Next Article in Journal
Estimation of Variance Components and Genomic Prediction for Individual Birth Weight Using Three Different Genome-Wide SNP Platforms in Yorkshire Pigs
Next Article in Special Issue
Long-Term Determinants of the Seroprevalence of Toxoplasma gondii in a Wild Ungulate Community
Previous Article in Journal
A Comparison of the Quality of Meat from Female and Male Californian and Flemish Giant Gray Rabbits
Previous Article in Special Issue
Broad Range Screening of Vector-Borne Pathogens in Arctic Foxes (Vulpes lagopus) in Iceland
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 10
Issue 12
10.3390/ani10122218
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Brief Report

Zoonotic Microsporidia in Wild Lagomorphs in Southern Spain

by
Anabel Martínez-Padilla
1,†,
Javier Caballero-Gómez
2,3,*,†,
Ángela Magnet
4,
Félix Gómez-Guillamón
5,
Fernando Izquierdo
4,
Leonor Camacho-Sillero
5,
Saúl Jiménez-Ruiz
2,6,
Carmen del Águila
4 and
Ignacio García-Bocanegra
2
1
Departamento de Biología Molecular y Bioquímica, Universidad de Málaga (UMA), 29010 Málaga, Spain
2
Grupo de Investigación en Sanidad Animal y Zoonosis (GISAZ), Departamento de Sanidad Animal, Universidad de Córdoba (UCO), 14014 Córdoba, Spain
3
Unidad de Enfermedades Infecciosas, Grupo de Virología Clínica y Zoonosis, Instituto Maimónides de Investigación Biomédica de Córdoba (IMIBIC), Universidad de Córdoba (UCO), 14004 Córdoba, Spain
4
Facultad de Farmacia, Universidad San Pablo-CEU, CEU Universities, Urbanización Montepríncipe, Boadilla del Monte, 28660 Madrid, Spain
5
Programa de Vigilancia Epidemiológica de la Fauna Silvestre en Andalucía (PVE), Consejería de Agricultura, Ganadería, Pesca y Desarrollo Sostenible, Junta de Andalucía, 29006 Málaga, Spain
6
Grupo Sanidad y Biotecnología (SaBio), Instituto de Investigación en Recursos Cinegéticos (IREC-CSIC-JCCM), Universidad de Castilla-la Mancha (UCLM), 13005 Ciudad Real, Spain
*
Author to whom correspondence should be addressed.
†
Equally contributed as first author.
Animals 2020, 10(12), 2218; https://doi.org/10.3390/ani10122218
Submission received: 9 November 2020 / Revised: 20 November 2020 / Accepted: 23 November 2020 / Published: 26 November 2020
(This article belongs to the Special Issue Parasites and Wildlife)
Browse Figure
Versions Notes

Abstract

:

Simple Summary

A cross-sectional study was carried out to assess the presence of zoonotic microsporidia in organ meats of European wild rabbits and Iberian hares consumed by humans in Spain. Between July 2015 and December 2018, kidney samples from 383 wild rabbits and kidney and brain tissues from 79 Iberian hares in southern Spain were tested by species-specific polymerase chain reactions (PCRs) for the detection of microsporidia DNA. We confirmed the presence of Enterocytozoon bieneusi in three wild rabbits and Encephalitozoon intestinalis in one wild rabbit and three Iberian hares. However, none of the 462 sampled wild lagomorphs showed Encephalitozoon hellem nor Encephalitozoon cuniculi infection. This is the first report of E. intestinalis infection in wild rabbits and Iberian hares. The presence of E. bieneusi and E. intestinalis in organ meats from wild lagomorphs can be of public health concern. Additional studies are required to determine the real prevalence of these parasites in European wild rabbit and Iberian hare.

Abstract

Microsporidia are obligate intracellular protist-like fungal pathogens that infect a broad range of animal species, including humans. This study aimed to assess the presence of zoonotic microsporidia (Enterocytozoon bieneusi, Encephalitozoon intestinalis, Encephalitozoon hellem, and Encephalitozoon cuniculi) in organ meats of European wild rabbit (Oryctolagus cuniculus) and Iberian hare (Lepus granatensis) consumed by humans in Spain. Between July 2015 and December 2018, kidney samples from 383 wild rabbits and kidney and brain tissues from 79 Iberian hares in southern Spain were tested by species-specific PCR for the detection of microsporidia DNA. Enterocytozoon bieneusi infection was confirmed in three wild rabbits (0.8%; 95% CI: 0.0–1.7%) but not in hares (0.0%; 95% CI: 0.0–4.6%), whereas E. intestinalis DNA was found in one wild rabbit (0.3%; 95% CI: 0.0–0.8%) and three Iberian hares (3.8%; 95% CI: 0.0–8.0%). Neither E. hellem nor E. cuniculi infection were detected in the 462 (0.0%; 95% CI: 0.0–0.8%) lagomorphs analyzed. The absence of E. hellem and E. cuniculi infection suggests a low risk of zoonotic foodborne transmission from these wild lagomorph species in southern Spain. To the authors’ knowledge, this is the first report of E. intestinalis infection in wild rabbits and Iberian hares. The presence of E. bieneusi and E. intestinalis in organ meats from wild lagomorphs can be of public health concern. Additional studies are required to determine the real prevalence of these parasites in European wild rabbit and Iberian hare.

1. Introduction

The European wild rabbit (Oryctolagus cuniculus) and the Iberian hare (Lepus granatensis) are two endemic species in the Iberian Peninsula. Both lagomorph species play a key role in the ecology of Mediterranean ecosystems [1,2]. They are the staple prey for a large number of predators, including endangered species such as the Iberian lynx (Lynx pardinus) and the Spanish imperial eagle (Aquila adalberti) [3]. These lagomorphs are also among the main small game species in Spain. About 5.3 million wild rabbits and 890 thousand Iberian hares are harvested annually in this country and are generally consumed without sanitary inspection since they are intended for small-scale retail sale or personal consumption [4]. Public health concerns indicate the need for epidemiological studies on zoonotic diseases affecting wildlife species that are a source of food for humans [5]. In this respect, the role of wild lagomorphs as reservoirs of zoonotic parasites has been widely documented [6,7,8].
The phylum Microsporidia comprises more than 1500 obligate intracellular spore-forming parasites classified as fungi that can infect a wide range of vertebrate and invertebrate hosts through the fecal–oral route [9]. Among the 17 zoonotic microsporidia species, Enterocytozoon bieneusi, Encephalitozoon intestinalis, E. hellem, and E. cuniculi are the most common species reported in humans [10,11]. Microsporidiosis in humans is usually characterized by chronic diarrhea and wasting syndrome, although keratoconjunctivitis, hepatitis, myositis, kidney and urogenital infection, ascites, and/or cholangitis have also been reported, particularly in immunocompromised individuals [12].
Foodborne transmission has previously been evidenced as a zoonotic route of microsporidia infection [13]. In this regard, in European countries, zoonotic microsporidia species have been detected in the Eastern cottontail rabbit (Sylvilagus floridanus), the European brown hare (Lepus europaeus), and the European rabbit [14,15,16,17]. Even though microsporidia infections in these lagomorph species are usually asymptomatic, microsporidiosis has been reported in domestic rabbit and European brown hare, causing neurological and/or renal disorders and even death [17,18,19]. However, knowledge about the role of wild lagomorphs in the epidemiology of microsporidia remains scarce [20]. Hence, the present study aimed to assess the presence of E. bieneusi, E. intestinalis, E. hellem, and E. cuniculi in organ meats from European wild rabbit and Iberian hare, the most frequent wild lagomorph species consumed by humans in Spain.

2. Materials and Methods

A cross-sectional study was carried out on wild lagomorphs in Andalusia (southern Spain) (36° N–38°60′ N, 1°75′ W–7°25′ W, 87,268 km2) between July 2015 and December 2018. The sample size for wild rabbits was calculated assuming a prevalence of 50% (the highest sample size for studies with unknown prevalence) with a 95% confidence level (95% CI) and a desired precision of ±5% [21], which gave 384 wild rabbits to be sampled. Whenever possible, a minimum of 49 animals were sampled in each of the eight provinces of Andalusia in order to detect microsporidia infection with a 95% probability and an assumed minimum within-province prevalence of 6%. Kidney samples were collected from 383 wild rabbits in 40 hunting areas (Figure 1). In the same study region and period, kidney and brain samples were also obtained from 79 Iberian hares in 43 hunting or protected areas (Figure 1). Sampled animals were necropsied in the field. Samples were placed in sterile bottles (25 mL), preserved at 4 °C while transported to the laboratory, and stored at −20 °C until analysis. Data on species, age, gender, sampling site, province, and sampling year were gathered from each wild lagomorph sampled, whenever possible. Data analyses were carried out using the SPSS statistical software package version 25.0 (IBM Corporation, Somers, NY, USA).
This study did not involve purposeful killing of animals. The collection of samples was performed by personnel of the Epidemiological Surveillance Program in Wildlife of the Government of Andalusia. Samples were collected from legally hunted animals during the hunting seasons or by passive surveillance in complete agreement with Andalusian, Spanish, and European regulations. No ethical approval by an Institutional Animal Care and Use Committee was deemed necessary.
Genomic DNA was extracted from the kidney and brain samples using the G-spin™ total DNA extraction kit (Intron Biotechnology, Seongnam-Si, Korea), following the manufacturer’s instructions. PCR amplifications were performed using the GenAmp kit (Perkin-Elmer Cetus, Norwalk, CT, USA) to detect small-subunit rRNA (SSU rRNA) coding regions of the microsporidia using species-specific primers previously described (Table 1) in a Gene Amp PCR system 9700 thermocycler (Perkin Elmer). The final concentration was 0.2 mM of each dNTP, 0.2 µM of each primer, buffer with MgCl2 (1.5 mM), and 1.25 U of Taq polymerase. Conditions for PCR reactions were as follows: denaturing at 94 °C for 30 s followed by 35 cycles of annealing at 45 °C for 30 s for E. intestinalis primers or 55 °C for 30 s for the remaining microsporidia species and extension at 72 °C for 90 s. PCR products were analyzed by electrophoresis in 2% agarose gel stained with ethidium bromide and examined under UV light.

3. Results

Microsporidia infection was detected in 7 of the 462 (1.5%; 95% CI: 0.4–2.6) wild lagomorphs analyzed. The distribution of prevalence according to species, province, year, age, and sex is shown in Table 2. Four of the 383 (1.0%; 95% CI: 0.0–2.1) wild rabbits and 3 of the 79 (3.8%; 95% CI: 0.0–8.0) Iberian hares tested positive for microsporidia infection. Positive animals were found in 7 of 83 (8.4%) sampling areas and 3 of 8 (37.5%) provinces (Figure 1). E. bieneusi infection was detected in wild rabbits (3/383; 0.8%; 95% CI: 0.0–1.7) but not in Iberian hares (0/79; 0.0%; 95% CI: 0.0–4.6). E. intestinalis was confirmed in one wild rabbit (0.3%; 95% CI: 0.0–0.8) and in two brain and one kidney samples from three Iberian hares (3.8%; 95% CI: 0.0–8.0). Co-infections with E. bieneusi and E. intestinalis were not observed. None of the 462 (0.0%; 95% CI: 0.0–0.8) wild lagomorphs showed positive results for E. hellem or E. cuniculi infection in the examined organs.

4. Discussion

This is the first large-scale study on zoonotic microsporidia species, including E. bieneusi, E. intestinalis, E. hellem, and E. cuniculi, in wild rabbits in the Iberian Peninsula and also the first report of microsporidia infection in Iberian hares worldwide. The presence of E. bieneusi infection in wild rabbits is consistent with that previously documented [26] and confirms the susceptibility of European wild rabbits to this pathogen. E. bieneusi infection has also been detected in farmed rabbits [27,28,29]. The low prevalence of this parasite detected in organ meats from wild rabbits and the absence of positivity in Iberian hares suggest that these mammal species could act as a spillover host rather than a true reservoir of this emerging pathogen. However, additional studies including fecal samples are required to determine the real prevalence of E. bieneusi in wild lagomorphs in the study area. In Spanish Mediterranean ecosystems, E. bieneusi infection has been detected in different sympatric species, including wild boar [30], red foxes (Vulpes vulpes), beech martens (Martes foina), and European badgers (Meles meles) [11,27], some of which can be predator species of wild lagomorphs. The high homology between E. bieneusi isolates obtained from humans, wild boar, and wild carnivores provides evidence of the zoonotic potential of wildlife [11,30]. In this regard, E. bieneusi infection has been reported in HIV/AIDS patients, organ transplant recipients, and immunocompetent individuals in Spain [31,32,33]. Further molecular studies are needed to assess the risk of zoonotic transmission of this pathogen from wild rabbits.
To the best of our knowledge, this is the first report of E. intestinalis infection in wild rabbits and Iberian hares, which increases the number of animal species susceptible to this microsporidian species. There is only one previous report of E. intestinalis infection in wild lagomorphs, particularly European brown hares [17]. E. intestinalis infection has been reported in humans in several European countries [34,35,36]. Even though this parasite has not been detected in humans in Spain so far, and the frequency of positive organ meat samples detected in the present study was low (0.3% and 3.8% in wild rabbits and Iberian hares, respectively), our results reveal E. intestinalis circulation in this country and, therefore, the risk of transmission of these food-borne zoonotic pathogen cannot be ruled out. Based on the number of animals infected with E. bieneusi or E. intestinalis found in the present study and hunting bag records for wild lagomorphs [4], around 53,000 wild rabbits and 33,800 Iberian hares infected with these microsporidia species may be consumed every year in Spain.
E. hellem or E. cuniculi DNA was not found in any of the 383 wild rabbits or 79 Iberian hares analyzed. These results are consistent with previous studies that also failed to detect these parasites in feces in wild and domestic rabbits [26,27,28,29] and in kidney and brain samples in domestic rabbits [35]. In contrast, DNA of E. hellem was confirmed in the kidneys of a free-living European brown hare with chronic interstitial nephritis [17]. In addition, E. cuniculi infections have been confirmed in kidney and brain tissues of free-living Eastern cottontail rabbits [15] as well as in farmed and pet European rabbits [37,38]. Serological evidence of E. cuniculi exposure has also been detected in wild rabbits in other European countries, with seroprevalence values ranging between 3.9% in France and 44.7% in Slovakia [16,39]. The absence of E. cuniculi infection in Iberian hares in our study is in accordance with previous observations in other hare species [37,40]. Likewise, seroprevalence values found in European brown hares ranged between 0.0% in Italy and 2.9% in the Czech Republic [14,41]. Further serosurvey studies are warranted to assess E. hellem and E. cuniculi circulation in the wild lagomorph populations in Spain.
Our study has some limitations that should be noted. Even though our objective was focused on assessing the risk of zoonotic foodborne transmission of the selected microsporidia species, fecal or duodenal tissue could be more appropriate samples for detecting infection of some of these pathogens. On the other hand, E. intestinalis DNA was detected in brain samples from Iberian hares, whose kidney tissues tested negative. Unfortunately, brain samples could not be collected from wild rabbits in the present study. While kidney tissue has been shown to be suitable for detection of microsporidia infection in wildlife species [42], including lagomorphs [17], previous observations have shown different sensitivities using brain and kidney samples [15,41,42]. Our results indicate that the prevalence of E. intestinalis obtained in wild rabbits in the present study, as well as those previously reported in other species, may be underestimated. To increase the sensitivity of microsporidia detection in organ meat samples, kidney and brain tissues should be tested in parallel.

5. Conclusions

The absence of positivity to E. hellem or E. cuniculi denotes a limited role of wild rabbits and Iberian hares in the zoonotic transmission of these microsporidia species in southern Spain. The detection of E. bieneusi in wild rabbits and E. intestinalis in both wild lagomorph species could be of public health concern. Further studies are warranted to elucidate E. bieneusi and E. intestinalis infection levels in meat and products derived from wild lagomorphs and the risk of transmission of these food-borne zoonotic pathogens.

Author Contributions

Conceptualization, A.M.-P. and I.G.-B.; Methodology, A.M.-P., J.C.-G., Á.M., F.I., L.C.-S., S.J.-R. and C.d.Á.; Formal Analysis, A.M.-P., J.C.-G., Á.M. and I.G.-B.; Investigation, A.M.-P. and J.C.-G.; Resources, Á.M., I.G.-B. and F.G.-G.; Writing—Original Draft Preparation, A.M.-P., J.C.-G. and I.G.-B.; Writing—Review and Editing, A.M.-P., J.C.-G. and I.G.-B.; Supervision, I.G.-B.; Project Administration, I.G.-B.; Funding Acquisition, Á.M. and I.G.-B. All authors have read and agreed to the published version of the manuscript.

Funding

This work has benefited from the financial aid of research grants funded by the Spanish Ministry of Science and Innovation (PID2019-111080RB-C21) and by the University of Córdoba (UCO-FEDER-1264967).

Acknowledgments

We gratefully acknowledge the help of E. Rayas and V. Talavera of the Epidemiological Surveillance Program in Wildlife (Regional Government of Andalusia) in the collection of samples and epidemiological information. J. Caballero-Gómez is supported by an FPU grant from the Spanish Ministry of Science, Innovation, and Universities (FPU17/01319) and S. Jiménez-Ruiz holds a Ph.D. contract from the UCLM co-supported by the European Social Fund (2018/12504).

Conflicts of Interest

The authors declare there are no conflicts of interest.

References

  1. Delibes-Mateos, M.; Redpath, S.M.; Angulo, E.; Ferreras, P.; Villafuerte, R. Rabbits as a keystone species in southern Europe. Biol. Conserv. 2007, 137, 149–156. [Google Scholar] [CrossRef]
  2. Gortazar, C.; Millán, J.; Acevedo, P.; Escudero, M.A.; Marco, J.; De Luco, D.F. A large-scale survey of brown hare Lepus europaeus and Iberian hare L. granatensis populations at the limit of their ranges. Wild. Biol. 2007, 13, 244–250. [Google Scholar] [CrossRef] [Green Version]
  3. Ferrer, M.; Negro, J.J. The near extinction of two large European predators: Super specialists pay a price. Conserv. Biol. 2004, 18, 344–349. [Google Scholar] [CrossRef]
  4. Ministerio de Agricultura, Pesca y Alimentación (MAPA). Available online: https://www.mapa.gob.es/es/desarrollo-rural/estadisticas/caza_pesca.aspx (accessed on 2 November 2020).
  5. Wang, L.F.; Crameri, G. Emerging zoonotic viral diseases. Rev. Sci. Tech. 2014, 33. [Google Scholar] [CrossRef]
  6. Jiménez, M.; González, E.; Martín-Martín, I.; Hernández, S.; Molina, R. Could wild rabbits (Oryctolagus cuniculus) be reservoirs for Leishmania infantum in the focus of Madrid, Spain? Vet. Parasitol. 2014, 202, 296–300. [Google Scholar] [CrossRef]
  7. Fernández-Aguilar, X.; Alzaga, V.; Villanúa, D.; Cabezón, O.; García-Bocanegra, I.; Dubey, J.P.; Almería, S. Epidemiology and prevalence of Toxoplasma gondii infection in the Iberian hare (Lepus granatensis). Vet. Parasitol. 2013, 196, 194–198. [Google Scholar] [CrossRef]
  8. Molina, R.; Jiménez, M.I.; Cruz, I.; Iriso, A.; Martín-Martín, I.; Sevillano, O.; Melero, S.; Bernal, J. The hare (Lepus granatensis) as potential sylvatic reservoir of Leishmania infantum in Spain. Vet. Parasitol. 2012, 190, 268–271. [Google Scholar] [CrossRef]
  9. Snowden, K. Microsporidia in higher vertebrates. In Microsporidia: Pathogens of Opportunity; Weiss, L., Becnel, J., Eds.; John Wiley & Sons: Hoboken, NJ, USA, 2014; pp. 469–491. [Google Scholar] [CrossRef]
  10. Qiu, L.; Xia, W.; Li, W.; Ping, J.; Ding, S.; Liu, H. The prevalence of microsporidia in China: A systematic review and meta-analysis. Sci. Rep. 2019, 9, 1–9. [Google Scholar] [CrossRef]
  11. Santín, M.; Calero-Bernal, R.; Carmena, D.; Mateo, M.; Balseiro, A.; Barral, M.; Barbero, F.L.; Habela, M.Á. Molecular characterization of Enterocytozoon bieneusi in wild carnivores in Spain. J. Eukaryot. Microbiol. 2018, 65, 468–474. [Google Scholar] [CrossRef]
  12. Weiss, L. Microsporidiosis. In Hunter’s Tropical Medicine and Emerging Infectious Disease, 10th ed.; Magill, A.J., Ryan, E.T., Eds.; Elsevier: Amsterdam, The Netherlands, 2020; pp. 825–831. [Google Scholar] [CrossRef]
  13. Didier, E.S.; Stovall, M.E.; Green, L.C.; Brindley, P.J.; Sestak, K.; Didier, P.J. Epidemiology of microsporidiosis: Sources and modes of transmission. Vet. Parasitol. 2004, 126, 145–166. [Google Scholar] [CrossRef]
  14. Bártová, E.; Marková, J.; Sedlak, K. Prevalence of antibodies to Encephalitozoon cuniculi in European hares (Lepus europaeus). Ann. Agric. Environ. Med. 2015, 22, 674–676. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Zanet, S.; Palese, V.; Trisciuoglio, A.; Alonso, C.C.; Ferroglio, E. Encephalitozoon cuniculi, Toxoplasma gondii and Neospora caninum infection in invasive Eastern Cottontail Rabbits Sylvilagus floridanus in Northwestern Italy. Vet. Parasitol. 2013, 197, 682–684. [Google Scholar] [CrossRef] [PubMed]
  16. Künzel, F.; Joachim, A. Encephalitozoonosis in rabbits. Parasitol. Res. 2010, 106, 299–309. [Google Scholar] [CrossRef] [PubMed]
  17. De Bosschere, H.; Wang, Z.; Orlandi, P.A. First diagnosis of Encephalitozoon intestinalis and E. hellem in a European brown hare (Lepus europaeus) with kidney lesions. Zoonoses Public Health 2007, 54, 131–134. [Google Scholar] [CrossRef]
  18. Morsy, E.A.; Salem, H.M.; Khattab, M.S.; Hamza, D.A.; Abuowarda, M.M. Encephalitozoon cuniculi infection in farmed rabbits in Egypt. Acta Vet. Scand. 2020, 62, 1–11. [Google Scholar] [CrossRef]
  19. Wasson, K.; Peper, R.L. Mammalian microsporidiosis. Vet. Pathol. 2000, 37, 113–128. [Google Scholar] [CrossRef] [Green Version]
  20. Hinney, B.; Sak, B.; Joachim, A.; Kváč, M. More than a rabbit’s tale–Encephalitozoon spp. in wild mammals and birds. Int. J. Parasitol. Parasites Wildl. 2016, 5, 76–87. [Google Scholar] [CrossRef] [Green Version]
  21. Thrusfield, M. Veterinary Epidemiology, 4th ed.; Wiley Backweel: Hoboken, NJ, USA, 2018. [Google Scholar]
  22. Da Silva, A.J.; Schwartz, D.A.; Visvesvara, G.S.; De Moura, H.; Slemenda, S.B.; Pieniazek, N.J. Sensitive PCR diagnosis of Infections by Enterocytozoon bieneusi (microsporidia) using primers based on the region coding for small-subunit rRNA. J. Clin. Microbiol. 1996, 34, 986–987. [Google Scholar] [CrossRef] [Green Version]
  23. Da Silva, A.J.; Slemenda, S.B.; Visvesvara, G.S.; Schwartz, D.A.; Wilcox, C.M.; Wallace, S.; Pieniazek, N.J. Detection of Septata intestinalis (Microsporidia) using polymerase chain reaction primers targeting the small subunit ribosomal RNA coding region. J. Mol. Diagn. 1997, 2, 47–52. [Google Scholar] [CrossRef]
  24. Visvesvara, G.S.; Leitch, G.J.; da Silva, A.J.; Croppo, G.P.; Moura, H.; Wallace, S.; Slemenda, S.B.; Schwartz, D.A.; Moss, D.; Bryan, R.T. Polyclonal and monoclonal antibody and PCR-amplified small-subunit rRNA identification of a microsporidian, Encephalitozoon hellem, isolated from an AIDS patient with disseminated infection. J. Clin. Microbiol. 1994, 32, 2760–2768. [Google Scholar] [CrossRef] [Green Version]
  25. De Groote, M.A.; Visvesvara, G.; Wilson, M.L.; Pieniazek, N.J.; Slemenda, S.B.; da Silva, A.J.; Gordon, J.L.; Bryan, R.T.; Reves, R. Polymerase chain reaction and culture confirmation of disseminated Encephalitozoon cuniculi in a patient with AIDS: Successful therapy with albendazole. J. Infect. Dis. 1995, 171, 1375–1378. [Google Scholar] [CrossRef]
  26. Del Aguila, C.; Izquierdo, F.; Navajas, R.; Pieniazek, N.J.; Miro, G.; Alonso, A.I.; Da Silva, A.J.; Fenoy, S. Enterocytozoon bieneusi in animals: Rabbits and dogs as new hosts. J. Eukaryot. Microbiol. 1999, 46, 8–9. [Google Scholar]
  27. Askari, Z.; Mirjalali, H.; Mohebali, M.; Zarei, Z.; Shojaei, S.; Rezaeian, T.; Rezaeian, M. Molecular detection and identification of zoonotic microsporidia spore in fecal samples of some animals with close-contact to human. Iran. J. Parasitol. 2015, 10, 381. [Google Scholar] [CrossRef] [PubMed]
  28. Galván-Díaz, A.L.; Magnet, A.; Fenoy, S.; Henriques-Gil, N.; Haro, M.; Gordo, F.P.; Miró, G.; Del águila, C.; Izquierdo, F. Microsporidia detection and genotyping study of human pathogenic E. bieneusi in animals from Spain. PLoS ONE 2014, 9, e106017. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  29. Lores, B.; Del Aguila, C.; Arias, C. Enterocytozoon bieneusi (microsporidia) in faecal samples from domestic animals from Galicia, Spain. Mem. Inst. Oswaldo Cruz 2002, 97, 941–945. [Google Scholar] [CrossRef] [Green Version]
  30. Dashti, A.; Rivero-Juarez, A.; Santín, M.; López-López, P.; Caballero-Gómez, J.; Frías-Casas, M.; Köster, P.C.; Bailo, B.; Briz, V.; Carmena, D. Enterocytozoon bieneusi (Microsporidia): Identification of novel genotypes and evidence of transmission between sympatric wild boars (Sus scrofa ferus) and Iberian pigs (Sus scrofa domesticus) in Southern Spain. Transbound. Emerg. Dis. 2020. [Google Scholar] [CrossRef]
  31. Abreu-Acosta, N.; Lorenzo-Morales, J.; Leal-Guio, Y.; Coronado-Álvarez, N.; Foronda, P.; Alcoba-Florez, J.; Izquierdo, F.; Batista-Díaz, N.; Del águila, C.; Valladares, B. Enterocytozoon bieneusi (microsporidia) in clinical samples from immunocompetent individuals in Tenerife, Canary Islands, Spain. Trans. R. Soc. Trop. Med. Hyg. 2005, 99, 848–855. [Google Scholar] [CrossRef]
  32. Galván, A.L.; Sánchez, A.M.; Valentín, M.P.; Henriques-Gil, N.; Izquierdo, F.; Fenoy, S.; Del Aguila, C. First cases of microsporidiosis in transplant recipients in Spain and review of the literature. J. Clin. Microbiol. 2011, 49, 1301–1306. [Google Scholar] [CrossRef] [Green Version]
  33. Lores, B.; López-Miragaya, I.; Arias, C.; Fenoy, S.; Torres, J.; Del Aguila, C. Intestinal Microsporidiosis Due to Enterocytozoon bieneusi in Elderly Human Immunodeficiency Virus–Negative Patients from Vigo, Spain. Clin. Infect. Dis. 2002, 34, 918–921. [Google Scholar] [CrossRef] [Green Version]
  34. Bednarska, M.; Bajer, A.; Siñski, E.; Wolska-Kusnierz, B.; Samoliñski, B.; Graczyk, T.M. Occurrence of intestinal microsporidia in immunodeficient patients in Poland. Ann. Agric. Environ. Med. 2014, 21, 244–248. [Google Scholar] [CrossRef] [Green Version]
  35. Talabani, H.; Sarfati, C.; Pillebout, E.; van Gool, T.; Derouin, F.; Menotti, J. Disseminated infection with a new genovar of Encephalitozoon cuniculi in a renal transplant recipient. J. Clin. Microbiol. 2010, 48, 2651–2653. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Mathis, A.; Weber, R.; Deplazes, P. Zoonotic potential of the microsporidia. Clin. Microbiol. Rev. 2005, 18, 423–445. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  37. Espinosa, J.; Ferreras, M.C.; Benavides, J.; Cuesta, N.; Pérez, C.; García Iglesias, M.J.; García Marín, J.F.; Pérez, V. Causes of Mortality and Disease in Rabbits and Hares: A Retrospective Study. Animals 2020, 10, 158. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  38. Csokai, J.; Joachim, A.; Gruber, A.; Tichy, A.; Pakozdy, A.; Künzel, F. Diagnostic markers for encephalitozoonosis in pet rabbits. Vet. Parasitol. 2009, 163, 18–26. [Google Scholar] [CrossRef]
  39. Bálent, P.; Halanova, M.; Sedlakova, T.; Valencakova, A.; Cislaková, L. Encephalitozoon cuniculi infection in rabbits and laboratory mice in eastern Slovakia. Bull. Vet. Inst. Pulawy 2004, 48, 113–116. [Google Scholar]
  40. Pipia, A.P.; Giobbe, M.; Mula, P.; Varcasia, A.; Sanna, G.; Walochnik, J.; Lavazza, A.; Scala, A. Epidemiological and Biomolecular Updates on Encephalitozoon cuniculi in Lagomorpha of Sardinia (Italy). In Veterinary Science: Current Aspects in Biology, Animal Pathology, Clinic, and Food Hygien; Pugliese, A., Gaiti, A., Eds.; Springer: Berlin/Heidelberg, Germany, 2012; pp. 47–50. [Google Scholar] [CrossRef]
  41. Ebani, V.V.; Poli, A.; Rocchigiani, G.; Bertelloni, F.; Nardoni, S.; Papini, R.A.; Mancianti, F. Serological survey on some pathogens in wild brown hares (Lepus europaeus) in Central Italy. Asian Pac. J. Trop. Med. 2016, 9, 465–469. [Google Scholar] [CrossRef]
  42. Tsukada, R.; Tsuchiyama, A.; Sasaki, M.; Park, C.H.; Fujii, Y.; Takesue, M.; Hatai, H.; Kudo, N.; Ikadai, H. Encephalitozoon infections in Rodentia and Soricomorpha in Japan. Vet. Parasitol. 2013, 198, 193–196. [Google Scholar] [CrossRef]
Animals 10 02218 g001 550
Figure 1. Map of Andalusia (southern Spain) showing the locations of European wild rabbits (dots) and Iberian hares (triangles) sampled. Green and red symbols indicate negative and positive animals, respectively, detected in these hunting areas.
Figure 1. Map of Andalusia (southern Spain) showing the locations of European wild rabbits (dots) and Iberian hares (triangles) sampled. Green and red symbols indicate negative and positive animals, respectively, detected in these hunting areas.
Animals 10 02218 g001
Table
Table 1. Primers used for the detection of Enterocytozoon bieneusi, Encephalitozoon intestinalis, Encephalitozoon hellem, and Encephalitozoon cuniculi.
Table 1. Primers used for the detection of Enterocytozoon bieneusi, Encephalitozoon intestinalis, Encephalitozoon hellem, and Encephalitozoon cuniculi.
Microspodia SpeciesPrimersForward Sequence (5′-3′)Reverse Sequence (5′-3′)Obtained Amplicon SizeReference
E. bieneusiEBIEF1/EBIER1GAAACTTGTCCACTCCTTACGCCATGCACCACTCCTGCCATT607[22]
E. intestinalisSINTF/SINTRTTTCGAGTGTAAAGGAGTCGATGCCATGCACTCACAGGCATC822[23]
E. hellemEHELF/EHELRTGAGAAGTAAGATGTTTAGCAGTAAAAACACTCTCACACTCA547[24]
E. cuniculiECUNF/ECUNRATGAGAAGTGATGTGTGTGCGTGCCATGCACTCACAGGCATC549[25]
Table
Table 2. Prevalence of zoonotic microsporidia (Enterocytozoon bieneusi, Encephalitozoon intestinalis, Encephalitozoon hellem, and Encephalitozoon cuniculi) in organ meats from wild lagomorph species in Andalusia, southern Spain.
Table 2. Prevalence of zoonotic microsporidia (Enterocytozoon bieneusi, Encephalitozoon intestinalis, Encephalitozoon hellem, and Encephalitozoon cuniculi) in organ meats from wild lagomorph species in Andalusia, southern Spain.
VariableCategoriesPrevalence (No. Positives/Overall) †
Microsporidia E. bieneusiE. intestinalisE. hellemE. cuniculi
SpeciesIberian hare3.8 (3/79)0 (0/79)3.8 (3/79)0 (0/79)0 (0/79)
Wild rabbit1.0 (4/383)0.8 (3/383)0.3 (1/383)0 (0/383)0 (0/383)
ProvinceCadiz0 (0/56)0 (0/56)0 (0/56)0 (0/56)0 (0/56)
Cordoba7.0 (3/43)2.3 (1/43)4.6 (2/43)0 (0/43)0 (0/43)
Jaen2.4 (2/82)1.2 (1/82)1.2 (1/82)0 (0/82)0 (0/82)
Almeria0 (0/52)0 (0/52)0 (0/52)0 (0/52)0 (0/52)
Malaga0 (0/67)0 (0/67)0 (0/67)0 (0/67)0 (0/67)
Seville3.7 (2/54)1.8 (1/54)1.8 (1/54)0 (0/54)0 (0/54)
Granada0 (0/49)0 (0/49)0 (0/49)0 (0/49)0 (0/49)
Huelva0 (0/59)0 (0/59)0 (0/59)0 (0/59)0 (0/59)
Year20151.2 (4/349)0.9 (3/349)0.3 (1/349)0 (0/349)0 (0/349)
20160 (0/1)0 (0/1)0 (0/1)0 (0/1)0 (0/1)
20170 (0/33)0 (0/33)0 (0/33)0 (0/33)0 (0/33)
20183.8 (3/79)0 (0/79)3.8 (3/79)0 (0/79)0 (0/79)
AgeYearling5.0 (1/20)0 (0/20)5.0 (1/20)0 (0/20)0 (0/20)
Subadult1.6 (1/62)1.6 (1/62)0 (0/62)0 (0/62)0 (0/62)
Adult1.1 (4/366)0.6 (2/366)0.6 (2/366)0 (0/366)0 (0/366)
SexFemale0.9 (2/235)0.4 (1/235)0.4 (1/235)0 (0/235)0 (0/235)
Male1.9 (4/212)0.9 (2/212)0.9 (2/212)0 (0/212)0 (0/212)
† Prevalences are depicted as percentages. Missing values omitted.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Martínez-Padilla, A.; Caballero-Gómez, J.; Magnet, Á.; Gómez-Guillamón, F.; Izquierdo, F.; Camacho-Sillero, L.; Jiménez-Ruiz, S.; del Águila, C.; García-Bocanegra, I. Zoonotic Microsporidia in Wild Lagomorphs in Southern Spain. Animals 2020, 10, 2218. https://doi.org/10.3390/ani10122218

AMA Style

Martínez-Padilla A, Caballero-Gómez J, Magnet Á, Gómez-Guillamón F, Izquierdo F, Camacho-Sillero L, Jiménez-Ruiz S, del Águila C, García-Bocanegra I. Zoonotic Microsporidia in Wild Lagomorphs in Southern Spain. Animals. 2020; 10(12):2218. https://doi.org/10.3390/ani10122218

Chicago/Turabian Style

Martínez-Padilla, Anabel, Javier Caballero-Gómez, Ángela Magnet, Félix Gómez-Guillamón, Fernando Izquierdo, Leonor Camacho-Sillero, Saúl Jiménez-Ruiz, Carmen del Águila, and Ignacio García-Bocanegra. 2020. "Zoonotic Microsporidia in Wild Lagomorphs in Southern Spain" Animals 10, no. 12: 2218. https://doi.org/10.3390/ani10122218

APA Style

Martínez-Padilla, A., Caballero-Gómez, J., Magnet, Á., Gómez-Guillamón, F., Izquierdo, F., Camacho-Sillero, L., Jiménez-Ruiz, S., del Águila, C., & García-Bocanegra, I. (2020). Zoonotic Microsporidia in Wild Lagomorphs in Southern Spain. Animals, 10(12), 2218. https://doi.org/10.3390/ani10122218

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop