract | 7.06 ± 0.905 | 7.01 ± 1.204 | 0.928 |
Ash | 2.08 ± 0.203 | 2.09 ± 0.301 | 0.978 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, X.; Zheng, X.; Zhou, Q.; Sun, C.; Wang, A.; Zhu, A.; Zhang, Y.; Liu, B. The Bile Acid Metabolism of Intestinal Microorganisms Mediates the Effect of Different Protein Sources on Muscle Protein Deposition in Procambarus clarkii. Microorganisms 2025, 13, 11. https://doi.org/10.3390/microorganisms13010011
Xu X, Zheng X, Zhou Q, Sun C, Wang A, Zhu A, Zhang Y, Liu B. The Bile Acid Metabolism of Intestinal Microorganisms Mediates the Effect of Different Protein Sources on Muscle Protein Deposition in Procambarus clarkii. Microorganisms. 2025; 13(1):11. https://doi.org/10.3390/microorganisms13010011
Chicago/Turabian StyleXu, Xiaodi, Xiaochuan Zheng, Qunlan Zhou, Cunxin Sun, Aimin Wang, Aimin Zhu, Yuanyuan Zhang, and Bo Liu. 2025. "The Bile Acid Metabolism of Intestinal Microorganisms Mediates the Effect of Different Protein Sources on Muscle Protein Deposition in Procambarus clarkii" Microorganisms 13, no. 1: 11. https://doi.org/10.3390/microorganisms13010011
APA StyleXu, X., Zheng, X., Zhou, Q., Sun, C., Wang, A., Zhu, A., Zhang, Y., & Liu, B. (2025). The Bile Acid Metabolism of Intestinal Microorganisms Mediates the Effect of Different Protein Sources on Muscle Protein Deposition in Procambarus clarkii. Microorganisms, 13(1), 11. https://doi.org/10.3390/microorganisms13010011