Microbiological and Molecular Diagnosis of Mucormycosis: From Old to New
Abstract
:1. Introduction
2. Histological and Microscopic Diagnosis
3. Microbiological Diagnosis
4. DNA-Based Diagnosis
4.1. DNA Extractability and Biological Specifics of Mucorales
4.2. PCR-Based Methods
4.3. Genus- to Species-Specific PCR Assays
4.4. Mucorales-Specific PCR Assays
4.5. Pan-Fungal PCR Assays
4.6. Target Genes and Sequence Databases
4.7. Potential and Limitations of Molecular Diagnostic Tools
Assay | Ev. in | Samples | Pos. Control Group | Neg. Control Group | Sensitivity | Specificity | Calculated on | Detected Taxa |
---|---|---|---|---|---|---|---|---|
Semi-nested PCR + sequencing (Bialek 2005) | [11] | FF-PET (n = 52) | MM (histopathology diagnosis) | aspergillosis (histopathology diagnosis) | 59% | 100% | samples = patients | Rp. spp., M. sp., Rm spp., L. sp. |
[58] | fresh tissue (n = 9) | proven MM (EORTC/MSG criteria) | ng | 100% | ng | samples = patients | Rp. spp. | |
FF-PET (n = 18) | 56% | Rp. spp. | ||||||
[12] | FF-PET (n = 21) | MM (histopathology diagnosis) | aspergillosis/cryptococcosis/candiasis (histopathology diagnosis) | 100% | 100% | samples = patients | Rp. sp., Rm. spp., C. spp., L. sp. | |
[59] | FF-PET (n = 27) | proven MM (EORTC/MSG criteria) | ng | 81% | ng | samples = patients | Rp. spp., M. spp., C. spp., Rm. spp., and L. spp. | |
[60] | FF-PET (n = 30 from 20 patients) | MM (histopathology diagnosis) | aspergillosis (histopathology diagnosis) | 68% | 100% | samples | no sequencing | |
[61] | fresh tissue (n = 28) | MM (histopathology diagnosis) | ng | 86% | ng | samples = patients | no sequencing | |
serum (n = 28) | 0% | |||||||
[62] | fresh tissue (n = 56) | MM (histopathology diagnosis) | aspergillosis (histopathology diagnosis) | 100% | 100% | samples = patients | Rp. sp., Rm. spp., L. sp. | |
[63] | serum (n = 62 from 31 patients) | MM diagnosis | no MM diagnosis | 0% | 100% | samples | na | |
[32] | tissue samples (rhino-orbito-cerebral) (n = 50) | diagnosed rhino-orbito-cerebral-MM | ng | 100% | ng | samples = patients | Rp. spp., Ap. sp. | |
qPCR +sequencing of 18S amplicon (Springer 2016a) | [27] | culture isolates (n = 28) | Ap. spp., Cokeromyces sp., C. spp., M. spp., Rm. sp., Rp. spp., Saksenaea sp., S. sp. | other clinically relevant fungi | 100% | 18S + 28S assay | na | |
fresh (n = 3 from 3 patients) and FF-PET (n = 14 from 11 patients) | proven invasive MM | proven non-Mucorales IFD | 90% | 88% | 18S + 28S assay | Rm. spp., L. spp., Rp. spp. | ||
[64] | FF-PET (n = 16 from 15 patients) | proven invasive MM (EORTC/MSG criteria) | patients without signs or symptoms typical for IFD | 91% | 100% | patients | Rm. spp., L. spp., Rp. spp. | |
83% | 100% | samples | ||||||
qPCR +sequencing of 18S amplicon (Springer 2016a) ff | serum (n = 52 of 5 patients) | Proven/probable invasive MM (EORTC/MSG criteria) | ng | 100% | ng | patients | Rm. spp., L. spp., Rp. spp., M. spp., Am. sp. | |
25% | ng | samples | ||||||
[49] | FF-PET (n = 46) | MM (histopathology or broad range 18S PCR/sequencing diagnosis) (n = 2) | No MM (histopathology or broad range 18S PCR/sequencing diagnosis) | 100% | 93% | samples | Rp. spp. | |
[65] | BAL (n = 99 from 96 patients) | proven/probable invasive fungal infection (MM: n = 6) | no invasive fungal infection | 68% | 93% | samples (supernatant + pellet) | no sequencing | |
qPCR (MucorGenius®, PathoNostics) | [66] | pulmonary samples *1 (n = 319 patients) | proven/probable MM (EORTC/MSG criteria) (n = 10) | proven/probable aspergillosis (EORTC/MSG criteria) (n = 63) | 90% | 98% | samples = patients | ng |
[39] | blood samples *2 (n = 106 from 16 patients) | proven/probable MM (EORTC/MSG criteria) (n = 10) | ng | 75% | ng | patients | ng | |
44% | ng | samples (D-20 to D75) | ng | |||||
[19] | spiked serum (n = 28 samples in 4 labs) | spiked serum | not-spiked serum | 84% | 100% | samples | ng | |
qPCR (EPA/Bellanger 2018) | [67] | culture isolates (n = 19) | L. spp., Rp. spp., M. spp., Rm. spp. | other clinically relevant fungi | na | 100% | isolates | na |
frozen serum (n = 51 from 10 patients) | proven MM | healthy/hematological malignancy/aspergillosis/pneumocystis infection | 90% | 100% | patients | L., Rm., M./Rp. | ||
51% | 100% | samples (D-68 to D29 from time of diagnosis) | ||||||
[13] | frozen serum (n = 194 from 44 patients) | proven MM (EORTC/MSG criteria) | ng | 88% | ng | patients | L., Rm., M./Rp. | |
81% | ng | samples (D-32 to D17 from time of diagnosis) | ||||||
[66] | pulmonary samples *1 (n = 319 patients) | proven/probable MM (EORTC/MSG criteria) (n = 10) | proven/probable aspergillosis according to EORTC/MSG criteria (n = 63) | 100% | 96% | samples = patients | L., Rm., M./Rp., C. | |
[68] | BAL (n = 450 from 374 patients) | proven/probable MM (EORTC/MSG criteria) | other or no fungal infections | 100% | 97% | patients | L., Rm., M./Rp. | |
[42] | plasma (n = 418 from 77 patients) | proven/probable invasive wound MM (EORTC/MSG criteria) | ng | 100% | ng | patients (earlier than standard diagnosis) | L., M./Rp. | |
[19] | spiked serum (n = 112 samples in 16 labs) | spiked serum | not-spiked serum | 90% | 97% | samples | L., Rm. |
4.8. Future Perspectives and Outlook
Author Contributions
Funding
Conflicts of Interest
References
- Lackner, M.; Caramalho, R.; Lass-Flörl, C. Laboratory diagnosis of mucormycosis: Current status and future perspectives. Future Microbiol. 2014, 9, 683–695. [Google Scholar] [CrossRef]
- Skiada, A.; Lass-Floerl, C.; Klimko, N.; Ibrahim, A.; Roilides, E.; Petrikkos, G. Challenges in the diagnosis and treatment of mucormycosis. Med. Mycol. 2018, 56, 93–101. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jenks, J.D.; Gangneux, J.-P.; Schwartz, I.S.; Alastruey-Izquierdo, A.; Lagrou, K.; Thompson Iii, G.R.; Lass-Flörl, C.; Hoenigl, M. Diagnosis of Breakthrough Fungal Infections in the Clinical Mycology Laboratory: An ECMM Consensus Statement. J. Fungi 2020, 6. [Google Scholar] [CrossRef]
- Cornely, O.A.; Alastruey-Izquierdo, A.; Arenz, D.; Chen, S.C.A.; Dannaoui, E.; Hochhegger, B.; Hoenigl, M.; Jensen, H.E.; Lagrou, K.; Lewis, R.E.; et al. Global guideline for the diagnosis and management of mucormycosis: An initiative of the European Confederation of Medical Mycology in cooperation with the Mycoses Study Group Education and Research Consortium. Lancet Infect. Dis. 2019, 19, e405–e421. [Google Scholar] [CrossRef]
- Lass-Flörl, C.; Samardzic, E.; Knoll, M. Serology anno 2021-fungal infections: From invasive to chronic. Clin. Microbiol. Infect. 2021. [Google Scholar] [CrossRef] [PubMed]
- Schwarz, P.; Guedouar, H.; Laouiti, F.; Grenouillet, F.; Dannaoui, E. Identification of Mucorales by Matrix-Assisted Laser Desorption Ionization Time-of-Flight Mass Spectrometry. J. Fungi 2019, 5. [Google Scholar] [CrossRef] [Green Version]
- Shao, J.; Wan, Z.; Li, R.; Yu, J. Species Identification and Delineation of Pathogenic Mucorales by Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry. J. Clin. Microbiol. 2018, 56. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zvezdanova, M.E.; Escribano, P.; Ruiz, A.; Martínez-Jiménez, M.C.; Peláez, T.; Collazos, A.; Guinea, J.; Bouza, E.; Rodríguez-Sánchez, B. Increased species-assignment of filamentous fungi using MALDI-TOF MS coupled with a simplified sample processing and an in-house library. Med. Mycol. 2019, 57, 63–70. [Google Scholar] [CrossRef] [PubMed]
- de Carolis, E.; Posteraro, B.; Lass-Flörl, C.; Vella, A.; Florio, A.R.; Torelli, R.; Girmenia, C.; Colozza, C.; Tortorano, A.M.; Sanguinetti, M.; et al. Species identification of Aspergillus, Fusarium and Mucorales with direct surface analysis by matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Clin. Microbiol. Infect. 2012, 18, 475–484. [Google Scholar] [CrossRef] [Green Version]
- Kontoyiannis, D.P.; Lewis, R.E. How I treat mucormycosis. Blood 2011, 118, 1216–1224. [Google Scholar] [CrossRef]
- Bialek, R.; Konrad, F.; Kern, J.; Aepinus, C.; Cecenas, L.; Gonzalez, G.M.; Just-Nübling, G.; Willinger, B.; Presterl, E.; Lass-Flörl, C.; et al. PCR based identification and discrimination of agents of mucormycosis and aspergillosis in paraffin wax embedded tissue. J. Clin. Pathol. 2005, 58, 1180–1184. [Google Scholar] [CrossRef]
- Rickerts, V.; Just-Nübling, G.; Konrad, F.; Kern, J.; Lambrecht, E.; Böhme, A.; Jacobi, V.; Bialek, R. Diagnosis of invasive aspergillosis and mucormycosis in immunocompromised patients by seminested PCR assay of tissue samples. Eur. J. Clin. Microbiol. Infect. Dis. 2006, 25, 8–13. [Google Scholar] [CrossRef]
- Millon, L.; Herbrecht, R.; Grenouillet, F.; Morio, F.; Alanio, A.; Letscher-Bru, V.; Cassaing, S.; Chouaki, T.; Kauffmann-Lacroix, C.; Poirier, P.; et al. Early diagnosis and monitoring of mucormycosis by detection of circulating DNA in serum: Retrospective analysis of 44 cases collected through the French Surveillance Network of Invasive Fungal Infections (RESSIF). Clin. Microbiol. Infect. 2016, 22, 810.e1–810.e8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Baldin, C.; Soliman, S.S.M.; Jeon, H.H.; Alkhazraji, S.; Gebremariam, T.; Gu, Y.; Bruno, V.M.; Cornely, O.A.; Leather, H.L.; Sugrue, M.W.; et al. PCR-Based Approach Targeting Mucorales-Specific Gene Family for Diagnosis of Mucormycosis. J. Clin. Microbiol. 2018, 56. [Google Scholar] [CrossRef] [Green Version]
- Ibrahim, A.S.; Spellberg, B.; Walsh, T.J.; Kontoyiannis, D.P. Pathogenesis of mucormycosis. Clin. Infect. Dis. 2012, 54 (Suppl. S1), S16–S22. [Google Scholar] [CrossRef] [PubMed]
- Bialek, R.; Zelck, U.E. PCR-Diagnostik von Mukormykosen aus Gewebeschnitten. Pathologe 2013, 34, 511–518. [Google Scholar] [CrossRef]
- Muñoz-Cadavid, C.; Rudd, S.; Zaki, S.R.; Patel, M.; Moser, S.A.; Brandt, M.E.; Gómez, B.L. Improving molecular detection of fungal DNA in formalin-fixed paraffin-embedded tissues: Comparison of five tissue DNA extraction methods using panfungal PCR. J. Clin. Microbiol. 2010, 48, 2147–2153. [Google Scholar] [CrossRef] [Green Version]
- Scharf, S.; Bartels, A.; Kondakci, M.; Pfeffer, K.; Henrich, B.; Haas, R. Introduction of a bead beating step improves fungal DNA extraction from selected patient specimens. Int. J. Med. Microbiol. 2020, 310, 151443. [Google Scholar] [CrossRef]
- Rocchi, S.; Scherer, E.; Mengoli, C.; Alanio, A.; Botterel, F.; Bougnoux, M.E.; Bretagne, S.; Cogliati, M.; Cornu, M.; Dalle, F.; et al. Interlaboratory evaluation of Mucorales PCR assays for testing serum specimens: A study by the fungal PCR Initiative and the Modimucor study group. Med. Mycol. 2021, 59, 126–138. [Google Scholar] [CrossRef]
- Shoji, J.-y.; Kikuma, T.; Arioka, M.; Kitamoto, K. Macroautophagy-mediated degradation of whole nuclei in the filamentous fungus Aspergillus oryzae. PLoS ONE 2010, 5, e15650. [Google Scholar] [CrossRef] [Green Version]
- Papandreou, M.-E.; Tavernarakis, N. Nucleophagy: From homeostasis to disease. Cell Death Differ. 2019, 26, 630–639. [Google Scholar] [CrossRef] [Green Version]
- Rickerts, V. Identifizierung von Pilzen in Gewebeschnitten mit Fluoreszenz-in-situ-Hybridisierung. Pathologe 2013, 34, 528–533. [Google Scholar] [CrossRef] [Green Version]
- Maicas, S.; Adam, A.C.; Polaina, J. The ribosomal DNA of the Zygomycete Mucor miehei. Curr. Genet. 2000, 37, 412–419. [Google Scholar] [CrossRef]
- Herrera, M.L.; Vallor, A.C.; Gelfond, J.A.; Patterson, T.F.; Wickes, B.L. Strain-dependent variation in 18S ribosomal DNA Copy numbers in Aspergillus fumigatus. J. Clin. Microbiol. 2009, 47, 1325–1332. [Google Scholar] [CrossRef] [Green Version]
- Rooney, A.P.; Ward, T.J. Evolution of a large ribosomal RNA multigene family in filamentous fungi: Birth and death of a concerted evolution paradigm. Proc. Natl. Acad. Sci. USA 2005, 102, 5084–5089. [Google Scholar] [CrossRef] [Green Version]
- Frickmann, H.; Loderstaedt, U.; Racz, P.; Tenner-Racz, K.; Eggert, P.; Haeupler, A.; Bialek, R.; Hagen, R.M. Detection of tropical fungi in formalin-fixed, paraffin-embedded tissue: Still an indication for microscopy in times of sequence-based diagnosis? Biomed. Res. Int. 2015, 2015, 938721. [Google Scholar] [CrossRef] [Green Version]
- Springer, J.; Goldenberger, D.; Schmidt, F.; Weisser, M.; Wehrle-Wieland, E.; Einsele, H.; Frei, R.; Löffler, J. Development and application of two independent real-time PCR assays to detect clinically relevant Mucorales species. J. Med. Microbiol. 2016, 65, 227–234. [Google Scholar] [CrossRef]
- Massire, C.; Buelow, D.R.; Zhang, S.X.; Lovari, R.; Matthews, H.E.; Toleno, D.M.; Ranken, R.R.; Hall, T.A.; Metzgar, D.; Sampath, R.; et al. PCR followed by electrospray ionization mass spectrometry for broad-range identification of fungal pathogens. J. Clin. Microbiol. 2013, 51, 959–966. [Google Scholar] [CrossRef] [Green Version]
- Spiess, B.; Seifarth, W.; Hummel, M.; Frank, O.; Fabarius, A.; Zheng, C.; Mörz, H.; Hehlmann, R.; Buchheidt, D. DNA microarray-based detection and identification of fungal pathogens in clinical samples from neutropenic patients. J. Clin. Microbiol. 2007, 45, 3743–3753. [Google Scholar] [CrossRef] [Green Version]
- Hsiao, C.R.; Huang, L.; Bouchara, J.-P.; Barton, R.; Li, H.C.; Chang, T.C. Identification of Medically Important Molds by an Oligonucleotide Array†. J. Clin. Microbiol. 2005, 43, 3760–3768. [Google Scholar] [CrossRef] [Green Version]
- Boch, T.; Reinwald, M.; Postina, P.; Cornely, O.A.; Vehreschild, J.J.; Heußel, C.P.; Heinz, W.J.; Hoenigl, M.; Eigl, S.; Lehrnbecher, T.; et al. Identification of invasive fungal diseases in immunocompromised patients by combining an Aspergillus specific PCR with a multifungal DNA-microarray from primary clinical samples. Mycoses 2015, 58, 735–745. [Google Scholar] [CrossRef]
- Zaman, K.; Rudramurthy, S.M.; Das, A.; Panda, N.; Honnavar, P.; Kaur, H.; Chakrabarti, A. Molecular diagnosis of rhino-orbito-cerebral mucormycosis from fresh tissue samples. J. Med. Microbiol. 2017, 66, 1124–1129. [Google Scholar] [CrossRef]
- Machouart, M.; Larché, J.; Burton, K.; Collomb, J.; Maurer, P.; Cintrat, A.; Biava, M.F.; Greciano, S.; Kuijpers, A.F.A.; Contet-Audonneau, N.; et al. Genetic identification of the main opportunistic Mucorales by PCR-restriction fragment length polymorphism. J. Clin. Microbiol. 2006, 44, 805–810. [Google Scholar] [CrossRef] [Green Version]
- Hrncirova, K.; Lengerova, M.; Kocmanova, I.; Racil, Z.; Volfova, P.; Palousova, D.; Moulis, M.; Weinbergerova, B.; Winterova, J.; Toskova, M.; et al. Rapid detection and identification of mucormycetes from culture and tissue samples by use of high-resolution melt analysis. J. Clin. Microbiol. 2010, 48, 3392–3394. [Google Scholar] [CrossRef] [Green Version]
- Caramalho, R.; Madl, L.; Rosam, K.; Rambach, G.; Speth, C.; Pallua, J.; Larentis, T.; Araujo, R.; Alastruey-Izquierdo, A.; Lass-Flörl, C.; et al. Evaluation of a Novel Mitochondrial Pan-Mucorales Marker for the Detection, Identification, Quantification, and Growth Stage Determination of Mucormycetes. J. Fungi 2019, 5. [Google Scholar] [CrossRef] [Green Version]
- Hata, D.J.; Buckwalter, S.P.; Pritt, B.S.; Roberts, G.D.; Wengenack, N.L. Real-time PCR method for detection of zygomycetes. J. Clin. Microbiol. 2008, 46, 2353–2358. [Google Scholar] [CrossRef] [Green Version]
- United States Environmental Protection Agency. EPA Technology for Mold Identification and Enumeration. 2014. Available online: https://irp-cdn.multiscreensite.com/c4e267ab/files/uploaded/gCQnkBNWQuSD96fPIikY_EPA_Technology%20for%20Mold%20Identification%20and%20Enumeration.pdf (accessed on 23 March 2021).
- Bellanger, A.-P.; Berceanu, A.; Rocchi, S.; Valot, B.; Fontan, J.; Chauchet, A.; Belin, N.; Scherer, E.; Deconinck, E.; Navellou, J.-C.; et al. Development of a quantitative PCR detecting Cunninghamella bertholletiae to help in diagnosing this rare and aggressive mucormycosis. Bone Marrow Transplant. 2018, 53, 1180–1183. [Google Scholar] [CrossRef]
- Mercier, T.; Reynders, M.; Beuselinck, K.; Guldentops, E.; Maertens, J.; Lagrou, K. Serial Detection of Circulating Mucorales DNA in Invasive Mucormycosis: A Retrospective Multicenter Evaluation. J. Fungi 2019, 5. [Google Scholar] [CrossRef] [Green Version]
- Salehi, E.; Hedayati, M.T.; Zoll, J.; Rafati, H.; Ghasemi, M.; Doroudinia, A.; Abastabar, M.; Tolooe, A.; Snelders, E.; van der Lee, H.A.; et al. Discrimination of Aspergillosis, Mucormycosis, Fusariosis, and Scedosporiosis in Formalin-Fixed Paraffin-Embedded Tissue Specimens by Use of Multiple Real-Time Quantitative PCR Assays. J. Clin. Microbiol. 2016, 54, 2798–2803. [Google Scholar] [CrossRef] [Green Version]
- Bernal-Martínez, L.; Buitrago, M.J.; Castelli, M.V.; Rodriguez-Tudela, J.L.; Cuenca-Estrella, M. Development of a single tube multiplex real-time PCR to detect the most clinically relevant Mucormycetes species. Clin. Microbiol. Infect. 2013, 19, E1–E7. [Google Scholar] [CrossRef] [Green Version]
- Legrand, M.; Gits-Muselli, M.; Boutin, L.; Garcia-Hermoso, D.; Maurel, V.; Soussi, S.; Benyamina, M.; Ferry, A.; Chaussard, M.; Hamane, S.; et al. Detection of Circulating Mucorales DNA in Critically Ill Burn Patients: Preliminary Report of a Screening Strategy for Early Diagnosis and Treatment. Clin. Infect. Dis. 2016, 63, 1312–1317. [Google Scholar] [CrossRef]
- Valero, C.; de La Cruz-Villar, L.; Zaragoza, Ó.; Buitrago, M.J. New Panfungal Real-Time PCR Assay for Diagnosis of Invasive Fungal Infections. J. Clin. Microbiol. 2016, 54, 2910–2918. [Google Scholar] [CrossRef] [Green Version]
- Gade, L.; Hurst, S.; Balajee, S.A.; Lockhart, S.R.; Litvintseva, A.P. Detection of mucormycetes and other pathogenic fungi in formalin fixed paraffin embedded and fresh tissues using the extended region of 28S rDNA. Med. Mycol. 2017, 55, 385–395. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wagner, K.; Springer, B.; Pires, V.P.; Keller, P.M. Molecular detection of fungal pathogens in clinical specimens by 18S rDNA high-throughput screening in comparison to ITS PCR and culture. Sci. Rep. 2018, 8, 6964. [Google Scholar] [CrossRef] [PubMed]
- Zeller, I.; Schabereiter-Gurtner, C.; Mihalits, V.; Selitsch, B.; Barousch, W.; Hirschl, A.M.; Makristathis, A.; Willinger, B. Detection of fungal pathogens by a new broad range real-time PCR assay targeting the fungal ITS2 region. J. Med. Microbiol. 2017, 66, 1383–1392. [Google Scholar] [CrossRef] [PubMed]
- White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal rna genes for phylogenetics. In PCR Protocols; Elsevier: Amsterdam, The Netherlands, 1990; pp. 315–322. ISBN 9780123721808. [Google Scholar]
- Khot, P.D.; Ko, D.L.; Fredricks, D.N. Sequencing and analysis of fungal rRNA operons for development of broad-range fungal PCR assays. Appl. Environ. Microbiol. 2009, 75, 1559–1565. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Springer, J.; McCormick Smith, I.; Hartmann, S.; Winkelmann, R.; Wilmes, D.; Cornely, O.; Kessel, J.; Löffler, J.; Rickerts, V. Identification of Aspergillus and Mucorales in formalin-fixed, paraffin-embedded tissue samples: Comparison of specific and broad-range fungal qPCR assays. Med. Mycol. 2019, 57, 308–313. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Camp, I.; Manhart, G.; Schabereiter-Gurtner, C.; Spettel, K.; Selitsch, B.; Willinger, B. Clinical evaluation of an in-house panfungal real-time PCR assay for the detection of fungal pathogens. Infection 2020, 48, 345–355. [Google Scholar] [CrossRef] [Green Version]
- Wickes, B.L.; Wiederhold, N.P. Molecular diagnostics in medical mycology. Nat. Commun. 2018, 9, 5135. [Google Scholar] [CrossRef] [Green Version]
- CLSI. Interpretive Criteria for Identification of Bacteria and Fungi by Targeted DNA Sequencing, 2nd ed.; Guideline MM18; Clinical and Laboratory Standards Institute: Annapolis Junction, MD, USA, 2018. [Google Scholar]
- Schwarz, P.; Bretagne, S.; Gantier, J.-C.; Garcia-Hermoso, D.; Lortholary, O.; Dromer, F.; Dannaoui, E. Molecular identification of zygomycetes from culture and experimentally infected tissues. J. Clin. Microbiol. 2006, 44, 340–349. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nilsson, R.H.; Kristiansson, E.; Ryberg, M.; Hallenberg, N.; Larsson, K.-H. Intraspecific ITS variability in the kingdom fungi as expressed in the international sequence databases and its implications for molecular species identification. Evol. Bioinform. Online 2008, 4, 193–201. [Google Scholar] [CrossRef]
- Babouee Flury, B.; Weisser, M.; Prince, S.S.; Bubendorf, L.; Battegay, M.; Frei, R.; Goldenberger, D. Performances of two different panfungal PCRs to detect mould DNA in formalin-fixed paraffin-embedded tissue: What are the limiting factors? BMC Infect. Dis. 2014, 14, 692. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Prakash, P.Y.; Irinyi, L.; Halliday, C.; Chen, S.; Robert, V.; Meyer, W. Online Databases for Taxonomy and Identification of Pathogenic Fungi and Proposal for a Cloud-Based Dynamic Data Network Platform. J. Clin. Microbiol. 2017, 55, 1011–1024. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- 57 Wagner, L.; Stielow, J.B.; de Hoog, G.S.; Bensch, K.; Schwartze, V.U.; Voigt, K.; Alastruey-Izquierdo, A.; Kurzai, O.; Walther, G. A new species concept for the clinically relevant Mucor circinelloides complex. Persoonia 2020, 44, 67–97. [Google Scholar] [CrossRef]
- Gholinejad-Ghadi, N.; Shokohi, T.; Seifi, Z.; Aghili, S.R.; Roilides, E.; Nikkhah, M.; Pormosa, R.; Karami, H.; Larjani, L.V.; Ghasemi, M.; et al. Identification of Mucorales in patients with proven invasive mucormycosis by polymerase chain reaction in tissue samples. Mycoses 2018, 61, 909–915. [Google Scholar] [CrossRef] [PubMed]
- Hammond, S.P.; Bialek, R.; Milner, D.A.; Petschnigg, E.M.; Baden, L.R.; Marty, F.M. Molecular methods to improve diagnosis and identification of mucormycosis. J. Clin. Microbiol. 2011, 49, 2151–2153. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Drogari-Apiranthitou, M.; Panayiotides, I.; Galani, I.; Konstantoudakis, S.; Arvanitidis, G.; Spathis, A.; Gouloumi, A.-R.; Tsakiraki, Z.; Tsiodras, S.; Petrikkos, G. Diagnostic value of a semi-nested PCR for the diagnosis of mucormycosis and aspergillosis from paraffin-embedded tissue: A single center experience. Pathol. Res. Pract. 2016, 212, 393–397. [Google Scholar] [CrossRef] [PubMed]
- Badiee, P.; Arastefar, A.; Jafarian, H. Comparison of histopathological analysis, culture and polymerase chain reaction assays to detect mucormycosis in biopsy and blood specimens. Iran. J. Microbiol. 2013, 5, 406–410. [Google Scholar]
- Rickerts, V.; Mousset, S.; Lambrecht, E.; Tintelnot, K.; Schwerdtfeger, R.; Presterl, E.; Jacobi, V.; Just-Nübling, G.; Bialek, R. Comparison of histopathological analysis, culture, and polymerase chain reaction assays to detect invasive mold infections from biopsy specimens. Clin. Infect. Dis. 2007, 44, 1078–1083. [Google Scholar] [CrossRef]
- Shokouhi, S.; Mirzaei, J.; Sajadi, M.M.; Javadi, A. Comparison of serum PCR assay and histopathology for the diagnosis of invasive aspergillosis and mucormycosis in immunocompromised patients with sinus involvement. Curr. Med. Mycol. 2016, 2, 46–48. [Google Scholar] [CrossRef] [Green Version]
- Springer, J.; Lackner, M.; Ensinger, C.; Risslegger, B.; Morton, C.O.; Nachbaur, D.; Lass-Flörl, C.; Einsele, H.; Heinz, W.J.; Loeffler, J. Clinical evaluation of a Mucorales-specific real-time PCR assay in tissue and serum samples. J. Med. Microbiol. 2016, 65, 1414–1421. [Google Scholar] [CrossRef]
- Springer, J.; White, P.L.; Kessel, J.; Wieters, I.; Teschner, D.; Korczynski, D.; Liebregts, T.; Cornely, O.A.; Schwartz, S.; Elgeti, T.; et al. A comparison of Aspergillus and Mucorales pcr testing of different bronchoalveolar lavage fluid fractions from patients with suspected invasive pulmonary fungal disease. J. Clin. Microbiol. 2018, 56. [Google Scholar] [CrossRef] [Green Version]
- Guegan, H.; Iriart, X.; Bougnoux, M.-E.; Berry, A.; Robert-Gangneux, F.; Gangneux, J.-P. Evaluation of MucorGenius® mucorales PCR assay for the diagnosis of pulmonary mucormycosis. J. Infect. 2020, 81, 311–317. [Google Scholar] [CrossRef]
- Millon, L.; Larosa, F.; Lepiller, Q.; Legrand, F.; Rocchi, S.; Daguindau, E.; Scherer, E.; Bellanger, A.-P.; Leroy, J.; Grenouillet, F. Quantitative polymerase chain reaction detection of circulating DNA in serum for early diagnosis of mucormycosis in immunocompromised patients. Clin. Infect. Dis. 2013, 56, e95–e101. [Google Scholar] [CrossRef] [Green Version]
- Scherer, E.; Iriart, X.; Bellanger, A.P.; Dupont, D.; Guitard, J.; Gabriel, F.; Cassaing, S.; Charpentier, E.; Guenounou, S.; Cornet, M.; et al. Quantitative PCR (qPCR) Detection of Mucorales DNA in Bronchoalveolar Lavage Fluid To Diagnose Pulmonary Mucormycosis. J. Clin. Microbiol. 2018, 56. [Google Scholar] [CrossRef] [Green Version]
- Schwartze, V.U.; Winter, S.; Shelest, E.; Marcet-Houben, M.; Horn, F.; Wehner, S.; Linde, J.; Valiante, V.; Sammeth, M.; Riege, K.; et al. Gene expansion shapes genome architecture in the human pathogen Lichtheimia corymbifera: An evolutionary genomics analysis in the ancient terrestrial mucorales (Mucoromycotina). PLoS Genet. 2014, 10, e1004496. [Google Scholar] [CrossRef]
- Navarro-Mendoza, M.I.; Pérez-Arques, C.; Panchal, S.; Nicolás, F.E.; Mondo, S.J.; Ganguly, P.; Pangilinan, J.; Grigoriev, I.V.; Heitman, J.; Sanyal, K.; et al. Early Diverging Fungus Mucor circinelloides Lacks Centromeric Histone CENP-A and Displays a Mosaic of Point and Regional Centromeres. Curr. Biol. 2019, 29, 3791–3802.e6. [Google Scholar] [CrossRef] [Green Version]
- Ma, L.-J.; Ibrahim, A.S.; Skory, C.; Grabherr, M.G.; Burger, G.; Butler, M.; Elias, M.; Idnurm, A.; Lang, B.F.; Sone, T.; et al. Genomic analysis of the basal lineage fungus Rhizopus oryzae reveals a whole-genome duplication. PLoS Genet. 2009, 5, e1000549. [Google Scholar] [CrossRef]
- Garcia-Hermoso, D.; Criscuolo, A.; Lee, S.C.; Legrand, M.; Chaouat, M.; Denis, B.; Lafaurie, M.; Rouveau, M.; Soler, C.; Schaal, J.-V.; et al. Outbreak of Invasive Wound Mucormycosis in a Burn Unit Due to Multiple Strains of Mucor circinelloides f. circinelloides Resolved by Whole-Genome Sequencing. mBio 2018, 9. [Google Scholar] [CrossRef] [Green Version]
- Morio, F.; Lombardi, L.; Butler, G. The CRISPR toolbox in medical mycology: State of the art and perspectives. PLoS Pathog. 2020, 16, e1008201. [Google Scholar] [CrossRef] [Green Version]
- Lau, A.; Ren, C.; Lee, L.P. Critical review on where CRISPR meets molecular diagnostics. Prog. Biomed. Eng. 2021, 3, 12001. [Google Scholar] [CrossRef]
- Jolany Vangah, S.; Katalani, C.; Booneh, H.A.; Hajizade, A.; Sijercic, A.; Ahmadian, G. CRISPR-Based Diagnosis of Infectious and Noninfectious Diseases. Biol. Proced. Online 2020, 22, 22. [Google Scholar] [CrossRef]
- Burnham-Marusich, A.R.; Hubbard, B.; Kvam, A.J.; Gates-Hollingsworth, M.; Green, H.R.; Soukup, E.; Limper, A.H.; Kozel, T.R. Conservation of Mannan Synthesis in Fungi of the Zygomycota and Ascomycota Reveals a Broad Diagnostic Target. mSphere 2018, 3. [Google Scholar] [CrossRef] [Green Version]
- Orne, C.; Burnham-Marusich, A.; Baldin, C.; Gebremariam, T.; Ibrahim, A.; Kvam, A.; Kozel, T. Cell wall fucomannan is a biomarker for diagnosis of invasive murine mucormycosis. In Proceedings of the 28thECCMID, Madrid, Spain, 21–24 April 2018. [Google Scholar]
- Koshy, S.; Ismail, N.; Astudillo, C.L.; Haeger, C.M.; Aloum, O.; Acharige, M.T.; Farmakiotis, D.; Baden, L.R.; Marty, F.M.; Kontoyiannis, D.P.; et al. Breath-Based Diagnosis of Invasive Mucormycosis (IM). Open Forum Infect. Dis. 2017, 4, S53–S54. [Google Scholar] [CrossRef]
- Montaño, D.E.; Voigt, K. Host Immune Defense upon Fungal Infections with Mucorales: Pathogen-Immune Cell Interactions as Drivers of Inflammatory Responses. J. Fungi 2020, 6. [Google Scholar] [CrossRef]
- Bacher, P.; Steinbach, A.; Kniemeyer, O.; Hamprecht, A.; Assenmacher, M.; Vehreschild, M.J.G.T.; Vehreschild, J.J.; Brakhage, A.A.; Cornely, O.A.; Scheffold, A. Fungus-specific CD4(+) T cells for rapid identification of invasive pulmonary mold infection. Am. J. Respir. Crit. Care Med. 2015, 191, 348–352. [Google Scholar] [CrossRef]
Type | Method | Target Gene | Primer Specificity | Identification Level | Primer/Probe | Fl (bp) |
---|---|---|---|---|---|---|
(q)PCR + sequencing | semi-nested PCR + sequencing (Bialek 2005) [11] | 18S rRNA | Mucorales | species, Rm. only genus | f1−ATTACCATGAGCAAATCAGA, r1−TCCGTCAATTCCTTTAAGTTTC, f2 = f1, r2–CAATCCAAGAATTTCACCTCTAG | 175–177 |
Probe-based qPCR +sequencing of 18S amplicon (Springer 2016a) [27] | 18S rRNA | Mucorales | genus | f−TTA CCRTGAGCAAATCAGARTG, r–AA TCYAAGAATTTCACCTCTAGCG, p–TYRR(G)G(G)B(A)T(T)T(G)T(A)TTT *1 | 175 | |
28S rRNA | f−TTTGGGAATGCAGCCT, r−TCARAGTTCTTTTCAWCTTTCCCT, p–CGARARACCGATAGCRAACAAGTACCGT | 107 | ||||
PCR + RFLP | semi-nested PCR + RFLP (Zaman 2017) [32] | 18S rRNA | Mucorales | species, genus | See Bialek 2005 *2 | 175–177 |
multiplex PCR + RFLP (Machouart 2006) [33] | 18S rRNA | Rp sp., Rm sp., M. sp., and L. corymbifera | species, genus | f−TGATCTACGTGACAAATTCT + f−TGATCTACGCGAGCGAACAA + f−TGATCTACGTGACATATTCT + f−TGATCTACACGGCATCAAAT, r–AGTAGTTTGTCTTCGGKCAA *3 | approx. 830 | |
PCR + gel electrophoresis | PCR + electrophoresis (Baldin 2018) [14] | CotH | Mucorales | Mucorales | np | np |
qPCR + HRM | nested-qPCR + HRM (Hrncirova 2010) [34] | 18S rRNA | Mucorales | species, genus | See Bialek 2005 | 175–177 |
qPCR + HRM (Caramalho 2019) [35] | mitochondrial rnl | Mucorales | genus/species | f−GGTGTAGAATACAAGGGAGTCGA, r−GGAGAAATCCGCCCCAGATAA | 124 | |
FRET-qPCR + HRM (Hata 2008) [36] | cytochrome b | Mucorales | genus | f−TAGGAATTACAGCAAAT, r−CCAATGCAAACTCC, anchor-ACAATTTTCTTATTCTTCTTAGTATTAG, Donor–TTTATTCTTATTC | 167 | |
qPCR | Probe-based qPCR (EPA) [37] | n. g. | L. | genus | f−CACCGCCCGTCGCTAC, r−GCAAAGCGTTCCGAAGGACA, p−ATGGCACGAGCAAGCATTAGGGACG | 118 |
Rm. | genus | f−CACCGCCCGTCGCTAC, r−GTAGTTTGCCATAGTTCGGCTA, p–TGGCTATAGTGAGCATATGGGAGGCT | 105 | |||
M. and Rp. | 2 genera | f-CACCGCCCGTCGCTAC, r−CCTAGTTTGCCATAGTTCTCA *4 GCAG, p–CCGATTGAATGGTTATAGTGAGCATATGGGATC | 105 | |||
Probe-based qPCR (Bellanger 2018) [38] | 18S rRNA | C. | genus | f–TGTGGCTATGCAGCTGGTCA, r−ACACATTCAGGCACGAAGGC, p–TCGGTCGGCGTGGTTCTCTGCCCA | 162 | |
MucorGenius®-qPCR (PathoNostics) | 28S (according to [39]) | Mucorales | order | according to [39], similar to Springer 2016a | np | |
Multiplex qPCR | 2 × Multiplex qPCR (Salehi 2016) [40] | ITS 2 | Quadriplex assay: Rp. microsporus, Rp. oryzae, M., and C. bertholletiae | genus/species | f−TGAATCATCRARTCTTTGAACGCA, r−ATATGCTTAAGTTCAGCGGGT, species-specific probes (see Salehi 2016) | approx. 300 |
Triplex assay: L., S., and Rm. | genus/species | f−GAATCATCGARTTCTYGAACGCA, r−ATATGCTTAAGTTCAGCGGGT, species-specific probes (see Salehi 2016) | approx. 350 | |||
Multiplex probe-based qPCR (Bernal-Martinez 2013) [41] | ITS 1 | Rp. oryzae | species | f−TCTGGGGTAAGTGATTGC, r–GCGAGAACCAAGAGATCC, p–CGCGATAACCAGGAGTGGCATCGATCAAATCGCG | 192 | |
ITS 1 | Rp. microsporus | species | F–CTTCTCAGTATTGTTTGC, r−ATGGTATATGGTAAAGGG, p-CGCGATCCTCTGGCGATGAAGGTCGTATCGCG | 187 | ||
ITS 2 | M. | genus | f−GTCTTTGAACGCAACTTG, r−CCTGATTTCAGATCAAAT, p–CGCGATTTCCAATGAGCACGCCTGTTATCGCG | 263 | ||
PCR + microarray | Multiplex PCR + microarray (Spiess 2007) [29] | ITS 1 | M. racemosus, Rp. microsporus, Rp. oryzae (and 12 other non-Mucorales fungi) | species | 9 different f primer + 3 different r primer *5 (see Spiess 2007) | np |
PCR + microarray (Hsiao 2005) [30] | ITS 1/5.8S rRNA/ITS 2 | L. corymbifera, C. spp., Rp. oryzae, Rm. pusillus (and 60 other non-Mucorales fungi) | species | f–TCCGTAGGTGAACCTGCGG, r–TCCTCCGCTTATTGATATG*6 | 640 | |
PCR + ESI-MS | PCR + ESI-MS (Massire 2013) [28] | 28S rRNA, 18S rRNA, mitochondrial 18S rRNA and cytB, tub, hpr | Fungi | genus/species | 16 primer pairs, detection range from broad-range fungal to order level specificity | 72–154 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lackner, N.; Posch, W.; Lass-Flörl, C. Microbiological and Molecular Diagnosis of Mucormycosis: From Old to New. Microorganisms 2021, 9, 1518. https://doi.org/10.3390/microorganisms9071518
Lackner N, Posch W, Lass-Flörl C. Microbiological and Molecular Diagnosis of Mucormycosis: From Old to New. Microorganisms. 2021; 9(7):1518. https://doi.org/10.3390/microorganisms9071518
Chicago/Turabian StyleLackner, Nina, Wilfried Posch, and Cornelia Lass-Flörl. 2021. "Microbiological and Molecular Diagnosis of Mucormycosis: From Old to New" Microorganisms 9, no. 7: 1518. https://doi.org/10.3390/microorganisms9071518
APA StyleLackner, N., Posch, W., & Lass-Flörl, C. (2021). Microbiological and Molecular Diagnosis of Mucormycosis: From Old to New. Microorganisms, 9(7), 1518. https://doi.org/10.3390/microorganisms9071518