Next Article in Journal
Detection and Genomic Characterization of Bovine Rhinitis Virus in China
Next Article in Special Issue
Molecular Identification of Sarcocystis rileyi and Sarcocystis sp. (Closely Related to Sarcocystis wenzeli) in Intestines of Mustelids from Lithuania
Previous Article in Journal
Time Farms Stay Naïve for Porcine Reproductive and Respiratory Syndrome
Previous Article in Special Issue
Survey of Zoonotic Diarrheagenic Protist and Hepatitis E Virus in Wild Boar (Sus scrofa) of Portugal
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 13
Issue 2
10.3390/ani13020311
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

A Case of Bovine Eosinophilic Myositis (BEM) Associated with Co-Infection by Sarcocystis hominis and Toxoplasma gondii

by
Filippo Maria Dini
*,
Monica Caffara
,
Joana G. P. Jacinto
,
Cinzia Benazzi
,
Arcangelo Gentile
and
Roberta Galuppi
Department of Veterinary Medical Sciences, University of Bologna, Ozzano dell’Emilia, 40064 Bologna, Italy
*
Author to whom correspondence should be addressed.
Animals 2023, 13(2), 311; https://doi.org/10.3390/ani13020311
Submission received: 24 December 2022 / Revised: 11 January 2023 / Accepted: 13 January 2023 / Published: 16 January 2023
(This article belongs to the Special Issue Molecular Identification, Taxonomy and Genetic Variation of Parasite in Animals)
Browse Figures
Review Reports Versions Notes

Abstract

:

Simple Summary

In this study, a peculiar case of bovine eosinophilic myositis (BEM) observed in a beef cattle is described. BEM is a specific inflammatory myopathy, often associated with Sarcocystis spp., with multifocal gray-green lesions that can lead to considerable economic losses and public health issues. Through histological, molecular, and serological analyses, we confirmed the first detection of T. gondii DNA in a case of BEM, associated with the coinfection by S. hominis. Molecular results highlighted DNA of both pathogens within the lesion, in healthy muscle and or in the meat juice pellets, drawing attention to the possible role that a co-infection of T. gondii with Sarcocystis sp. may play in evoking BEM lesions.

Abstract

Bovine eosinophilic myositis (BEM) is a specific inflammatory myopathy, often associated with Sarcocystis spp., with multifocal gray-green lesions leading to carcass condemnation with considerable economic losses. Here is described a peculiar case of BEM that occurred in an adult (16 month) cattle, born in France, bred, and slaughtered in Italy at the end of 2021. On inspection, muscles showed the typical multifocal gray-green lesions that were sampled for, cytological, histological, and molecular investigations, while meat juice was subjected to IFAT for Toxoplasma IgG. Genomic DNA was extracted from lesions, portions of healthy muscle and from meat juice pellet and analyzed by PCR targeting 18S rDNA, COI mtDNA and B1 genes, and sequenced. The cytology showed inflammatory cells mostly referable to eosinophils; at histology, protozoan cysts and severe granulomatous myositis were observed. A BEM lesion and meat juice pellet subjected to PCR showed, concurrently, sequences referable both to S. hominis and T. gondii. Meat juice IFAT resulted negative for T. gondii IgG. Our findings highlight the first detection of T. gondii DNA in association with S. hominis in a BEM case, suggesting a multiple parasite infection associated with this pathology, although the actual role of T. gondii infection in the pathophysiology of the diseases should be clarified.

1. Introduction

Sarcocystis is an Apicomplexan parasite infecting several hosts including humans. Among the more than 200 Sarcocystis species at least six are recognized as infecting bovine muscular tissue, namely, S. hirsuta, S. bovifelis, S. bovini, S. cruzi, S. hominis and S. heydorni. Felids serve as definitive hosts of the first three species, canids are definitive hosts of S. cruzi, while S. hominis and S. heydorni are zoonotic [1,2,3].
Over the past few years, several species of Sarcocystis associated with eosinophilic lesions in bovine muscles have been reported. Their identification has been based on histological observation of the cyst wall thickness, separating the species forming thick-walled (2–7 μm) sarcocysts and thin-walled (<1 μm) sarcocysts [4]. The most common Sarcocystis species in cattle belonging to the first group are S. hominis, S. bovifelis, S. bovini and S. hirsuta [4,5,6], while the second group includes S. cruzi and S. heydorni [7,8]. As some of the abovementioned species forming thick- (S. bovifelis and S. bovini) and thin- (S. heydorni) walled cysts have been recently described, misidentification may have occurred in the past with reference to etiology of bovine eosinophilic myositis [9].
Bovine eosinophilic myositis (BEM) is a specific inflammatory myopathy characterized by typical grey-green lesions in cattle muscles, visible during post-mortem inspection [4]. Although the etiology of the eosinophilic myositis remains uncertain [9], this condition in cattle is often associated with Sarcocystis sp. infection and can lead to carcass condemnation [10]. It has been hypothesized that the pathogenesis is linked with cysts’ degeneration together with the establishment of a hypersensitivity response towards the parasite [11]. Supporting this hypothesis is the finding of intralesional Sarcocystis species inside the eosinophilic granulomatous lesions [4,5,7] and the ability of Sarcocystis sp. antigens to induce an eosinophilic granulocyte-mediated immune response [12]. However, except for the latter study, BEM has never been reported during experimental infection with Sarcocystis [11]. The prevalence of BEM is very low worldwide, ranging from 0.002 up to 5% [5], while the prevalence of Sarcocysts sp. infection in cattle is extremely high, with values in Italy ranging from 67.8% up to 95% [1,13,14,15,16]. A possible explanation of this discrepancy could be that BEM may be associated with one or more specific Sarcocystis species [5], including those that are zoonotic. For this reason, the correct identification of the species involved in BEM is crucial in order to assess the risk for the consumer of eating raw or undercooked meat [13,17].
So far sequencing the 18S rDNA has been widely used for Sarcocystis species identification, even if several authors pointed out that misidentification may occur due to high conservative characters of this gene, as for example among S. bovini, S. bovifelis and S. hominis [6,18,19,20]. Therefore, cytochrome C oxidase subunit I mitochondrial (COI mtDNA) gene has recently been exploited as a useful genetic marker for the Sarcocystidae and has proved to be useful in resolving unclear species boundaries of closely related Sarcocystis spp. in different hosts [2,18,21,22]. In the wake of this evidence, molecular techniques have been recently developed to clarify the identification of Sarcocystis species infecting cattle, confirming the higher discriminatory power of COI mitochondrial gene for Sarcocystis species identification [23]. A novel species-specific multiplex PCR assay for the simultaneous identification of all the species of the genus Sarcocystis reported in cattle in Italy has been recently developed by Rubiola et al. [19]. Through this new molecular approach, during an investigation on the presence of Sarcocystis species in BEM cases, the presence of S. bovifelis and S. hominis has been observed and seems to be considerably higher in specimens isolated from BEM condemned carcasses than in samples isolated from randomly sampled slaughter cattle [1]; anyway, Sarcocystis species seem to be predominant in different geographical areas [9].
Furthermore, possible co-infections between Sarcocystis spp. and other Apicomplexa parasites, such as Toxoplasma gondii have been described in cattle [24,25,26,27]. Toxoplasma gondii is a widespread zoonotic protozoon that can also lead to important economic impacts in livestock, causing mainly reproductive failure in small ruminants [28]. In contrast to small ruminants, cattle appear to be largely resistant to T. gondii infections and rarely showed the presence of tissue cysts [29]. Reports on clinical toxoplasmosis in naturally infected cattle are rare and comprised only abortions in association with the isolation of T. gondii from the fetuses [30].
Our study presents a severe case of BEM in a Limousine bull imported from France and fattened and slaughtered in Italy by characterizing in detail the gross-pathological, cytological and histological features and by identifying the associated etiology by serologic and molecular analysis.

2. Materials and Methods

2.1. Source Material

Portions of muscle (gluteus, semimembranosus, and semitendinosus) from a clinically healthy 16-month-old Limousine bull were conferred at the Department of Veterinary Medical Sciences of Bologna University because of suspected sarcosporidiosis. The bull was born in France and imported to a fattening unit in the province of Verona (Italy) at the age of 10 months to be fattened and then slaughtered. No signs of disease were observed during the entire period of fattening in Italy and no differences in body weight were noticed when compared to the cohort animals. The carcass was rejected at slaughterhouse inspection due to the presence of macroscopic nodular green lesions on most muscle masses.

2.2. Gross Pathology, Cytology and Histology Investigation

A gross-pathologic examination of the skeletal muscles of the Limousine bull was carried out. Smears and impressions of different lesion were performed, fixed and stained with May-Grunwald Giemsa. Samples from both affected areas and healthy muscle were collected for histology. The samples were fixed in 10% neutral buffered formalin, trimmed, embedded in paraffin wax, sectioned at 3–4 μm, and stained with hematoxylin and eosin (H&E) for histological evaluation.

2.3. Meat Juice Extraction and Serology

Portions of the skeletal muscle (approximately 1 kg) were frozen in a plastic bag at −20 °C immediately after sampling and thawed at +4 °C overnight for collecting meat juice. After defrosting, approximately 1.5 mL of meat juice from the bag was transferred into sterile tubes (Eppendorf, Hamburg, Germany). Meat juice tubes were then centrifuged at 2500 rpm for 15 min to remove coarse particles, and the supernatant were tested by Immunofluorescence Antibody test (IFAT) by commercial antigen (Mega Cor Diagnostik, Horbranz, Osterreich) consisting of tachyzoites cultured on Vero cells and, as a conjugate, rabbit anti-bovine IgG (Sigma Immunochemicals, St. Louis, MO, USA) bound to fluorescein isothiocyanate (FITC) and diluted 1/300. An initial dilution of 1:4 (cut off) was used for the meat juice. The pellet was stored at −20 °C for downstream analyses.

2.4. Molecular Investigations

Genomic DNA was purified from different parts of the muscle: four samples from macroscopic lesions (ML) and four from muscle macroscopically healthy (HM), of 25 mg each, and one meat juice pellet (MJ), approximately 200 μL, using Pure Link ® Genomic DNA Mini kit (Invitrogen by Thermo Fisher), according to the manufacturer’s protocol.
A first screening end-point PCR targeting 18S rDNA gene of Apicomplexa was performed on all of the samples with the primers COC-1 and COC-2, as described by Hornok et al. [31]. Briefly, a reaction volume of 25 μL, containing 12.5 μL 2× Dream Taq Hot Start Green PCR Master Mix (Thermo Scientific), 9.5 μL ddH2O, 0.25 μL (1 μM final concentration) of each primer, and 2.5 μL template DNA were used. For amplification, an initial denaturation step at 94 °C for 10 min was followed by 40 cycles of denaturation at 94 °C for 30 s, annealing at 54 °C for 30 s and an extension at 72 °C for 30 s. A final extension was performed at 72 °C for 10 min.
Additional Multiplex PCR assay, described by Rubiola et al. [19] was performed to simultaneously identify all of the species of the genus Sarcocystis actually reported in cattle in Italy, targeting 18S rDNA and COI mtDNA. The multiplex-PCR contained 2.5 μL of template DNA, 0.25 μL (0.5 mM) of each primer, Sarco Rev, Sar F, Hirsuta, Cruzi, COI HB, COI H and COI B, 12.5 μL 2× Dream Taq Hot Start Green PCR Master Mix to a total volume of 25 μL. The PCR assay involved a denaturation step at 95 °C for 3 min, followed by 35 cycles at 95 °C for 60 s, 58 °C for 60 s and 72 °C for 30 s and a final extension of 72 °C for 3 min.
Finally, a Nested PCR targeting the glycerol-3-phosphate dehydrogenase (B1 gene) of Toxoplasma gondii was performed as described by Jones et al. [32]. First round of amplification included a denaturation step at 96 °C for 2 min, followed by 40 cycles at 93 °C for 10 s, 57 °C for 10 s, and 72 °C for 30 s. The second round of amplification involved a denaturation step at 95 °C for 2 min, followed by 40 cycles at 93 °C for 10 s, 62.5 °C for 10 s, and 72 °C for 30 s. Amplifications were performed in a T-personal thermal cycler (Biometra, Goettingen, Germany). In all of the abovementioned PCRs, water was included as a negative control.
The PCR products were electrophoresed on a 1% (for the first two assays) and 2% (for B1 nested PCR), agarose gel stained with SYBR Safe DNA Gel Stain (Thermo Fisher Scientific, Carlsbad, CA, USA) in 0.5× TBE. For sequencing, the amplicons were excised and purified by Nucleo-Spin Gel and PCR Clean-up (Mackerey-Nagel, Düren, Germany) and sequenced with an ABI 3730 DNA analyzer (StarSEQ, Mainz, Germany). All of the primers used in this study are reported in Table 1.
The trace files were assembled with Contig Express (VectorNTI Advance 11 software, Invitrogen, Carlsbad, CA, USA), and the consensus sequences were compared with published data by BLAST tools (https://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 5 December 2022). Sequence alignments were carried out by BioEdit 7.2.5 [33], while p-distance and maximum-likelihood (ML) tree (K2+G substitution model for both genes and bootstrap of 1000 replicate) were calculated by MEGA 7 [34]. The sequences obtained in this study were deposited in GenBank under accession numbers OQ184854-56 (18SrDNA) and OQ190466-67 (COI mtDNA).
Table
Table 1. Forward and reverse primers used in the different PCR assays.
Table 1. Forward and reverse primers used in the different PCR assays.
Primers GenePrimer Sequences Product Length Reference
18S ApicomplexaCOC-118SAAGTATAAGCTTTTATACGGCT300 bp[31]
COC-2CACTGCCACGGTAGTCCAATA
Sarcocystis spp.
Multiplex PCR		Sarco_Rev18SAACCCTAATTCCCCGTTA [15]
SarFTGGCTAATACATGCGCAAATA200–250 bp[35]
HirsutaCATTTCGGTGATTATTGG108 bp[15]
CruziATCAGATGAAAATCTACTACATGG300 bp
COI_HBCOIAATGTGGTGCGGTATGAACT [19]
COI_HGGCACCAACGAACATGGTA420 bp
COI_BTCAAAAACCTGCTTTGCTG700 bp
B1 Toxoplasma nested PCRI Round for B1GGAACTGCATCCGTTCATGAG [32]
I Round rev TCTTTAAAGCGTTCGTGGTC-
II Round forTGCATAGGTTGCAGTCACTG96bp
II Round rev GGCGACCAATCTGCGAATACACC

3. Results

3.1. Gross-Pathological Findings

On gross pathology, skeletal muscles showed multifocal, firm, cohalescent green-yellowish round lesions with a diameter ranging from 0.1 to 1.5 cm. Some of the larger lesions (1.0–1.5 cm in diameter) had necrotic yellow-green content (Figure 1a), and the smaller (0.2–0.5 cm in diameter) were whitish in color and appeared solid or released only little yellowish-white material when squeezed (Figure 1b). Based on the gross pathology, a diagnosis of severe multifocal chronic myositis was formulated.

3.2. Cytological and Histological Findings

On cytology, inflammatory cells mostly referable to eosinophils were noticed.
Histologically, the muscle revealed extensive multifocal areas of necrosis with mineralization surrounded by fibrosis and inflammatory cells, mostly lymphoid cells (Figure 2a,b). In some areas, single muscle fibers were noted to be atrophic or with initial necrosis (in a longitudinal section made visible by hypertrophy, loss of transverse striation, and initial fragmentation) immersed in connective tissue with macrophages, giant cells, and lymphoid cells. Occasionally, the foci presented degenerate parasitic cysts surrounded by variable numbers of inflammatory cells (among which many eosinophils), or, at a later state, macrophages and giant cells forming a granulomatous lesion (Figure 2c). Intact protozoan cysts (morphologically referable to Sarcocystis sp.) were detected in the unaffected muscle (Figure 2d).
Histologically, the retrieved findings were compatible with a severe granulomatous myositis.

3.3. Serological and Molecular Results

The meat juice IFAT resulted negative for T. gondii specific IgG at a 1:4 dilution.
Concerning the molecular analyses, all of the PCR assays successfully amplified all of the three matrices examined. In detail, in the PCR targeting the Apicomplexa 18S rDNA, all nine specimens were positive, with a band of ~ 300 bp. Sequences were obtained from six samples (4 ML, 1 HM, 1 MJ) and a BLAST search gave 99.6% identity with S. hominis in five (3 ML, 1 HM, 1 MJ), and 99.6–99.3% Hammondia hammondi/T. gondii only from ML.
The same samples tested with the multiplex PCR specific for cattle Sarcocystis showed a band of 420 bp of S. hominis. To confirm the results, the COI mtDNA of two samples (1 ML, 1 MJ) were sequenced. A BLAST search gave a 99.5% (ML) and a 99.7% (MJ) identity with S. hominis.
Finally, the nested PCR targeting B1 gene of T. gondii showed amplification of all the nine samples, with an amplicon of approximately of 96 bp. Unfortunately, only one specimen (MJ) gave a readable sequence showing 100% identity with T. gondii (Table 2).
The p-distance of the 18S rDNA S. hominis specimens (HM, ML and MJ) showed 0% genetic variability to the same species retrieved from GenBank and used for building the ML tree. The interspecific p-distance was 0.2–0.3% with S. bovini and S. bovifelis, respectively, reaching 1.2–1.3 and 1.4% with S. hirsuta, S. heydorni and S. cruzi, respectively. Concerning the more variable COI mtDNA the intraspecific variability among S. hominis was 0.1–0.2%, while the interspecific divergence was 0.9–1% with S. bovini and S. bovifelis, respectively, and 1.6–2.5 and 2.3 % with S. hirsuta, S. heydorni and S. cruzi, respectively.
The ML tree of both molecular markers showed the same topology (Figure 3a,b); our specimens (both HM and MJ) are included in the S. hominis cluster and closely related to S. bovini and S. bovifelis. Moreover, the T. gondii sample formed a cluster with the other member of the family Sarcocystidae (H. hammondi/T. gondii and N. caninum).

4. Discussion

This paper reports for the first time co-infection by S. hominis and T. gondii in a severe case of BEM, resulting in carcass condemnation at slaughter. Sarcocystis spp. infection is common in cattle, but the development of BEM only occurs in some cases and seems to be linked to the presence of some Sarcocystis spp. [4]. In Italy, it has been seen to be associated mainly with S. bovifelis, S. hominis and S. cruzi [1]. Occasionally, as shown in the present report, muscular involvement can be extremely severe, causing carcass discard and high economic losses. The histopathological lesions observed in this study were similar to those described by Wouda [4] in a case of BEM in a beef cow due to S. hominis.
The correct identification of the etiological agents involved in BEM are of primary importance as the cattle muscle can be infected by some important zoonotic parasites, i.e., Sarcocystis spp. and T. gondii. In this view, the identification at species level of the former genus should be considered of primary importance in order to discriminate the zoonotic from the non-zoonotic species. In fact, S. hominis and S. heydorni are meat-borne zoonotic parasites that can be transmitted by eating raw or undercooked meat, a very common practice in all the southern regions of Europe [13,17,18].
In our study, depending on the method used, both S. hominis and T. gondii were detected in all of the three matrices tested (ML, HM and MJ). In particular by the species-specific multiplex PCR for Sarcocystis spp. [19], the S. hominis-related amplicon was detected in all matrices, as well as with the nested PCR targeting B1 gene of T. gondii [32].
The less specific PCR targeting of the 18S rDNA of Apicomplexa [32], did not allow for properly identifying T. gondii (BLAST result H. hammondi/T. gondii), which was confirmed only by the B1 specific gene.
Despite the two Apicomplexa detected in all matrices examined, sequences of good quality were obtained mostly for S. hominis, probably due to the high presence of this species also in healthy tissues (observed in histological sections).
Lastly, in our study, the sediment of meat juice was used as a target for the DNA extraction and amplification, and to the best of our knowledge this is the first time that such a matrix has been used for this purpose. Interestingly, only from this matrix were we able to obtain a readable sequence of T. gondii B1 gene, probably because the staring amount of parasite was higher than in lesions and in healthy muscle.
Therefore, based on our results, meat juice sediment proved to be a promising matrix to be tested for the molecular diagnosis of cysts-forming protozoans infecting bovine muscle, independently of the presence of BEM lesions.
Co-infections in cattle between T. gondii and Sarcocystis spp. have been already described [24,25,26,27]. To the best of our knowledge, this is the first report of the presence of T. gondii DNA in a case of BEM. However, its role in evoking the disease is unclear, as the infection in cattle is usually asymptomatic [28] and the reported cases are mainly related to reproductive failure [30]. Nevertheless, ingestion of T. gondii tissue cysts from infected meat is a major route of infection for humans, with consumption of raw or undercooked meat from infected animals considered a significant public health risk [36]. There is evidence suggesting the important role of the beef as a source of human infection [37,38,39]. The reported seroprevalence for T. gondii infection in cattle varies between different countries, for example, 83.3% (n = 504) in southern Spain [40], 45.6% (n = 406) in Switzerland [41], and 10.2% in Italian beef cattle [42].
Contrastingly to what happens in other animal species, in cattle the seroprevalence does not give a valid indication of the risk for human infection by eating meat because cattle can eliminate their tissue cysts while remaining seropositive [43]. Possibly, only recently infected animals, which have not yet developed antibodies, have a parasite load high enough to be detectable by direct assays [44]. This is confirmed also in the presented study in which the animal was seronegative for IgG against T. gondii by IFAT on meat juice, while T. gondii DNA was observed in muscle.
The finding of T. gondii DNA within the BEM lesions draws attention to the possible role that a co-infection of this parasite with Sarcocystis sp. may play in evoking BEM lesions. In the human context, although toxoplasmosis is not a well-recognized cause of eosinophilia, the literature suggests that associated factors, such as coinfection with other parasites or drug hypersensitivity, may play a role in the development of eosinophilia with acquired toxoplasmosis [45,46]. However, this is only a possible pathogenetic analogy, as these two host species (bovine and human) have a totally different susceptibility to T. gondii, with very different consequences of infection.

5. Conclusions

In conclusion, we described in this paper the first detection of T. gondii DNA in a severe case of bovine eosinophilic myositis associated with a coinfection by S. hominis. Molecular results highlighted DNA of both pathogens within the lesion in healthy muscle and or in the meat juice pellets, laying the groundwork for a possible etio-pathogenetic correlation between co-infection and the development of BEM. However, the role of T. gondii in the pathogenesis of eosinophilic myositis is completely unclear, and further studies on co-infection of T. gondii and Sarcocystis sp. in BEM cases are necessaryto understand the possible role of Toxoplasma in this condition that impacts food safety and the economy of the livestock sector.

Author Contributions

Conceptualization, F.M.D. and J.G.P.J.; methodology, F.M.D., M.C. and R.G.; software, M.C.; validation, R.G., M.C. and C.B.; formal analysis, F.M.D. and M.C.; investigation, J.G.P.J., A.G., R.G. and F.M.D.; resources, J.G.P.J. and A.G.; data curation, F.M.D. and M.C.; writing—original draft preparation, F.M.D.; writing—review and editing, M.C., C.B. and R.G.; visualization, M.C. and A.G.; supervision, M.C. and R.G.; project administration, F.M.D. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

This study did not require official or institutional ethical approval as it was not an experimental study but part of a veterinary diagnostic case.

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

GenBank accession numbers OQ184854-56 (18SDNA), OQ190466-67 (COI mtDNA).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Rubiola, S.; Civera, T.; Panebianco, F.; Vercellino, D.; Chiesa, F. Molecular Detection of Cattle Sarcocystis spp. in North-West Italy highlights their association with bovine eosinophilic myositis. Parasites Vectors 2021, 14, 1–8. [Google Scholar] [CrossRef]
  2. Gjerde, B. Molecular Characterisation of Sarcocystis bovifelis, Sarcocystis bovini sp., Sarcocystis hirsuta and Sarcocystis cruzi from Cattle (Bos taurus) and Sarcocystis sinensis from Water Buffaloes (Bubalus bubalis). Parasitol. Res. 2016, 115, 1473–1492. [Google Scholar] [CrossRef] [PubMed]
  3. Dubey, J.P.; van Wilpe, E.; Calero-Bernal, R.; Verma, S.K.; Fayer, R. Sarcocystis heydorni, n. sp. (Apicomplexa: Sarcocystidae) with cattle (Bos taurus) and human (Homo sapiens) cycle. Parasitol. Res. 2015, 114, 4143–4147. [Google Scholar] [CrossRef] [PubMed]
  4. Wouda, W.; Snoep, J.J.; Dubey, J.P. Eosinophilic myositis due to Sarcocystis hominis in a beef cow. J. Comp. Pathol. 2006, 135, 249–253. [Google Scholar] [CrossRef] [PubMed]
  5. Vangeel, L.; Houf, K.; Geldhof, P.; De Preter, K.; Vercruysse, J.; Ducatelle, R.; Chiers, K. Different Sarcocystis spp. Are present in bovine eosinophilic myositis. Vet. Parasitol. 2013, 197, 543–548. [Google Scholar] [CrossRef]
  6. Hoeve-Bakker, B.J.A.; van der Giessen, J.W.B.; Franssen, F.F.J. Molecular identification targeting Cox1 and 18s genes confirms the high prevalence of Sarcocystis spp. in cattle in the Netherlands. Int. J. Parasitol. 2019, 49, 859–866. [Google Scholar] [CrossRef]
  7. Gajadhar, A.A.; Marquardt, W.C. Ultrastructural and transmission evidence of Sarcocysis cruzi associated with eosinophilic myositis in cattle. Can. J. Vet. Res. 1992, 56, 41. [Google Scholar] [PubMed]
  8. Waine, K.; Bartley, P.M.; Cox, A.; Newsome, R.; Strugnell, B.; Katzer, F. Molecular detection of Sarcocystis cruzi in three beef carcases with eosinophilic myositis lesions and in unaffected beef from animals in the same herd. Vet. Parasitol. Reg. Stud. Rep. 2022, 33, 100751. [Google Scholar] [CrossRef]
  9. Dubey, J.P.; Rosenthal, B.M. Bovine sarcocystosis: Sarcocystis species, diagnosis, prevalence, economic and public health considerations, and association of Sarcocystis species with eosinophilic myositis in cattle. Int. J. Parasitol. 2022; in press. [Google Scholar] [CrossRef]
  10. Lindsay, D.S.; Dubey, J.P. Neosporosis, Toxoplasmosis, and Sarcocystosis in ruminants: An update. Vet. Clin. N. Am. Food Anim. Pract. 2020, 36, 205–222. [Google Scholar] [CrossRef]
  11. Dubey, J.P.; Calero-Bernal, R.; Rosenthal, B.M.; Speer, C.A.; Fayer, R. Sarcocystosis of Animals and Humans, 2nd ed.; CRC Press: Boca Raton, FL, USA, 2015; ISBN 9781498710152. [Google Scholar]
  12. Vangeel, L.; Houf, K.; Geldhof, P.; Nollet, H.; Vercruysse, J.; Ducatelle, R.; Chiers, K. Intramuscular inoculation of cattle with Sarcocystis antigen results in focal eosinophilic myositis. Vet. Parasitol. 2012, 183, 224–230. [Google Scholar] [CrossRef]
  13. Bucca, M.; Brianti, E.; Giuffrida, A.; Ziino, G.; Cicciari, S.; Panebianco, A. Prevalence and distribution of Sarcocystis spp. cysts in several muscles of cattle slaughtered in Sicily, Southern Italy. Food Control 2011, 22, 105–108. [Google Scholar] [CrossRef]
  14. Domenis, L.; Peletto, S.; Sacchi, L.; Clementi, E.; Genchi, M.; Felisari, L.; Felisari, C.; Mo, P.; Modesto, P.; Zuccon, F.; et al. Detection of a morphogenetically novel Sarcocystis hominis-like in the context of a prevalence study in semi-intensively bred cattle in Italy. Parasitol. Res. 2011, 109, 1677–1687. [Google Scholar] [CrossRef] [PubMed]
  15. Chiesa, F.; Muratore, E.; Dalmasso, A.; Civera, T. A New Molecular approach to assess the occurrence of Sarcocystis spp. in cattle and products thereof: Preliminary data. Ital. J. Food Saf. 2013, 2, 148–151. [Google Scholar] [CrossRef]
  16. Meistro, S.; Peletto, S.; Pezzolato, M.; Varello, K.; Botta, M.; Richelmi, G.; Biglia, C.; Baioni, E.; Modesto, P.; Acutis, P.; et al. Sarcocystis spp. prevalence in bovine minced meat: A histological and molecular study. Ital. J. Food Saf. 2015, 4, 85–87. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  17. Dubey, J.P. Foodborne and waterborne zoonotic sarcocystosis. Food Waterborne Parasitol. 2015, 1, 2–11. [Google Scholar] [CrossRef] [Green Version]
  18. Moré, G.; Schares, S.; Maksimov, A.; Conraths, F.J.; Venturini, M.C.; Schares, G. Development of a multiplex real time PCR to differentiate Sarcocystis spp. affecting cattle. Vet. Parasitol. 2013, 197, 85–94. [Google Scholar] [CrossRef]
  19. Rubiola, S.; Civera, T.; Ferroglio, E.; Zanet, S.; Zaccaria, T.; Brossa, S.; Cipriani, R.; Chiesa, F. Molecular Differentiation of Cattle Sarcocystis spp. by Multiplex PCR Targeting 18S and COI Genes Following Identification of Sarcocystis hominis in Human Stool Samples. Food Waterborne Parasitol. 2020, 18, e00074. [Google Scholar] [CrossRef]
  20. Prakas, P.; Strazdaitė-Žielienė, Ž.; Januškevičius, V.; Chiesa, F.; Baranauskaitė, A.; Rudaitytė-Lukošienė, E.; Servienė, E.; Petkevičius, S.; Butkauskas, D. Molecular identification of four Sarcocystis species in cattle from Lithuania, including S. hominis, and development of a rapid molecular detection method. Parasit. Vectors. 2020, 13, 610. [Google Scholar] [CrossRef]
  21. Gjerde, B. Phylogenetic Relationships among Sarcocystis Species in Cervids, Cattle and Sheep inferred from the mitochondrial cytochrome c oxidase subunit i gene. Int. J. Parasitol. 2013, 43, 579–591. [Google Scholar] [CrossRef]
  22. Zeng, H.; Van Damme, I.; Kabi, T.W.; Šoba, B.; Gabriël, S. Sarcocystis species in bovine carcasses from a Belgian abattoir: A cross-sectional study. Parasit. Vectors. 2021, 14, 271. [Google Scholar] [CrossRef]
  23. Rubiola, S.; Chiesa, F.; Zanet, S.; Civera, T. Molecular Identification of Sarcocystis spp. in Cattle: Partial Sequencing of Cytochrome C Oxidase Subunit 1 (COI). Ital. J. Food Saf. 2018, 7, 204–208. [Google Scholar] [CrossRef]
  24. Moré, G.; Basso, W.; Bacigalupe, D.; Venturini, M.C.; Venturini, L. Diagnosis of Sarcocystis cruzi, Neospora caninum, and Toxoplasma gondii infections in cattle. Parasitol. Res. 2008, 102, 671–675. [Google Scholar] [CrossRef] [PubMed]
  25. Amairia, S.; Rouatbi, M.; Rjeibi, M.R.; Gomes, J.; Rekik, M.; Darghouth, M.A.; Gharbi, M. Molecular detection of Toxoplasma gondii and Sarcocystis spp. co-infection in tunisian merguez, a traditional processed sausage beef meat. Food Control 2021, 121, 107618. [Google Scholar] [CrossRef]
  26. Langoni, H.; Generoso, D.; Hayasaka, Ê.Y.; Mantovan, K.B.; Menozzi, B.D.; Richini-Pereira, V.B.; da Silva, R.C. Molecular characterization of Toxoplasma gondii and Sarcocystis spp. in raw kibbeh and other meat samples commercialized in Botucatu, Southeastern Brazil. Rev. Bras. Parasitol. Vet. 2021, 30, 1–9. [Google Scholar] [CrossRef] [PubMed]
  27. Hooshyar, H.; Chehrazi, F.; Arbabi, M. Molecular identification and frequency of cyst-forming coccidia (Sarcocystis, Toxoplasma gondii, and Neospora caninum) in native slaughtered cattle in Kashan, Central Iran. Int. Arch. Health Sci. 2021, 8, 301. [Google Scholar] [CrossRef]
  28. Stelzer, S.; Basso, W.; Benavides Silván, J.; Ortega-Mora, L.M.; Maksimov, P.; Gethmann, J.; Conraths, F.J.; Schares, G. Toxoplasma gondii infection and toxoplasmosis in farm animals: Risk factors and economic impact. Food Waterborne Parasitol. 2019, 15, e00037. [Google Scholar] [CrossRef]
  29. Dubey, J.P. A Review of Toxoplasmosis in cattle. Vet. Parasitol. 1986, 22, 177–202. [Google Scholar] [CrossRef] [PubMed]
  30. Canada, N.; Meireles, C.S.; Rocha, A.; da Costa, J.M.C.; Erickson, M.W.; Dubey, J.P. Isolation of viable Toxoplasma gondii from naturally infected aborted bovine fetuses. J. Parasitol. 2002, 88, 1247–1248. [Google Scholar] [CrossRef]
  31. Hornok, S.; Mester, A.; Takács, N.; Baska, F.; Majoros, G.; Fok, É.; Biksi, I.; Német, Z.; Hornyák, Á.; Jánosi, S.; et al. Sarcocystis-infection of cattle in Hungary. Parasites Vectors 2015, 8, 4–9. [Google Scholar] [CrossRef]
  32. Jones, C.D.; Okhravi, N.; Adamson, P.; Tasker, S. Comparison of PCR detection methods for B1, P30, and 18S rDNA genes of T. gondii in aqueous humor. Investig. Ophthalmol. Vis. Sci. 2000, 41, 634–644. [Google Scholar]
  33. Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
  34. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis version 7 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Vangeel, L.; Houf, K.; Chiers, K.; Vercruysse, J.; D’Herde, K.; Ducatelle, R. Molecular-based identification of Sarcocystis hominis in Belgian minced beef. J. Food Prot. 2007, 70, 1523–1526. [Google Scholar] [CrossRef]
  36. Guo, M.; Dubey, J.P.; Hill, D.; Buchanan, R.L.; Ray Gamble, H.; Jones, J.L.; Pradhan, A.K. Prevalence and risk factors for Toxoplasma gondii infection in meat animals and meat products destined for human consumption. J. Food Prot. 2015, 78, 457–476. [Google Scholar] [CrossRef]
  37. Baril, L.; Ancelle, T.; Goulet, V.; Thulliez, P.; Tirard-Fleury, V.; Carme, B. Risk Factors for Toxoplasma Infection in pregnancy: A case-control study in France. Scand. J. Infect. Dis. 1999, 31, 305–309. [Google Scholar] [CrossRef] [PubMed]
  38. Cook, A.J.; Gilbert, R.E.; Buffolano, W.; Zufferey, J.; Petersen, E.; Jenum, P.A.; Foulon, W.; Semprini, A.E.; Dunn, D.T. Sources of Toxoplasma infection in pregnant women: European multicentre case-control study. european research network on congenital toxoplasmosis. BMJ 2000, 321, 142–147. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  39. Jones, J.L.; Dargelas, V.; Roberts, J.; Press, C.; Remington, J.S.; Montoya, J.G. Risk Factors for Toxoplasma gondii Infection in the United States. Clin. Infect. Dis. Off. Publ. Infect. Dis. Soc. Am. 2009, 49, 878–884. [Google Scholar] [CrossRef] [Green Version]
  40. García-Bocanegra, I.; Cabezón, O.; Hernández, E.; Martínez-Cruz, M.S.; Martínez-Moreno, Á.; Martínez-Moreno, J. Toxoplasma gondii in ruminant species (cattle, sheep, and goats) from Southern Spain. J. Parasitol. 2013, 99, 438–440. [Google Scholar] [CrossRef]
  41. Berger-Schoch, A.E.; Bernet, D.; Doherr, M.G.; Gottstein, B.; Frey, C.F. Toxoplasma gondii in Switzerland: A serosurvey based on meat juice analysis of slaughtered pigs, wild boar, sheep and cattle. Zoonoses Public Health 2011, 58, 472–478. [Google Scholar] [CrossRef]
  42. Gazzonis, A.L.; Marino, A.M.F.; Garippa, G.; Rossi, L.; Mignone, W.; Dini, V.; Giunta, R.P.; Luini, M.; Villa, L.; Zanzani, S.A.; et al. Toxoplasma gondii seroprevalence in beef cattle raised in Italy: A multicenter study. Parasitol. Res. 2020, 119, 3893–3898. [Google Scholar] [CrossRef]
  43. Opsteegh, M.; Teunis, P.; Züchner, L.; Koets, A.; Langelaar, M.; van der Giessen, J. Low predictive value of seroprevalence of Toxoplasma gondii in cattle for detection of parasite DNA. Int. J. Parasitol. 2011, 41, 343–354. [Google Scholar] [CrossRef] [PubMed]
  44. Dubey, J.P. Isolation of Toxoplasma gondii from a naturally infected beef cow. J. Parasitol. 1992, 78, 151–153. [Google Scholar] [CrossRef] [PubMed]
  45. Guneratne, R.; Mendis, D.; Bandara, T.; Fernando, S.D. Toxoplasma, Toxocara and tuberculosis co-infection in a four year old child. BMC Pediatr. 2011, 11, 44. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  46. Yusuf, I.H.; Sahare, P.; Hildebrand, G.D. DRESS Syndrome in a child treated for toxoplasma retinochoroiditis. J. AAPOS Off. Publ. Am. Assoc. Pediatr. Ophthalmol. Strabismus 2013, 17, 521–523. [Google Scholar] [CrossRef] [PubMed]
Animals 13 00311 g001 550
Figure 1. Macroscopic appearance of the infected skeletal muscle. (a) Note the multifocal yellowish-green round lesions, ranging from 0.1 to 1cm of diameter, with a necrotic content in a cross-section of skeletal muscle. (b) Note the white round lesions and a green discoloration area of the muscle (arrow).
Figure 1. Macroscopic appearance of the infected skeletal muscle. (a) Note the multifocal yellowish-green round lesions, ranging from 0.1 to 1cm of diameter, with a necrotic content in a cross-section of skeletal muscle. (b) Note the white round lesions and a green discoloration area of the muscle (arrow).
Animals 13 00311 g001
Animals 13 00311 g002 550
Figure 2. Histological appearance of the infected skeletal muscle. (a) A vast lesion showing mineralized foci of necrotic tissue surrounded by inflammation, mostly mononuclear elements. H.&E. 4× (b) Higher magnification shows a few necrotic fibers in the center of inflammatory tissue composed by palisades epithelioid macrophages, multinucleated giant cells, admixed with eosinophils and lymphoid tissue. H.&-E. 20× (c) On the left, extensive necrotic material in which the debris of a protozoan cyst are visible (arrow). Around them a layer of necrotic inflammatory cells surrounded by granulomatous tissue. H.&E. 10× (d) Top right: A cyst in the middle of a viable skeletal muscle fiber, with no inflammation. Left: Thick connective tissue (fibrosis) with scattered eosinophils. H.&E.10×.
Figure 2. Histological appearance of the infected skeletal muscle. (a) A vast lesion showing mineralized foci of necrotic tissue surrounded by inflammation, mostly mononuclear elements. H.&E. 4× (b) Higher magnification shows a few necrotic fibers in the center of inflammatory tissue composed by palisades epithelioid macrophages, multinucleated giant cells, admixed with eosinophils and lymphoid tissue. H.&-E. 20× (c) On the left, extensive necrotic material in which the debris of a protozoan cyst are visible (arrow). Around them a layer of necrotic inflammatory cells surrounded by granulomatous tissue. H.&E. 10× (d) Top right: A cyst in the middle of a viable skeletal muscle fiber, with no inflammation. Left: Thick connective tissue (fibrosis) with scattered eosinophils. H.&E.10×.
Animals 13 00311 g002
Animals 13 00311 g003 550
Figure 3. Maximum Likelihood trees inferred from Sarcocystis homins and Toxoplasma gondii 18S rDNA (a) and COI mtDNA (b) from this study and sequences retrieved from GenBank. The evolutionary history was computed with the Kimura 2-parameter model. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. There were a total of 207 position for 18S rDNA and 348 for COI mtDNA in the final data sets. Our specimens are in bold. HM = healthy muscle; ML = macroscopic lesion; MJ = meat juice pellet.
Figure 3. Maximum Likelihood trees inferred from Sarcocystis homins and Toxoplasma gondii 18S rDNA (a) and COI mtDNA (b) from this study and sequences retrieved from GenBank. The evolutionary history was computed with the Kimura 2-parameter model. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. There were a total of 207 position for 18S rDNA and 348 for COI mtDNA in the final data sets. Our specimens are in bold. HM = healthy muscle; ML = macroscopic lesion; MJ = meat juice pellet.
Animals 13 00311 g003
Table
Table 2. Results of PCR and Sequencing on tested samples.
Table 2. Results of PCR and Sequencing on tested samples.
Sample18s PCR [31]Multiplex Sarcocystis PCR [19]B1 Toxoplasma Nested-PCR [32]
ML
(4 samples) 		4 PCR positive
* (3 S. hominis, 1 Toxoplasma/Hammondia)		4 S. hominis PCR positive
(1 S. hominis) 		4 PCR Positive
(no sequence)
HM
(4 samples)		4 PCR Positive
(1 S. hominis)		4 S. hominis PCR positive 4 PCR Positive
(no sequence)
MJ
(1 sample) 		1 PCR Positive
(1 S. hominis)		1 S. hominis PCR positive
(1 S. hominis)		1 PCR Positive
(1 T. gondii)
* In round brackets the results of Sanger sequencing.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Dini, F.M.; Caffara, M.; Jacinto, J.G.P.; Benazzi, C.; Gentile, A.; Galuppi, R. A Case of Bovine Eosinophilic Myositis (BEM) Associated with Co-Infection by Sarcocystis hominis and Toxoplasma gondii. Animals 2023, 13, 311. https://doi.org/10.3390/ani13020311

AMA Style

Dini FM, Caffara M, Jacinto JGP, Benazzi C, Gentile A, Galuppi R. A Case of Bovine Eosinophilic Myositis (BEM) Associated with Co-Infection by Sarcocystis hominis and Toxoplasma gondii. Animals. 2023; 13(2):311. https://doi.org/10.3390/ani13020311

Chicago/Turabian Style

Dini, Filippo Maria, Monica Caffara, Joana G. P. Jacinto, Cinzia Benazzi, Arcangelo Gentile, and Roberta Galuppi. 2023. "A Case of Bovine Eosinophilic Myositis (BEM) Associated with Co-Infection by Sarcocystis hominis and Toxoplasma gondii" Animals 13, no. 2: 311. https://doi.org/10.3390/ani13020311

APA Style

Dini, F. M., Caffara, M., Jacinto, J. G. P., Benazzi, C., Gentile, A., & Galuppi, R. (2023). A Case of Bovine Eosinophilic Myositis (BEM) Associated with Co-Infection by Sarcocystis hominis and Toxoplasma gondii. Animals, 13(2), 311. https://doi.org/10.3390/ani13020311

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop