Honokiol Alleviates High-Fat Diet-Induced Obesity of Mice by Inhibiting Adipogenesis and Promoting White Adipose Tissue Browning
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Animals and Treatments
2.3. Histological Analysis
2.4. Preparation of Protein Samples
2.5. Proteomics Analysis
2.6. RT-qPCR Analysis
2.7. Western Blot Analysis
2.8. Statistical Analysis
3. Results
3.1. HON Mitigates the Body Fat Ratio and Average Adipocyte Diameter in HFD-Induced Mice
3.2. HON Influences the Expression of Proteins in the Adipose Tissue of HFD-Fed Mice
3.3. HON Affects the Epididymal WAT Browning-Related Gene Expression in HFD-Fed Mice
3.4. HON Regulates the Epididymal WAT Browning-Related Protein Expression in HFD-Fed Mice
3.5. HON Increases the Expression of UCP1 in the Inguinal WAT of HFD-Fed Mice
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Popkin, B.M.; Adair, L.S.; Ng, S.W. Global nutrition transition and the pandemic of obesity in developing countries. Nutr. Rev. 2012, 70, 3–21. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Blüher, M. Adipose tissue dysfunction contributes to obesity related metabolic diseases. Best Pract. Res. Clin. Endocrinol. Metab. 2013, 27, 163–177. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.Y.; van de Wall, E.; Laplante, M.; Azzara, A.; Trujillo, M.E.; Hofmann, S.M.; Schraw, T.; Durand, J.L.; Li, H.; Li, G.; et al. Obesity-associated improvements in metabolic profile through expansion of adipose tissue. J. Clin. Investig. 2007, 117, 2621–2637. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Saely, C.H.; Geiger, K.; Drexel, H. Brown versus White Adipose Tissue: A Mini-Review. Gerontology 2012, 58, 15–23. [Google Scholar] [CrossRef]
- Grimpo, K.; Völker, M.N.; Heppe, E.N.; Braun, S.; Heverhagen, J.T.; Heldmaier, G. Brown adipose tissue dynamics in wild-type and UCP1-knockout mice: In vivo insights with magnetic resonance. J. Lipid Res. 2014, 55, 398–409. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nedergaard, J.; Cannon, B. The Browning of White Adipose Tissue: Some Burning Issues. Cell Metab. 2014, 20, 396–407. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, J.; Bostrom, P.; Sparks, L.M.; Ye, L.; Choi, J.H.; Giang, A.H.; Khandekar, M.; Virtanen, K.A.; Nuutila, P.; Schaart, G.; et al. Beige adipocytes are a distinct type of thermogenic fat cell in mouse and human. Cell 2012, 150, 366–376. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Z.; Zhang, H.; Li, B.; Meng, X.; Wang, J.; Zhang, Y.; Yao, S.; Ma, Q.; Jin, L.; Yang, J.; et al. Berberine activates thermogenesis in white and brown adipose tissue. Nat. Commun. 2014, 5, 5439. [Google Scholar] [CrossRef] [Green Version]
- Ohyama, K.; Nogusa, Y.; Shinoda, K.; Suzuki, K.; Bannai, M.; Kajimura, S. A Synergistic Antiobesity Effect by a Combination of Capsinoids and Cold Temperature Through Promoting Beige Adipocyte Biogenesis. Diabetes 2016, 65, 1410–1423. [Google Scholar] [CrossRef] [Green Version]
- Wang, S.; Liang, X.; Yang, Q.; Fu, X.; Rogers, C.J.; Zhu, M.; Rodgers, B.D.; Jiang, Q.; Dodson, M.V.; Du, M. Resveratrol induces brown-like adipocyte formation in white fat through activation of AMP-activated protein kinase (AMPK) alpha1. Int. J. Obes. 2015, 39, 967–976. [Google Scholar] [CrossRef] [Green Version]
- Fried, L.E.; Arbiser, J.L. Honokiol, a multifunctional antiangiogenic and antitumor agent. Antioxid Redox Signal. 2009, 11, 1139–1148. [Google Scholar] [CrossRef]
- Arora, S.; Singh, S.; Piazza, G.A.; Contreras, C.M.; Panyam, J.; Singh, A.P. Honokiol: A novel natural agent for cancer prevention and therapy. Curr. Mol. Med. 2012, 12, 1244. [Google Scholar] [CrossRef] [PubMed]
- Costa, A.; Facchini, G.; Pinheiro, A.; Da, S.M.; Bonner, M.Y.; Arbiser, J.; Eberlin, S. Honokiol protects skin cells against inflammation, collagenolysis, apoptosis, and senescence caused by cigarette smoke damage. Int. J. Dermatol. 2017, 56, 754–761. [Google Scholar] [CrossRef] [PubMed]
- Zhong, X.; Liu, H. Honokiol attenuates diet-induced non-alcoholic steatohepatitis by regulating macrophage polarization through activating peroxisome proliferator-activated receptor γ. J. Gastroenterol. Hepatol. 2018, 33, 524–532. [Google Scholar] [CrossRef] [PubMed]
- Lu, J.Y.; Huang, K.C.; Chang, L.C.; Huang, Y.S.; Chi, Y.C.; Su, T.C.; Chen, C.L.; Yang, W.S. Adiponectin: A biomarker of obesity-induced insulin resistance in adipose tissue and beyond. J. Biomed. Sci. 2018, 15, 565–576. [Google Scholar] [CrossRef] [PubMed]
- Lone, J.; Yun, J.W. Honokiol exerts dual effects on browning and apoptosis of adipocytes. Pharmacol. Rep. 2017, 69, 1357–1365. [Google Scholar] [CrossRef] [PubMed]
- Alonso-Castro, A.J.; Zapata-Bustos, R.; Domínguez, F.; García-Carrancá, A.; Salazar-Olivo, L.A. Magnolia dealbata Zucc and its active principles honokiol and magnolol stimulate glucose uptake in murine and human adipocytes using the insulin-signaling pathway. Phytomedicine 2011, 18, 926–933. [Google Scholar] [CrossRef]
- Atanasov, A.G.; Wang, J.N.; Gu, S.P.; Bu, J.; Kramer, M.P.; Baumgartner, L.; Fakhrudin, N.; Ladurner, A.; Malainer, C.; Vuorinen, A.; et al. Honokiol: A non-adipogenic PPARγ agonist from nature. Biochim. Biophys. Acta Gen. Subj. 2013, 1830, 4813–4819. [Google Scholar] [CrossRef] [Green Version]
- Kim, Y.J.; Choi, M.S.; Cha, B.Y.; Woo, J.T.; Park, Y.B.; Kim, S.R.; Jung, U.J. Long-term supplementation of honokiol and magnolol ameliorates body fat accumulation, insulin resistance, and adipose inflammation in high-fat fed mice. Mol. Nutr. Food Res. 2013, 57, 1988–1998. [Google Scholar] [CrossRef]
- Flachs, P.; Horakova, O.; Brauner, P.; Rossmeisl, M.; Pecina, P.; Franssen-van Hal, N.; Ruzickova, J.; Sponarova, J.; Drahota, Z.; Vlcek, C.; et al. Polyunsaturated fatty acids of marine origin upregulate mitochondrial biogenesis and induce-beta oxidation in white fat. Diabetologia 2005, 48, 2365–2375. [Google Scholar] [CrossRef] [Green Version]
- Mercader, J.; Ribot, J.; Murano, I.; Felipe, F.; Cinti, S.; Bonet, M.L.; Palou, A. Remodeling of White Adipose Tissue after Retinoic Acid Administration in Mice. Endocrinology 2006, 147, 5325–5332. [Google Scholar] [CrossRef] [Green Version]
- Mercader, J.; Madsen, L.; Felipe, F.; Palou, A.; Kristiansen, K.; Bonet, L. All-Trans Retinoic Acid Increases Oxidative Metabolism in Mature Adipocytes. Cell. Physiol. Biochem. 2007, 20, 1061–1072. [Google Scholar] [CrossRef] [PubMed]
- Vögler, O.; López-Bellan, A.; Alemany, R.; Tofé, S.; González, M.; Quevedo, J.; Pereg, V.; Barcelo, F.; Escriba, P.V. Structure-effect relation of C18 long-chain fatty acids in the reduction of body weight in rats. Int. J. Obes. 2008, 32, 464–473. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Akagiri, S.; Naito, Y.; Ichikawa, H.; Mizushima, K.; Takagi, T.; Handa, O.; Kokura, S.; Yoshikawa, T. Bofutsushosan, an Oriental Herbal Medicine, Attenuates the Weight Gain of White Adipose Tissue and the Increased Size of Adipocytes Associated with the Increase in Their Expression of Uncoupling Protein 1 in High-Fat Diet-Fed Male KK/Ta mice. J. Clin. Biochem. Nutr. 2008, 42, 158–166. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kotani, H.; Tanabe, H.; Mizukami, H.; Makishima, M.; Inoue, M. Identification of a Naturally Occurring Rexinoid, Honokiol, That Activates the Retinoid X Receptor. J. Nat. Prod. 2010, 73, 1332–1336. [Google Scholar] [CrossRef] [PubMed]
- Muzik, O.; Mangner, T.J.; Leonard, W.R.; Kumar, A.; Granneman, J.G. Sympathetic Innervation of Cold-Activated Brown and White Fat in Lean Young Adults. J. Nucl. Med. 2017, 58, 799–806. [Google Scholar] [CrossRef] [Green Version]
- Bradshaw, M.P.; Prenzler, P.D.; Scollary, G.R. Ascorbic Acid-Induced Browning of (+)-Catechin In a Model Wine System. J. Agr. Food Chem. 2001, 49, 934–939. [Google Scholar] [CrossRef]
- Zou, T.; Chen, D.; Yang, Q.; Wang, B.; Zhu, M.; Nathanielsz, P.W.; Du, M. Resveratrol supplementation of high-fat diet-fed pregnant mice promotes brown and beige adipocyte development and prevents obesity in male offspring. J. Physiol. 2017, 595, 1547–1562. [Google Scholar] [CrossRef]
- Kalinovich, A.V.; de Jong, J.M.; Cannon, B.; Nedergaard, J. UCP1 in adipose tissues: Two steps to full browning. Biochimie 2017, 124, 127–137. [Google Scholar] [CrossRef]
- Ricquier, D.; Bouillaud, F. The uncoupling protein homologues: UCP1, UCP2, UCP3, StUCP and AtUCP. Biochem. J. 2000, 345 Pt 2, 161–179. [Google Scholar] [CrossRef]
- Shabalina, I.G.; Petrovic, N.; de Jong, J.M.A.; Kalinovich, A.V.; Cannon, B.; Nedergaard, J. UCP1 in Brite/Beige Adipose Tissue Mitochondria Is Functionally Thermogenic. Cell Rep. 2013, 5, 1196–1203. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rosen, E.D.; Hsu, C.; Wang, X.; Sakai, S.; Freeman, M.W.; Gonzalez, F.J.; Spiegelman, B.M. C/EBPα induces adipogenesis through PPARγ: A unified pathway. Gene Dev. 2002, 16, 22–26. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Linhart, H.G.; Ishimura-Oka, K.; DeMayo, F.; Kibe, T.; Repka, D.; Poindexter, B.; Bick, R.J.; Darlington, G.J. C/EBPα is required for differentiation of white, but not brown, adipose tissue. Mol. Biol. Rep. 2001, 47, 1161–1171. [Google Scholar]
- Yang, G.; Lee, J.; Lee, S.; Kwak, D.; Choe, W.; Kang, I.; Kim, S.S.; Ha, J. Krill Oil Supplementation Improves Dyslipidemia and Lowers Body Weight in Mice Fed a High-Fat Diet through Activation of AMP-Activated Protein Kinase. J. Med. Food. 2016, 19, 1120–1129. [Google Scholar] [CrossRef] [PubMed]
- Salt, I.P.; Hardie, D.G. AMP-Activated Protein Kinase. Circ. Res. 2017, 120, 1825–1841. [Google Scholar] [CrossRef] [Green Version]
- Carling, D. The AMP-activated protein kinase cascade—a unifying system for energy control. Trends Biochem. Sci. 2004, 29, 18–24. [Google Scholar] [CrossRef]
- Imran, K.M.; Yoon, D.; Kim, Y. A pivotal role of AMPK signaling in medicarpin-mediated formation of brown and beige. Biofactors 2018, 44, 168–179. [Google Scholar] [CrossRef]
- Li, T.; Gao, J.; Du, M.; Song, J.; Mao, X. Milk Fat Globule Membrane Attenuates High-Fat Diet-Induced Obesity by Inhibiting Adipogenesis and Increasing Uncoupling Protein 1 Expression in White Adipose Tissue of Mice. Nutrients 2018, 10, 331. [Google Scholar] [CrossRef] [Green Version]
- Abu-Elheiga, L.; Brinkley, W.R.; Zhong, L.; Chirala, S.S.; Woldegiorgis, G.; Wakil, S.J. The subcellular localization of acetyl-CoA carboxylase 2. Proc. Natl. Acad. Sci. USA 2000, 97, 1444–1449. [Google Scholar] [CrossRef] [Green Version]
- Yuan, E.; Duan, X.; Xiang, L.; Ren, J.; Lai, X.; Li, Q.; Sun, L.; Sun, S. Aged Oolong Tea Reduces High-Fat Diet-Induced Fat Accumulation and Dyslipidemia by Regulating the AMPK/ACC Signaling Pathway. Nutrients 2018, 10, 187. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Y.; Liu, X.; Han, L.; Gao, X.; Liu, E.; Wang, T. Regulation of lipid and glucose homeostasis by mango tree leaf extract is mediated by AMPK and PI3K/AKT signaling pathways. Food Chem. 2013, 141, 2896–2905. [Google Scholar] [CrossRef] [PubMed]
- Mercader, J.; Palou, A.; Bonet, M.L. Induction of Uncoupling Protein-1 in Mouse Embryonic Fibroblast-derived Adipocytes by Retinoic Acid. Obesity 2010, 18, 655–662. [Google Scholar] [CrossRef]
- Wolfgang, M.J.; Lane, M.D. Hypothalamic malonyl-CoA and CPT1c in the treatment of obesity. FEBS J. 2011, 278, 552–558. [Google Scholar] [CrossRef] [PubMed]
- Fedorenko, A.; Lishko, P.V.; Kirichok, Y. Mechanism of Fatty-Acid-Dependent UCP1 Uncoupling in Brown Fat Mitochondria. Cell 2012, 151, 400–413. [Google Scholar] [CrossRef] [Green Version]
- Chouchani, E.T.; Kazak, L.; Jedrychowski, M.P.; Lu, G.Z.; Erickson, B.K.; Szpyt, J.; Pierce, K.A.; Laznik-Bogoslavski, D.; Vetrivelan, R.; Clish, C.B.; et al. Mitochondrial ROS regulate thermogenic energy expenditure and sulfenylation of UCP1. Nature 2016, 532, 112–116. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Genes | Primer Sequence (5′–3′) | |
---|---|---|
UCP1 | Forward | ACTGCCACACCTCCAGTCATT |
Reverse | CTTTGCCTCACTCAGGATTGG | |
SOAT1 | Forward | AACTCCATCTTGCCAGGTGTCTTG |
Reverse | ACCACGTTCCAGGTCCTGTAGTAG | |
ACC | Forward | TTGAAGGCACAGTGAAGGCTTACG |
Reverse | GACGCCATCTTCCTCTGTCAGTTG | |
CPT1A | Forward | GTGGCATCTCCTTTAACTCAAC |
Reverse | CGGCGTTGAAGATCTTGTATTC | |
β-actin | Forward | GACATTTGAGAAGGGCCACAT |
Reverse | CAAAGAGGTCCAAAACAATCG |
Database 1 | Tatal Spectra 2 | Spectra (PSM) 3 | Peptides 4 | Protein Groups 5 |
---|---|---|---|---|
Mus musculus | 364220 | 68436 | 30981 | 5130 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ding, Y.; Zhang, L.; Yao, X.; Zhang, H.; He, X.; Fan, Z.; Song, Z. Honokiol Alleviates High-Fat Diet-Induced Obesity of Mice by Inhibiting Adipogenesis and Promoting White Adipose Tissue Browning. Animals 2021, 11, 1493. https://doi.org/10.3390/ani11061493
Ding Y, Zhang L, Yao X, Zhang H, He X, Fan Z, Song Z. Honokiol Alleviates High-Fat Diet-Induced Obesity of Mice by Inhibiting Adipogenesis and Promoting White Adipose Tissue Browning. Animals. 2021; 11(6):1493. https://doi.org/10.3390/ani11061493
Chicago/Turabian StyleDing, Yanan, Longlin Zhang, Xiaofeng Yao, Haihan Zhang, Xi He, Zhiyong Fan, and Zehe Song. 2021. "Honokiol Alleviates High-Fat Diet-Induced Obesity of Mice by Inhibiting Adipogenesis and Promoting White Adipose Tissue Browning" Animals 11, no. 6: 1493. https://doi.org/10.3390/ani11061493
APA StyleDing, Y., Zhang, L., Yao, X., Zhang, H., He, X., Fan, Z., & Song, Z. (2021). Honokiol Alleviates High-Fat Diet-Induced Obesity of Mice by Inhibiting Adipogenesis and Promoting White Adipose Tissue Browning. Animals, 11(6), 1493. https://doi.org/10.3390/ani11061493