Next Article in Journal
Rearing European Eel (Anguilla anguilla) Elvers in a Biofloc System
Next Article in Special Issue
First Report of Sarcocystis pilosa from a Red Fox (Vulpes vulpes) Released for the Re-Introduction Project in South Korea
Previous Article in Journal
Three-Dimensional Volume Rendering in Computed Tomography for Evaluation of the Temporomandibular Joint in Dogs
Previous Article in Special Issue
Sarcocystis spp. Macrocysts Infection in Wildfowl Species in Eastern Baltic Region: Trends in Prevalence in 2011–2022
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 13
Issue 20
10.3390/ani13203232
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

First Detection of Theileria sinensis-like and Anaplasma capra in Ixodes kashmiricus: With Notes on cox1-Based Phylogenetic Position and New Locality Records

by
Muhammad Numan
1,
Abdulaziz Alouffi
2,
Mashal M. Almutairi
3,
Tetsuya Tanaka
4,
Haroon Ahmed
5,
Haroon Akbar
6,
Muhammad Imran Rashid
6,
Kun-Hsien Tsai
7,* and
Abid Ali
1,*
1
Department of Zoology, Abdul Wali Khan University Mardan, Mardan 23200, Pakistan
2
King Abdulaziz City for Science and Technology, Riyadh 12354, Saudi Arabia
3
Department of Pharmacology and Toxicology, College of Pharmacy, King Saud University, Riyadh 11451, Saudi Arabia
4
Laboratory of Infectious Diseases, Joint Faculty of Veterinary Medicine, Kagoshima University, Kagoshima 890-0065, Japan
5
Department of Biosciences, COMSATS University Islamabad (CUI), Park Road, Chak ShahZad, Islamabad 45550, Pakistan
6
Department of Parasitology, University of Veterinary and Animal Sciences, Lahore 54200, Pakistan
7
Global Health Program, Institute of Environmental and Occupational Health Sciences, College of Public Health, National Taiwan University, Taipei 106319, Taiwan
*
Authors to whom correspondence should be addressed.
Animals 2023, 13(20), 3232; https://doi.org/10.3390/ani13203232
Submission received: 7 August 2023 / Revised: 11 October 2023 / Accepted: 13 October 2023 / Published: 17 October 2023
(This article belongs to the Special Issue Parasites and Parasitic Diseases in Small Animals)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

Ixodes species are the main vectors of bacteria and piroplasm for different vertebrate hosts. Research on these unexplored concerns has been neglected in different regions including Pakistan. Recently, we molecularly characterized Ixodes kashmiricus ticks and associated Rickettsia spp.; however, the cox1 sequence and associated Theileria spp. and Anaplasma spp. for this tick are unknown. This study aimed to genetically identify I. kashmiricus based on the cox1 sequence and associated Theileria spp. and Anaplasma spp. A total of 352 ticks including adult females, nymphs and males were collected from small ruminants. The BLAST results and phylogenetic analysis of the cox1 sequence revealed a close resemblance with the Ixodes ricinus complex sequences. The 18S rDNA and 16S rDNA sequences showed maximum identity with Theileria cf. sinensis or Theileria sinensis and Anaplasma capra, respectively, and they phylogenetically clustered with the same species. This is the first report on the cox1 sequence of the I. kashmiricus tick, new locality records, and associated T. sinensis-like and A. capra. In order to determine the epidemiology of Ixodes ticks and their related pathogens, a widespread tick investigation is required.

Abstract

Ixodes ticks transmit Theileria and Anaplasma species to a wide range of animals. The spreading of ticks and tick-borne pathogens has been attributed to transhumant herds, and research on these uninvestigated issues has been neglected in many countries, including Pakistan. Recently, we used internal transcribed spacer (ITS) and 16S ribosomal DNA partial sequences to genetically characterize Ixodes kashmiricus ticks and their associated Rickettsia spp. However, the data on its cox1 sequence and associated Theileria spp. and Anaplasma spp. are missing. This study aimed to genetically characterize I. kashmiricus based on the cox1 sequence and their associated Theileria spp. and Anaplasma spp. The I. kashmiricus ticks were collected from small ruminants: sheep (Ovis aries) and goats (Capra hircus) of transhumant herds in district Shangla, Dir Upper and Chitral, Khyber Pakhtunkhwa (KP), Pakistan. Out of 129 examined hosts, 94 (72.87%) (56 sheep and 38 goats) were infested by 352 ticks, including adult females (175; 49.7%) followed by nymphs (115; 32.7%) and males (62; 17.6%). For molecular analyses, 121 ticks were subjected to DNA isolation and PCR for the amplification of the cox1 sequence for I. kashmiricus, 18S rDNA for Theileria spp. and 16S rDNA sequences for Anaplasma spp. The obtained cox1 sequence showed 89.29%, 88.78%, and 88.71% identity with Ixodes scapularis, Ixodes gibbosus, and Ixodes apronophorus, respectively. Phylogenetically, the present cox1 sequence clustered with the Ixodes ricinus complex. Additionally, the 18S rDNA sequence showed 98.11% maximum identity with Theileria cf. sinensis and 97.99% identity with Theileria sinensis. Phylogenetically, Theileria spp. clustered with the T. cf. sinensis and T. sinensis. In the case of Anaplasma spp., the 16S rDNA sequence showed 100% identity with Anaplasma capra and phylogenetically clustered with the A. capra. PCR-based DNA detection targeting the amplification of groEL and flaB sequences of Coxiella spp. and Borrelia spp., respectively, was unsuccessful. This is the first phylogenetic report based on cox1 and new locality records of I. kashmiricus, and the associated T. sinensis-like and A. capra. Significant tick surveillance studies are needed in order to determine the epidemiology of Ixodes ticks and their associated pathogens.

1. Introduction

Genus Ixodes (Acari: Ixodidae: Prostriata) developed during the Mesozoic era’s cretaceous period (65–95 million years ago) [1,2]. The Ixodes genus comprises more than 265 species, which are divided based on morphology into 18 subgenera [3]. Among them, the largest subgenus Ixodes comprises 18 species and includes the most studied ticks [4]. Ixodes ticks are known to adopt in particular environmental conditions for survival and development, and these are considered to limit their dispersal [3,5]. Climatic conditions and the availability of a suitable host are the two most important factors determining the distribution and abundance of Ixodes ticks. Ixodes ticks have been commonly found in woodland or mixed forest and grassland, which provide moist vegetation and approximately 80% humidity—a critical threshold for the survival and development of these ticks [2,5].
Ixodes ticks are known to parasitize a wide range of hosts including birds, reptiles, and mammals [3]. These ticks are capable of transmitting pathogens of medical and veterinary importance like Theileria spp., Anaplasma spp., Coxiella spp., Babesia spp. and Borrelia spp. [5,6,7,8]. Hard ticks, particularly of the Haemaphysalis, Dermacentor, Ixodes and Rhipicephalus genera are the primary vectors that transmit Anaplasma spp. [9,10]. To date, only two species of Anaplasma spp. like Anaplasma phagocytophilum have been detected in Ixodes ticks such as Ixodes ricinus [11], Ixodes trianguliceps [12], Ixodes scapularis [13] and Ixodes frontalis [14], while the Anaplasma capra has been detected in Ixodes persulcatus [15]. Several other hard tick species, including Haemaphysalis longicornis, Haemaphysalis qinghaiensis, Rhipicephalus sanguineus, Rhipicephalus turinicus, Rhipicephalus haemaphysaloides, Rhipicephalus microplus and Dermacentor everstianus have been shown as carrier of A. capra [9,10,16]. Similarly, some piroplasm species such as Theileria annae in Ixodes hexagonus [17], Theileria fuliginosa in Ixodes australiensis [18], and Theileria spp. in I. ricinus [14] have been described. On the other hand, Ha. qinghaiensis is the only known vector of Theileria sinensis [19]. Coxiella spp. such as Coxiella burnetii [7], and Borrelia spp. such as Borrelia burgdorferi, Borrelia miyamotoi, Borrelia genospecies and “Candidatus Borrelia sibirica” of the relapsing fever group, have been detected in the Ixodes ticks [6,20].
The identification of ticks, particularly those belonging to the genus Ixodes, has been traditionally based on morphological features, such as the shape of the spiracular plates, grooves of the scutum and punctations [2,4,21]. However, these methods are often insufficient for accurate identification and differentiation, particularly for Ixodes and other closely related ticks [22,23]. Molecular techniques have been alternatively used for the accurate identification and differentiation of different tick species [22,24,25,26,27,28]. Some genetic markers, such as cox1, 16S ribosomal DNA (rDNA) and internal transcribed spacer (ITS), have been shown suitable for the accurate delineation of ticks [21,29,30,31,32]. Ixodes kashmiricus tick has been reported based on ITS and 16S rDNA sequences, and their associated Rickettsia spp. has been reported based on gltA and ompA sequences [21]. However, genetic data based on cox1 sequence for I. kashmiricus and associated Theileria spp. and Anaplasma spp. are missing. Herein, I. kashmiricus ticks were for the first time genetically characterized based on a mitochondrial cox1 sequence and screened for associated Theileria spp. and Anaplasma spp. in Khyber Pakhtunkhwa (KP), Pakistan.

2. Materials and Methods

2.1. Ethical Approval

This study was approved by the Advance Studies Research Board (ASRB: Dir/A&R/AWKUM/2022/9396) committee members of Abdul Wali Khan University, Mardan KP, Pakistan. The oral permission was obtained from the owners of the transhumant herds during the host’s observation and tick collection.

2.2. Study Area and Tick Collection

This study was conducted in district Shangla (34°46′34.6″ N 72°40′45.8″ E), Dir Upper (35°13′23.4″ N 71°55′12.2″ E) and Chitral (35°50′11.7″ N 71°48′18.0″ E) of KP, Pakistan. These districts are highly mountainous, with an elevation approximately 3000–3500 m (m), and situated in the north or northwest of KP. The elevation study map was designed in ArcGIS 10.3.1, using the “Global Positioning System” to determine the locations of the collection sites (Figure 1). Tick specimens were collected from small ruminants in transhumant herds during May–July 2022 in district Shangla, Dir Upper and Chitral. The ticks were isolated from the host body carefully via tweezers to avoid any external damage to the specimens. The tick specimens were washed in distilled water followed by 70% ethanol and preserved in 100% ethanol in 1.5 mL Eppendorf tubes for further experiments.

2.3. Morphological Identification of Ticks

The collected tick specimens were morphologically identified under a stereozoom microscope (StereoBlue-euromex SB.1302-1, Arnhem, The Netherlands) using standard morphological identification keys [2,21,33].

2.4. DNA Isolation and PCR

Individually, 121 ticks including 20 males, 44 adult females and 27 nymphs from sheep, as well as 16 females and 14 nymphs from goats, were selected and subjected to molecular analyses. Before the DNA isolation, tick specimens were washed with distilled water followed by 70% ethanol and kept in an incubator (30–45 min) until dried. The specimens were cut with sterile scissors and homogenized in 200–300 µL phosphate-buffered saline (pH 7.4, 137 mM NaCl, 2.7 mM KCl, 8 mM Na2HPO4, 2 mM KH2PO4) using a micro-pestle. The genomic DNA was extracted using a phenol–chloroform protocol [34], and the isolated DNA pellet was diluted by the addition of 20–30 μL of “nuclease-free” PCR water. The isolated genomic DNA was quantified via NanoDrop (Nano-Q, Optizen, Daejeon, Republic of Korea) and stored at −20 ℃.
The tick genomic DNA of I. kashmiricus (1 male, 2 adult females, and 2 nymphs) were subjected to conventional PCR (GE-96G, BIOER, Hangzhou, China) for the amplification of mitochondrial cytochrome C oxidase 1 (cox1) sequence. Each PCR reaction mixture contained 25 µL volume—comprising 1 µL of each primer (10 µM), 2 µL of template DNA (50–100 ng/µL), 8.5 µL of PCR water “nuclease-free” and 12.5 µL of DreamTaq green MasterMix (2×) (Thermo Scientific, Waltham, MA, USA).
All extracted genomic DNA was used for the screening of associated pathogens based on genetic markers such as 18S rRNA for Theileria spp., 16S rRNA for Anaplasma spp., groEL for Coxiella spp. and flaB for Borrelia spp. Each PCR contained a positive control (DNA of Anaplasma marginale, Theileria annulata, Coxiella burnetii and Borrelia anserina for pathogens and genomic DNA of Hy. anatolicum for ticks) and a negative control (“nuclease-free” PCR water instead of DNA). The primers used in this study and their thermocycler conditions are given in Table 1.
The PCR-amplified products were electrophoresed on a 1.5% agarose gel and visualized under ultraviolet light in the Gel Documentation System (BioDoc-It™ Imaging Systems UVP, LLC, Upland, CA, USA). PCR-positive samples were purified by using a DNA Clean & Concentrator Kit (Zymo Research, Irvine, CA, USA) by following the manufacturer’s instructions.

2.5. DNA Sequencing and Phylogenetic Analysis

All amplified amplicons of cox1 (5: 1 male, 2 adult females, and 2 nymphs) for ticks, 18S rDNA (2: 1 adult female and 1 nymph) for Theileria spp. and 16S rDNA (4: 2 adult females and 2 nymphs) for Anaplasma spp. were sequenced (Macrogen Inc., Seoul, Republic of Korea) by Sanger sequencing. The obtained sequences were trimmed/edited via SeqMan v. 5 (DNASTAR, Inc., Madison/WI, USA) for the removal of poor reading sequences and subjected to Basic Local Alignment Search Tool (BLAST, https://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on: 10 July 2022) at the National Center for Biotechnology Information (NCBI, https://www.ncbi.nlm.nih.gov/, accessed on: 10 July 2022). After BLAST, maximum identity sequences of the most similar/subgenus species were downloaded in FASTA format from the NCBI. Obtained sequences were aligned with the downloaded sequences using ClustalW multiple alignments in BioEdit Sequence Alignment Editor v. 7.0.5 [39]. The phylogenies were constructed individually for each DNA sequence of tick and associated pathogens through the Maximum Likelihood statistical method and Kimura 2-parameter model in Molecular Evolutionary Genetics Analysis (MEGA-X) with a bootstrapping value of 1000 [40]. The coding sequences like cox1 sequences were aligned by using MUSCLE algorithms [41].

2.6. Statistical Analyses

All recorded data such as the numbers of collected ticks and their life stages in the three districts, as well as associated pathogens like Theileria spp. and Anaplasma spp., were arranged in the spreadsheet (Microsoft Excel v. 2016, Microsoft 365®) for descriptive statistical analyses. The differences were considered significant at a p-value less than 0.05 under chi-square tests using the GraphPad Prism v. 8 (Inc., San Diego, CA, USA).

3. Results

3.1. Morphological Identification and Description of Ixodes kashmiricus

Altogether, 352 I. kashmiricus ticks (Table 2) were collected in this study and morphologically identified. During this study, 94 out of 129 (72.87%) hosts of small ruminants including 56 sheep and 38 goats were infested by 352 ticks comprising adult females (175/352, 49.7%) followed by nymphs (115/352, 32.7%) and males (62/352, 17.6%). A significantly high prevalence of I. kashmiricus was found on sheep (271/352, 77%) followed by goats (81/352, 23%) in transhumant herds.
Furthermore, other tick species were not found co-infesting sheep and goats afflicted by I. kashmiricus ticks. During collection from district Chitral, only an adult female of I. kashmiricus was found on sheep. Details of host records, prevalence of ticks, and detection of Theileria and Anaplasma species in the selected districts are summarized in Table 2.

3.2. Sequences and Phylogenetic Relationship of Ticks

A sum of five ticks’ (one male, two adult females and two nymphs) genomic DNA was amplified via PCR targeting the cox1 sequence. The BLAST analysis of the cox1 sequence of I. kashmiricus showed 89.29% maximum identity with I. scapularis followed by 88.78% with Ixodes gibbosus and 88.71% with Ixodes apronophorus from Canada, Turkey and Russia, respectively. The obtained 16S rDNA sequence for I. kashmiricus was identical to the sequences of the same species from Pakistan (MW578839). Therefore, the 16S rDNA sequence was not included in further analysis. The obtained cox1 sequence of I. kashmiricus was submitted to GenBank under the accession number OR244356.
Phylogenetically, the cox1 sequence was clustered to the species of the subgenus Ixodes ricinus complex such as I. apronophorus (MH784873) reported from Russia. Furthermore, the cox1 sequence formed sister clades with I. ricinus complex such as I. scapularis, I. gibbosus, Ixodes acuminatus, Ixodes redikorzevi, Ixodes laguri, Ixodes inopinatus, Ixodes ricinus, and Ixodes affinis reported from Canada, Turkey, Malta, Romania, Serbia, Tunisia, Italy and the United States (Figure 2).

3.3. Sequences and Phylogenetic Relationship of Theileria spp. and Anaplasma spp.

Among all molecularly analyzed ticks, Theileria spp. and Anaplasma spp. DNA were detected in two (1.65%: one adult female and one nymph) and four (3.3%: two adult females and two nymphs) I. kashmiricus ticks, respectively (Table 2). Moreover, other pathogens such as Coxiella spp. and Borrelia spp. based on groEL and flaB markers, respectively, were not amplified by PCR.
The 18S rDNA sequence of Theileria spp. showed 98.11% maximum identity with Theileria cf. sinensis reported from South Africa, which was followed by 97.99–97.87% identity with T. sinensis reported from Malaysia and China. Similarly, the 16S rDNA sequence of Anaplasma spp. showed 100% identity with A. capra reported from the Republic of Korea, China, and Iraq. The obtained 18S rDNA sequence of T. sinensis-like and 16S rDNA sequence of A. capra were submitted to GenBank (OR244360: T. sinensis-like and OR244358: A. capra). The details regarding the detection rate of T. sinensis-like and Anaplasma capra are shown in Table 2.
The phylogenetic tree of the 18S rDNA sequence for T. sinensis-like clustered with T. sinensis (JQ037786-JQ037787) reported from South Africa and T. cf. sinensis reported from Malaysia (MT271902 and MT271911) and China (KX115427 and KF559355). It formed a sister clade with the sequences of Theileria sergenti, Theileria buffeli and Theileria orientalis (Figure 3). In the case of 16S rDNA, A. capra clustered to the corresponding species reported from South Korea (LC432114), China (MG869594), and Iraq (ON872236) (Figure 4).

4. Discussions

Ixodes ticks are known to transmit various pathogens such as Anaplasma spp., Theileria spp., Coxiella spp., Rickettsia spp., and Borrelia spp. to different hosts [5,7,11,14,20,21,42,43]. Genetic data of I. kashmiricus based on cox1 sequence and their associated pathogens like Theileria spp. and Anaplasma spp. are missing. To date, a total of five Ixodes spp. such as Ixodes hyatti (Peshawar) [44], Ixodes redikorzevi (Kaghan) [45], Ixodes stromi [46], I. kashmiricus (Kashmir and Shangla) [21,33] and an undetermined Ixodes spp. (Swat) [47] have been reported in Pakistan. Among these, only I. kashmiricus (Shangla) has been characterized based on the morphology and molecular level [21]. In addition to the Rickettsia spp., I. kashmiricus associated with any other pathogens have not been characterized. In the current study, I. kashmiricus ticks collected from sheep and goats in district Shangla, Dir Upper and Chitral were characterized based on the cox1 sequence and their associated T. sinensis-like and A. capra for the first time.
Small ruminants such as sheep and goats were found infested by I. kashmiricus ticks. The significantly higher infestation of I. kashmiricus on sheep among small ruminants shows that this tick prefers sheep as a host. The majority of the Ixodes spp. in the I. ricinus complex are associated with small ruminants: sheep and goats [33,48], which graze in areas having favorable climate conditions [49]. Similarly, the study districts are mountainous, having temperatures in the winter season below 10 °C, in the summer season 15–30 °C, a high relative humidity of ~70–80%, and precipitation throughout the year approximately 1000–1400 mm (climate-data.org, [26]). Notably, these transhumant herds seasonally migrate toward the frontiers of the country in northern and northwest areas during the spring and summer seasons (March–September). The frontiers of the country lie in the Palearctic region, which has a high prevalence and distribution of Ixodes ticks because of the availability of suitable environmental conditions [21,33,50]. Moreover, this transhumant movement of the infested hosts can enhance the dispersal of the I. kashmiricus ticks and associated pathogens to novel localities [51].
Ixodes kashmiricus ticks have been described previously by Pomerantzev [33] in India and then genetically characterized by Numan et al. [21] in Pakistan. These locations are at approximately 300 km (km) distance, while the current study’s new localities, Dir Upper and Chitral, are about ~130 km and ~165 km away from the previous collection site in the district Shangla, respectively. These ticks were collected from highly mountainous areas (up to 3000–3500 m elevation), as other members of the I. ricinus complex have been reported from hilly ranges in the Palearctic and Oriental regions [50]. Until the present study, only ITS and 16S rDNA sequences are freely available for I. kashmiricus in GenBank. Herein, we provided for the first time a cox1 sequence for I. kashmiricus, which shared a high identity with the I. ricinus complex. The morphological compatibility of I. kashmiricus was confirmed by molecular characterization, as the 16S rDNA sequence has close resemblance to the I. ricinus complex and clustered with the same species, which was previously reported in Pakistan. Whereas, due to the unavailability of cox1 sequences for I. kashmiricus in GenBank, the obtained cox1 sequence clustered to the I. ricinus complex from the Neotropical and Palearctic regions. The topologies of the constructed phylogeny for I. kashmiricus were paralleled to the sequences of I. ricinus complex [4,21].
Until the present study, except for the undetermined Rickettsia spp., no other pathogens in I. kashmiricus have been reported [21]. Ticks of the I. ricinus complex are the main vector of piroplasmids such as T. annae, T. fuliginosa, and undetermined Theileria spp. [14,17,18]. These Ixodes-associated pathogens have been genetically characterized based on the 18S rDNA. This genetic marker has been demonstrated to be valuable for determining evolutionary studies of protozoans [52,53,54,55]. The suggested identity or threshold level of 18S rDNA locus for Theileria spp. to be considered the same species is 99.3% [52]. However, the use of various parameters to determine genetic distances has led to insufficient use of this measure [18,55]. For instance, Theileria fuliginosa [18] and Theileria ornithorhynchi [56] have been considered similar species with 97.6% and 98.2% maximum identity, respectively. Likewise, the corresponding sequence of T. sinensis-like detected in I. kashmiricus showed 98.11% maximum identity. Furthermore, the obtained 18S rDNA sequence of T. sinensis-like showed a minimum nucleotide difference of 16 bp with the sequences of T. sinensis, which showed 1.89% (16/844 bp) genetic difference. Due to the high genetic differences, this species was considered as T. sinensis-like or related to T. sinensis. Similarly, the phylogeny of the obtained 18S rDNA sequence indicated a similar relationship or related to the T. sinensis reported from the Old World. The constructed phylogeny work has a comparable topology to those demonstrated by Loh et al. [18], whereas Theileria spp. is derived from Ixodes spp.
Ixodes ticks collected from cattle and sheep have been reported as a vector of A. phagocytophilum and A. capra [11,12,13,14,15]. This study presents the first evidence for A. capra in I. kashmiricus. For the molecular identification of Anaplasma spp., a highly conserved 16S rDNA sequence has been used historically [27,57]. Likewise, the 16S rDNA sequence of A. capra was detected in I. kashmiricus, which was reported for the first time. The present study reported T. sinensis-like and A. capra in I. kashmiricus ticks infesting small ruminants that closely related to the corresponding species. The zoonotic pathogenicity of the T. sinensis-like and A. capra was detected in this survey remains to be examined considering the significance of piroplasm and bacterial species as an agent of novel emerging infectious agents carried by I. kashmiricus ticks.

5. Conclusions

A new locality for I. kashmiricus was recorded, and its phylogenetic position based on the cox1 sequence was delineated for the first time. Based on a phylogenetic analysis, the I. kashmiricus tick is closely related and clustered with the species of same subgenus—the I. ricinus complex. Theileria sinensis-like and A. capra were detected in I. kashmiricus for the first time. These findings may help to further understand the epidemiology of the I. kashmiricus tick and its associated Theileria and Anaplasma species, and they may strengthen the need for tick and tick-borne pathogen surveillance programs.

Author Contributions

A.A. (Abid Ali) designed the study. M.M.A., T.T., A.A. (Abdulaziz Alouffi), H.A. (Haroon Ahmed), M.I.R. and K.-H.T., carried out the experiments, wrote the initial draft and H.A. (Haroon Ahmed) and H.A. (Haroon Akbar) critically reviewed the final draft. A.A. (Abid Ali) and M.N. performed the phylogenetic and statistical analysis. All authors have read and agreed to the published version of the manuscript.

Funding

The researchers supporting project number (RSP2023R494), King Saud University, Riyadh, Saudi Arabia. This research was also partially funded by the National Science and Technology Council, grant number: 112-2327-B-002-008.

Institutional Review Board Statement

This study was approved by the Advance Studies Research Board (ASRB: Dir/A&R/AWKUM/2022/9396) committee members of Abdul Wali Khan University, Mardan KP, Pakistan.

Informed Consent Statement

Not applicable.

Data Availability Statement

All the relevant data are within the manuscript.

Acknowledgments

The authors acknowledge the financial support provided by the Higher Education Commission (HEC) and Pakistan Science Foundation (PSF). The researchers supporting project number (RSP2023R494), King Saud University, Riyadh, Saudi Arabia.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Clifford, C.M.; Sonenshine, D.E.; Keirans, J.E.; Kohls, G.M. Systematics of the subfamily Ixodinae (Acarina: Ixodidae). 1. the subgenera of Ixodes. Ann. Entomol. Soc. Am. 1973, 66, 489–500. [Google Scholar] [CrossRef]
  2. Filippova, N.A. Ixodid ticks of the subfamily Ixodinae. Fauna SSSR, Paukoobraznye, Izdatielstwo Nauka, Moskwa–Leningrad. Arachnida 1977, 4, 272–283. (In Russian) [Google Scholar]
  3. Guglielmone, A.A.; Petney, T.N.; Robbins, R.G. Ixodidae (Acari: Ixodoidea): Descriptions and redescriptions of all known species from 1758 to December 31, 2019. Zootaxa 2020, 4871, 1–322. [Google Scholar]
  4. Rar, V.; Yakimenko, V.; Tikunov, A.; Vinarskaya, N.; Tancev, A.; Babkin, I.; Epikhina, T.; Tikunova, N. Genetic and morphological characterization of Ixodes apronophorus from Western Siberia, Russia. Ticks Tick Borne Dis. 2020, 11, 101284. [Google Scholar] [CrossRef] [PubMed]
  5. Pietzsch, M.E.; Medlock, J.M.; Jones, L.; Avenell, D.; Abbott, J.; Harding, P.; Leach, S. Distribution of Ixodes ricinus in the British Isles: Investigation of historical records. Med. Vet. Entomol. 2005, 19, 306–314. [Google Scholar] [PubMed]
  6. Lommano, E.; Bertaiola, L.; Dupasquier, C.; Gern, L. Infections and coinfections of questing Ixodes ricinus ticks by emerging zoonotic pathogens in Western Switzerland. Appl. Environ. Microbiol. 2012, 78, 4606–4612. [Google Scholar] [CrossRef]
  7. Pilloux, L.; Baumgartner, A.; Jaton, K.; Lienhard, R.; Ackermann-Gäumann, R.; Beuret, C.; Greub, G. Prevalence of Anaplasma phagocytophilum and Coxiella burnetii in Ixodes ricinus ticks in Switzerland: An underestimated epidemiologic risk. New Microbes New Infect. 2019, 27, 22–26. [Google Scholar] [CrossRef]
  8. Sands, B.; Lihou, K.; Lait, P.; Wall, R. Prevalence of Babesia spp. pathogens in the ticks Dermacentor reticulatus and Ixodes ricinus in the UK. Acta Trop. 2022, 236, 106692. [Google Scholar] [CrossRef]
  9. Guo, W.P.; Zhang, B.; Wang, Y.H.; Xu, G.; Wang, X.; Ni, X.; Zhou, E.M. Molecular identification and characterization of Anaplasma capra and Anaplasma platys-like in Rhipicephalus microplus in Ankang, Northwest China. BMC Infect. Dis. 2019, 19, 1–9. [Google Scholar]
  10. Altay, K.; Erol, U.; Sahin, O.F. The first molecular detection of Anaplasma capra in domestic ruminants in the central part of Turkey, with genetic diversity and genotyping of Anaplasma capra. Trop. Anim. Health Prod. 2022, 54, 129. [Google Scholar] [CrossRef]
  11. Aktas, M.; Vatansever, Z.; Altay, K.; Aydin, M.F.; Dumanli, N. Molecular evidence for Anaplasma phagocytophilum in Ixodes ricinus from Turkey. Trans. R. Soc. Trop. Med. Hyg. 2010, 104, 10–15. [Google Scholar] [PubMed]
  12. Bown, K.J.; Begon, M.; Bennett, M.; Woldehiwet, Z.; Ogden, N.H. Seasonal dynamics of Anaplasma phagocytophila in a rodent-tick (Ixodes trianguliceps) system, United Kingdom. Emerg. Infect. Dis. 2003, 9, 63. [Google Scholar] [CrossRef] [PubMed]
  13. Ogden, N.H.; Lindsay, L.R.; Hanincová, K.; Barker, I.K.; Bigras-Poulin, M.; Charron, D.F.; Heagy, A.; Francis, C.M.; O’Callaghan, C.J.; Schwartz, I.; et al. Role of migratory birds in introduction and range expansion of Ixodes scapularis ticks and of Borrelia burgdorferi and Anaplasma phagocytophilum in Canada. Appl. Environ. Microbiol. 2008, 74, 1780–1790. [Google Scholar]
  14. Remesar, S.; Diaz, P.; Prieto, A.; García-Dios, D.; Panadero, R.; Fernández, G.; Brianti, E.; Díez-Baños, P.; Morrondo, P.; López, C.M. Molecular detection and identification of piroplasms (Babesia spp.; Theileria spp.) and Anaplasma phagocytophilum in questing ticks from northwest Spain. Med. Vet. Entomol. 2021, 35, 51–58. [Google Scholar] [PubMed]
  15. Li, H.; Zheng, Y.C.; Ma, L.; Jia, N.; Jiang, B.G.; Jiang, R.R.; Huo, Q.B.; Wang, Y.W.; Liu, H.B.; Chu, Y.L.; et al. Human infection with a novel tick-borne Anaplasma species in China: A surveillance study. Lancet Infect. Dis. 2015, 15, 663–670. [Google Scholar] [CrossRef] [PubMed]
  16. Ali, A.; Ullah, S.; Numan, M.; Almutairi, M.; Alouffi, A.; Tanaka, T. First report on tick-borne pathogens detected in ticks infesting stray dogs near butcher shops. Front. Vet. Sci. 2023, 10, 1246871. [Google Scholar]
  17. Camacho, A.T.; Pallas, E.; Gestal, J.J.; Guitián, F.J.; Olmeda, A.S.; Telford III, S.R.; Spielman, A. Ixodes hexagonus is the main candidate as vector of Theileria annae in northwest Spain. Vet. Parasitol. 2003, 112, 157–163. [Google Scholar] [CrossRef]
  18. Loh, S.M.; Paparini, A.; Ryan, U.; Irwin, P.; Oskam, C. Identification of Theileria fuliginosa-like species in Ixodes australiensis ticks from western grey kangaroos (Macropus fuliginosus) in Western Australia. Ticks Tick Borne Dis. 2018, 9, 632–637. [Google Scholar]
  19. Wang, Y.; Wang, B.; Zhang, Q.; Li, Y.; Yang, Z.; Han, S.; Yuan, G.; Wang, S.; He, H. The common occurrence of Theileria ovis in Tibetan Sheep and the first report of Theileria sinensis in yaks from southern Qinghai, China. Acta Parasitol. 2021, 66, 1177–1185. [Google Scholar]
  20. Sabitova, Y.; Rar, V.; Tikunov, A.; Yakimenko, V.; Korallo-Vinarskaya, N.; Livanova, N.; Tikunova, N. Detection and genetic characterization of a putative novel Borrelia genospecies in Ixodes apronophorus/Ixodes persulcatus/Ixodes trianguliceps sympatric areas in Western Siberia. Ticks Tick Borne Dis. 2023, 14, 102075. [Google Scholar] [CrossRef]
  21. Numan, M.; Islam, N.; Adnan, M.; Zaman Safi, S.; Chitimia-Dobler, L.; Labruna, M.B.; Ali, A. First genetic report of Ixodes kashmiricus and associated Rickettsia sp. Parasit. Vectors 2022, 15, 378. [Google Scholar] [CrossRef] [PubMed]
  22. Barker, S.C.; Walker, A.R.; Campelo, D. A list of the 70 species of Australian ticks; diagnostic guides to and species accounts of Ixodes holocyclus (paralysis tick), Ixodes cornuatus (southern paralysis tick) and Rhipicephalus australis (Australian cattle tick); and consideration of the place of Australia in the evolution of ticks with comments on four controversial ideas. Int. J. Parasitol. 2014, 44, 941–953. [Google Scholar] [PubMed]
  23. Cheng, T.Y.; Chen, Z.; Li, Z.B.; Liu, G.H. First report of Ixodes nipponensis infection in goats in China. Vector-Borne Zoonotic Dis. 2018, 18, 575–578. [Google Scholar] [CrossRef] [PubMed]
  24. Lv, J.; Wu, S.; Zhang, Y.; Chen, Y.; Feng, C.; Yuan, X.; Jia, G.; Deng, J.; Wang, C.; Wang, Q.; et al. Assessment of four DNA fragments (COI, 16S rDNA, ITS2, 12S rDNA) for species identification of the Ixodida (Acari: Ixodida). Parasit. Vectors 2014, 7, 93. [Google Scholar]
  25. Ali, A.; Zahid, H.; Zeb, I.; Tufail, M.; Khan, S.; Haroon, M.; Bilal, M.; Hussain, M.; Alouffi, A.S.; Muñoz-Leal, S. Risk factors associated with tick infestations on equids in Khyber Pakhtunkhwa, Pakistan, with notes on Rickettsia massiliae detection. Parasit. Vectors 2021, 14, 363. [Google Scholar] [CrossRef]
  26. Ali, A.; Numan, M.; Khan, M.; Aiman, O.; Muñoz-Leal, S.; Chitimia-Dobler, L.; Labruna, M.B.; Nijhof, A.M. Ornithodoros (Pavlovskyella) ticks associated with a Rickettsia sp. in Pakistan. Parasit. Vectors 2022, 15, 138. [Google Scholar]
  27. Khan, Z.; Shehla, S.; Alouffi, A.; Kashif Obaid, M.; Zeb Khan, A.; Almutairi, M.M.; Numan, M.; Aiman, O.; Alam, S.; Ullah, S.; et al. Molecular survey and genetic characterization of Anaplasma marginale in ticks collected from livestock hosts in Pakistan. Animals 2022, 12, 1708. [Google Scholar] [CrossRef]
  28. Ahmad, I.; Ullah, S.; Alouffi, A.; Almutairi, M.M.; Khan, M.; Numan, M.; Safi, S.Z.; Chitimia-Dobler, L.; Tanaka, T.; Ali, A. Description of Male, Redescription of Female, Host Record, and Phylogenetic Position of Haemaphysalis danieli. Pathogens 2022, 11, 1495. [Google Scholar] [CrossRef]
  29. Mangold, A.J.; Bargues, M.D.; Mas-Coma, S. Mitochondrial 16S rDNA sequences and phylogenetic relationships of species of Rhipicephalus and other tick genera among Metastriata (Acari: Ixodidae). Parasitol. Res. 1998, 84, 478–484. [Google Scholar] [CrossRef]
  30. Kovalev, S.Y.; Golovljova, I.V.; Mukhacheva, T.A. Natural hybridization between Ixodes ricinus and Ixodes persulcatus ticks evidenced by molecular genetics methods. Ticks Tick Borne Dis. 2016, 7, 113–118. [Google Scholar] [CrossRef]
  31. Karim, S.; Budachetri, K.; Mukherjee, N.; Williams, J.; Kausar, A.; Hassan, M.J.; Adamson, S.; Dowd, S.E.; Apanskevich, D.; Arijo, A.; et al. A study of ticks and tick-borne livestock pathogens in Pakistan. PLoS Negl. Trop. Dis. 2017, 11, e0005681. [Google Scholar] [CrossRef] [PubMed]
  32. Khan, S.M.; Khan, M.; Alouffi, A.; Almutairi, M.M.; Numan, M.; Ullah, S.; Obaid, M.K.; Islam, Z.U.; Ahmed, H.; Tanaka, T.; et al. Phylogenetic Position of Haemaphysalis kashmirensis and Haemaphysalis cornupunctata, with Notes on Rickettsia spp. Genes 2023, 14, 360. [Google Scholar] [CrossRef] [PubMed]
  33. Pomerantzev, B.I. New ticks of the family Ixodidae. Parazitol Sborn Zool Inst Akad Nauk. SSSR 1948, 10, 20–24. (In Russian) [Google Scholar]
  34. Sambrook, J.; Fritsch, E.F.; Maniatis, T. Molecular Cloning: A Laboratory Manual, 2nd ed.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 1989. [Google Scholar]
  35. Folmer, O.; Hoeh, W.R.; Black, M.B.; Vrijenhoek, R.C. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotech. 1994, 3, 294–299. [Google Scholar]
  36. Inokuma, H.; Raoult, D.; Brouqui, P. Detection of Ehrlichia platys DNA in brown dog ticks (Rhipicephalus sanguineus) in Okinawa Island, Japan. J. Clin. Microbiol. 2000, 38, 4219–4221. [Google Scholar] [CrossRef]
  37. Duron, O.; Noël, V.; McCoy, K.D.; Bonazzi, M.; Sidi-Boumedine, K.; Morel, O.; Vavre, F.; Zenner, L.; Jourdain, E.; Durand, P.; et al. The recent evolution of a maternally-inherited endosymbiont of ticks led to the emergence of the Q fever pathogen, Coxiella burnetii. PLoS Pathog. 2015, 11, e1004892. [Google Scholar] [CrossRef]
  38. Stromdahl, E.Y.; Williamson, P.C.; Kollars, T.M., Jr.; Evans, S.R.; Barry, R.K.; Vince, M.A.; Dobbs, N.A. Evidence of Borrelia lonestari DNA in Amblyomma americanum (Acari: Ixodidae) removed from humans. J. Clin. Microbiol. 2003, 41, 5557–5562. [Google Scholar] [CrossRef]
  39. Hall, T.; Biosciences, I.; Carlsbad, C.J.G.B.B. BioEdit: An important software for molecular biology. GERF Bull Biosci. 2011, 2, 60–61. [Google Scholar]
  40. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547. [Google Scholar] [CrossRef]
  41. Edgar, R.C. MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004, 32, 1792–1797. [Google Scholar] [CrossRef]
  42. Schouls, L.M.; Van De Pol, I.; Rijpkema, S.G.; Schot, C.S. Detection and identification of Ehrlichia, Borrelia burgdorferi sensu lato, and Bartonella species in Dutch Ixodes ricinus ticks. J. Clin. Microbiol. 1999, 37, 2215–2222. [Google Scholar] [CrossRef] [PubMed]
  43. Parola, P.; Paddock, C.D.; Socolovschi, C.; Labruna, M.B.; Mediannikov, O.; Kernif, T.; Abdad, M.Y.; Stenos, J.; Bitam, I.; Fournier, P.E.; et al. Update on tick-borne rickettsioses around the world: A geographic approach. Clin. Microbiol. Rev. 2013, 26, 657–702. [Google Scholar] [CrossRef] [PubMed]
  44. Clifford, C.M.; Hoogstraal, H.; Kohls, G.M. Ixodes hyatti, n. sp.; and I. shahi, n. sp. (Acarina: Ixodidae), parasites of pikas (Lagomorpha: Ochotonidae) in the Himalayas of Nepal and West Pakistan. J. Med. Entomol. 1971, 8, 430–438. [Google Scholar] [CrossRef] [PubMed]
  45. Begum, F.; Wisseman, C.L., Jr.; Casals, J. Tick-borne viruses of west Pakistan: II. Hazara virus, a new agent isolated from Ixodes redikorzevi ticks from the Kaghan valley, w. Pakistan. Am. J. Epidemiol. 1970, 92, 192–194. [Google Scholar] [CrossRef]
  46. Filippova, N.A. Ixodes stromi, new species of tick and its systematic position in Ixodinae. Zool. Zhurnal. 1957, 36, 864–869. (In Russian) [Google Scholar]
  47. Begum, F.; Wisseman, C.L., Jr.; Traub, R. Tick-borne viruses of West Pakistan: I. Isolation and general characteristics. Am. J. Epidemiol. 1970, 92, 180–191. [Google Scholar] [CrossRef]
  48. Hoogstraal, H. The epidemiology of tick-borne Crimean-Congo hemorrhagic fever in Asia, Europe, and Africa. J. Med. Entomol. 1979, 15, 307–417. [Google Scholar] [CrossRef]
  49. Gilbert, L.; Aungier, J.; Tomkins, J.L. Climate of origin affects tick (Ixodes ricinus) host-seeking behavior in response to temperature: Implications for resilience to climate change? Ecol. Evol. 2014, 4, 1186–1198. [Google Scholar] [CrossRef]
  50. Filippova, N.A. Forms of sympatry and possible ways of microevolution of closely related species of the group Ixodes ricinus-persulcatus (Ixodidae). Acta Zool. Litu. 2002, 12, 215–227. [Google Scholar] [CrossRef]
  51. Volkova, V.V.; Howey, R.; Savill, N.J.; Woolhouse, M.E. Sheep movement networks and the transmission of infectious diseases. PLoS ONE 2010, 5, e11185. [Google Scholar] [CrossRef]
  52. Schnittger, L.; Yin, H.; Gubbels, M.J.; Beyer, D.; Niemann, S.; Jongejan, F.; Ahmed, J.S. Phylogeny of sheep and goat Theileria and Babesia parasites. Parasitol. Res. 2003, 91, 398–406. [Google Scholar] [PubMed]
  53. Schnittger, L.; Rodriguez, A.E.; Florin-Christensen, M.; Morrison, D.A. Babesia: A world emerging. Infect. Genet. Evol. 2012, 12, 1788–1809. [Google Scholar] [CrossRef] [PubMed]
  54. Sivakumar, T.; Hayashida, K.; Sugimoto, C.; Yokoyama, N. Evolution and genetic diversity of Theileria. Infect. Genet. Evol. 2014, 27, 250–263. [Google Scholar] [CrossRef]
  55. Ullah, K.; Numan, M.; Alouffi, A.; Almutairi, M.M.; Zahid, H.; Khan, M.; Islam, Z.U.; Kamil, A.; Safi, S.Z.; Ahmed, H.; et al. Molecular Characterization and assessment of risk factors associated with Theileria annulata infection. Microorganisms 2022, 10, 1614. [Google Scholar] [CrossRef] [PubMed]
  56. Paparini, A.; Macgregor, J.; Ryan, U.M.; Irwin, P.J. First molecular characterization of Theileria ornithorhynchi Mackerras, 1959: Yet another challenge to the systematics of the piroplasms. Protist 2015, 166, 609–620. [Google Scholar] [CrossRef] [PubMed]
  57. Alam, S.; Khan, M.; Alouffi, A.; Almutairi, M.M.; Ullah, S.; Numan, M.; Islam, N.; Khan, Z.; Aiman, O.; Zaman Safi, S.; et al. Spatio-temporal patterns of ticks and molecular survey of Anaplasma marginale, with notes on their phylogeny. Microorganisms 2022, 10, 1663. [Google Scholar] [CrossRef]
Animals 13 03232 g001
Figure 1. Map showing the locations (black stars) where Ixodes ticks were collected during this study.
Figure 1. Map showing the locations (black stars) where Ixodes ticks were collected during this study.
Animals 13 03232 g001
Animals 13 03232 g002
Figure 2. Phylogenetic tree of Ixodes species based on the cox1 sequences. The cox1 sequence of Ixodes simplex belonging to the subgenus Eschatocephalus was taken as an outgroup. The obtained cox1 sequence was highlighted with bold and underlined fonts (OR244356).
Figure 2. Phylogenetic tree of Ixodes species based on the cox1 sequences. The cox1 sequence of Ixodes simplex belonging to the subgenus Eschatocephalus was taken as an outgroup. The obtained cox1 sequence was highlighted with bold and underlined fonts (OR244356).
Animals 13 03232 g002
Animals 13 03232 g003
Figure 3. Phylogenetic tree of Theileria species based on the 18S rDNA sequences. The 18S rDNA sequence of Theileria annae was taken as an outgroup. The obtained 18S rDNA sequence was highlighted with bold and underlined fonts (OR244360).
Figure 3. Phylogenetic tree of Theileria species based on the 18S rDNA sequences. The 18S rDNA sequence of Theileria annae was taken as an outgroup. The obtained 18S rDNA sequence was highlighted with bold and underlined fonts (OR244360).
Animals 13 03232 g003
Animals 13 03232 g004
Figure 4. Phylogenetic tree of Anaplasma species based on the 16S rDNA sequences. The 16S rDNA sequence of “Candidatus Anaplasma sphenisci” was taken as an outgroup. The obtained 16S rDNA sequence was highlighted with bold and underlined fonts (OR244358).
Figure 4. Phylogenetic tree of Anaplasma species based on the 16S rDNA sequences. The 16S rDNA sequence of “Candidatus Anaplasma sphenisci” was taken as an outgroup. The obtained 16S rDNA sequence was highlighted with bold and underlined fonts (OR244358).
Animals 13 03232 g004
Table 1. List of the primers used to amplify target DNA of the Ixodes kashmiricus and associated Theileria and Anaplasma species.
Table 1. List of the primers used to amplify target DNA of the Ixodes kashmiricus and associated Theileria and Anaplasma species.
Organism/Marker Primer Sequences 5′-3′AmpliconsAnnealing TemperatureReferences
Ticks/cox1HC02198: TAAACTTCAGGGTGACCAAAAAATCA649 bp55 °C[35]
LCO1490: GGTCAACAAATCATAAAGATATTGG
Anaplasma spp./16S rDNAEHR16SD: GGTACCYACAGAAGAAGTCC344 bp55 °C[36]
EHR16SR: TAGCACTCATCGTTTACAGC
Theileria spp./18S rRNA18S_F: GGTAATTCTAGAGCTAATACATGAGC897 bp56 °CThis study
18S_R: ACAATAAAGTAAAAAACAYTTCAAAG
Coxiella spp./groEL *CoxGrF1: TTTGAAAAYATGGGCGCKCAAATGGT619 bp56 °C[37]
CoxGrR2: CGRTCRCCAAARCCAGGTGC
CoxGrF2: GAAGTGGCTTCGCRTACWTCAGACG
CoxGrFR1: CCAAARCCAGGTGCTTTYAC
Borrelia spp./flabFla SS: AAGAGCTGAAGAGCTTGGAATG354 bp55 °C[38]
Fla RS: CTTTGATCACTTATCATTCTAATAGC
* Nested PCR.
Table 2. Prevalence of identified Ixodes kashmiricus ticks and their life stages and molecular detection of associated Theileria spp. and Anaplasma spp.
Table 2. Prevalence of identified Ixodes kashmiricus ticks and their life stages and molecular detection of associated Theileria spp. and Anaplasma spp.
Location/
Districts		HostInfested/Observed HostsNumbers of Ticks/Life StagesTotal Collected Ticksp ValueNumber of Ticks Subjected to DNA IsolationAmplified cox1 for Ixodes kashmiricusAmplified 18S rDNA for TheileriaAmplified 16S rDNA for Anaplasma
MalesAdult FemalesNymphs
ShanglaSheep42/473712372232<0.00177 (17M, 38F, 22N)2 (1M, 1F)1 (1F)2 (1F, 1N)
Goats27/39 1124256025 (13F, 12N)1 (1F)1 (1N)1 (1N)
Dir UpperSheep13/18916133814 (3M, 6F, 5N)1 (1N)01 (1F)
Goats11/16 5115215 (3F, 2N)1 (1N)00
ChitralSheep1/5 01010000
Goats0/400000000
Total Sheep (%)56/70 (80)4614085271 (77)91 (20M, 44F, 27N)3 (1M, 1F, 1N)1 (1F)3 (2F, 1N)
Total Goats (%)38/59 (64.4)16353081 (23)30 (16F, 14N)2 (1F, 1N)1 (1N)1 (1N)
Overall Total (%)94/129 (72.87)62 (17.6)175 (49.7)115 (32.7)352 (100) 121 (20M, 60F, 41N)5 (1M, 2F, 2N)2 (1.65) (1F, 1N)4 (3.3) (2F, 2N)
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Numan, M.; Alouffi, A.; Almutairi, M.M.; Tanaka, T.; Ahmed, H.; Akbar, H.; Rashid, M.I.; Tsai, K.-H.; Ali, A. First Detection of Theileria sinensis-like and Anaplasma capra in Ixodes kashmiricus: With Notes on cox1-Based Phylogenetic Position and New Locality Records. Animals 2023, 13, 3232. https://doi.org/10.3390/ani13203232

AMA Style

Numan M, Alouffi A, Almutairi MM, Tanaka T, Ahmed H, Akbar H, Rashid MI, Tsai K-H, Ali A. First Detection of Theileria sinensis-like and Anaplasma capra in Ixodes kashmiricus: With Notes on cox1-Based Phylogenetic Position and New Locality Records. Animals. 2023; 13(20):3232. https://doi.org/10.3390/ani13203232

Chicago/Turabian Style

Numan, Muhammad, Abdulaziz Alouffi, Mashal M. Almutairi, Tetsuya Tanaka, Haroon Ahmed, Haroon Akbar, Muhammad Imran Rashid, Kun-Hsien Tsai, and Abid Ali. 2023. "First Detection of Theileria sinensis-like and Anaplasma capra in Ixodes kashmiricus: With Notes on cox1-Based Phylogenetic Position and New Locality Records" Animals 13, no. 20: 3232. https://doi.org/10.3390/ani13203232

APA Style

Numan, M., Alouffi, A., Almutairi, M. M., Tanaka, T., Ahmed, H., Akbar, H., Rashid, M. I., Tsai, K. -H., & Ali, A. (2023). First Detection of Theileria sinensis-like and Anaplasma capra in Ixodes kashmiricus: With Notes on cox1-Based Phylogenetic Position and New Locality Records. Animals, 13(20), 3232. https://doi.org/10.3390/ani13203232

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop