Variation in the HSL Gene and Its Association with Carcass and Meat Quality Traits in Yak
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Sample Collection
2.2. RNA Extraction and qRT-PCR Analysis
2.3. Meat Quality Trait Measurements
2.4. Genomics DNA Isolation
2.5. PCR Amplification and SNP Identification
2.6. Genotyping
2.7. Statistical Analyses
3. Results
3.1. Tissue Expression of HSL
3.2. Variation in the HSL Gene in Yaks
3.3. LD Analyses of the HSL Gene
3.4. Effects of the HSL Genotype on Meat Quality Traits and Carcass Traits
3.5. Association Analysis of HSL Haplotype Combinations with Meat Quality Traits and Carcass Traits
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Yang, L.; Min, X.; Zhu, Y.; Hu, Y.; Yang, M.; Yu, H.; Li, J.; Xiong, X. Polymorphisms of SORBS 1 Gene and Their Correlation with Milk Fat Traits of Cattleyak. Animals 2021, 11, 3461. [Google Scholar] [CrossRef]
- Lang, Y.; Sha, K.; Zhang, R.; Xie, P.; Luo, X.; Sun, B.; Li, H.; Zhang, L.; Zhang, S.; Liu, X. Effect of electrical stimulation and hot boning on the eating quality of Gannan yak longissimus lumborum. Meat Sci. 2016, 112, 3–8. [Google Scholar] [CrossRef]
- Zhang, L.; Sun, B.; Yu, Q.; Ji, Q.; Xie, P.; Li, H.; Wang, L.; Zhou, Y.; Li, Y.; Huang, C.; et al. The Breed and Sex Effect on the Carcass Size Performance and Meat Quality of Yak in Different Muscles. Korean J. Food Sci. Anim. Resour. 2016, 36, 223–229. [Google Scholar] [CrossRef]
- Hudson, N.J.; Reverter, A.; Greenwood, P.L.; Guo, B.; Cafe, L.M.; Dalrymple, B.P. Longitudinal muscle gene expression patterns associated with differential intramuscular fat in cattle. Animal 2015, 9, 650–659. [Google Scholar] [CrossRef]
- Park, S.J.; Beak, S.H.; Jung, D.J.S.; Kim, S.Y.; Jeong, I.H.; Piao, M.Y.; Kang, H.J.; Fassah, D.M.; Na, S.W.; Yoo, S.P.; et al. Genetic, management, and nutritional factors affecting intramuscular fat deposition in beef cattle—A review. Asian-Australas J. Anim. Sci. 2018, 31, 1043–1061. [Google Scholar] [CrossRef]
- Maltin, C.; Balcerzak, D.; Tilley, R.; Delday, M. Determinants of meat quality: Tenderness. Proc. Nutr. Soc. 2003, 62, 337–347. [Google Scholar] [CrossRef] [PubMed]
- Cheng, J.; Peng, W.; Cao, X.; Huang, Y.; Lan, X.; Lei, C.; Chen, H. Differential Expression of KCNJ12 Gene and Association Analysis of Its Missense Mutation with Growth Traits in Chinese Cattle. Animals 2019, 9, 273. [Google Scholar] [CrossRef] [PubMed]
- Ye, M.H.; Chen, J.L.; Zhao, G.P.; Zheng, M.Q.; Wen, J. Associations of A-FABP and H-FABP markers with the content of intramuscular fat in Beijing-You chicken. Anim. Biotechnol. 2010, 21, 14–24. [Google Scholar] [CrossRef] [PubMed]
- Felgner, P.L.; Gadek, T.R.; Holm, M.; Roman, R.; Chan, H.W.; Wenz, M.; Northrop, J.P.; Ringold, G.M.; Danielsen, M. Lipofection: A highly efficient, lipid-mediated DNA-transfection procedure. Proc. Natl. Acad. Sci. USA 1987, 84, 7413–7417. [Google Scholar] [CrossRef]
- Albert, J.S.; Yerges-Armstrong, L.M.; Horenstein, R.B.; Pollin, T.I.; Sreenivasan, U.T.; Chai, S.; Blaner, W.S.; Snitker, S.; O’Connell, J.R.; Gong, D.W.; et al. Null mutation in hormone-sensitive lipase gene and risk of type 2 diabetes. N. Engl. J. Med. 2014, 370, 2307–2315. [Google Scholar] [CrossRef] [PubMed]
- Reilly, S.M.; Saltiel, A.R. Adapting to obesity with adipose tissue inflammation. Nat. Rev. Endocrinol. 2017, 13, 633–643. [Google Scholar] [CrossRef]
- Wang, H.; Hu, L.; Dalen, K.; Dorward, H.; Marcinkiewicz, A.; Russell, D.; Gong, D.; Londos, C.; Yamaguchi, T.; Holm, C.; et al. Activation of hormone-sensitive lipase requires two steps, protein phosphorylation and binding to the PAT-1 domain of lipid droplet coat proteins. J. Biol. Chem. 2009, 284, 32116–32125. [Google Scholar] [CrossRef]
- Sztalryd, C.; Xu, G.; Dorward, H.; Tansey, J.T.; Contreras, J.A.; Kimmel, A.R.; Londos, C. Perilipin A is essential for the translocation of hormone-sensitive lipase during lipolytic activation. J. Cell Biol. 2003, 161, 1093–1103. [Google Scholar] [CrossRef]
- Qiao, Y.; Huang, Z.; Li, Q.; Liu, Z.; Hao, C.; Shi, G.; Dai, R.; Xie, Z. Developmental changes of the FAS and HSL mRNA expression and their effects on the content of intramuscular fat in Kazak and Xinjiang sheep. J. Genet. Genom. 2007, 34, 909–917. [Google Scholar] [CrossRef]
- Lafontan, M.; Langin, D. Lipolysis and lipid mobilization in human adipose tissue. Prog. Lipid. Res. 2009, 48, 275–297. [Google Scholar] [CrossRef]
- Hoffstedt, J.; Arner, P.; Schalling, M.; Pedersen, N.L.; Sengul, S.; Ahlberg, S.; Iliadou, A.; Lavebratt, C. A common hormone-sensitive lipase i6 gene polymorphism is associated with decreased human adipocyte lipolytic function. Diabetes 2001, 50, 2410–2413. [Google Scholar] [CrossRef]
- Carlsson, E.; Johansson, L.E.; Strom, K.; Hoffstedt, J.; Groop, L.; Holm, C.; Ridderstrale, M. The hormone-sensitive lipase C-60G promoter polymorphism is associated with increased waist circumference in normal-weight subjects. Int. J. Obes. 2006, 30, 1442–1448. [Google Scholar] [CrossRef]
- Hsiao, P.J.; Chen, Z.C.; Hung, W.W.; Yang, Y.H.; Lee, M.Y.; Huang, J.F.; Kuo, K.K. Risk interaction of obesity, insulin resistance and hormone-sensitive lipase promoter polymorphisms (LIPE-60 C > G) in the development of fatty liver. BMC Med. Genet. 2013, 14, 54. [Google Scholar] [CrossRef]
- Qi, L.; Shen, H.; Larson, I.; Barnard, J.R.; Schaefer, E.J.; Ordovas, J.M. Genetic variation at the hormone sensitive lipase: Gender-specific association with plasma lipid and glucose concentrations. Clin. Genet. 2004, 65, 93–100. [Google Scholar] [CrossRef] [PubMed]
- Fang, X.; Zhao, Z.; Jiang, P.; Yu, H.; Xiao, H.; Yang, R. Identification of the bovine HSL gene expression profiles and its association with fatty acid composition and fat deposition traits. Meat Sci. 2017, 131, 107–118. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.P.; Chung, S.; Soni, K.; Bourdages, H.; Hermo, L.; Trasler, J.; Mitchell, G.A. Expression of human hormone-sensitive lipase (HSL) in postmeiotic germ cells confers normal fertility to HSL-deficient mice. Endocrinology 2004, 145, 5688–5693. [Google Scholar] [CrossRef] [PubMed]
- Fang, X.B.; Zhang, L.P.; Yu, X.Z.; Li, J.Y.; Lu, C.Y.; Zhao, Z.H.; Yang, R.J. Association of HSL gene E1-c.276C>T and E8-c.51C>T mutation with economical traits of Chinese Simmental cattle. Mol. Biol. Rep. 2014, 41, 105–112. [Google Scholar] [CrossRef] [PubMed]
- Goszczynski, D.E.; Ripoli, M.V.; Takeshima, S.N.; Baltian, L.; Aida, Y.; Giovambattista, G. Haplotype determination of the upstream regulatory region and the second exon of the BoLA-DRB3 gene in Holstein cattle. Tissue Antigens 2014, 83, 180–183. [Google Scholar] [CrossRef] [PubMed]
- Lei, M.G.; Wu, Z.F.; Deng, C.Y.; Dai, L.H.; Zhang, Z.B.; Xiong, Y.Z. Sequence and polymorphism analysis of porcine hormone-sensitive lipase gene 5′-UTR and exon I. Yi Chuan Xue Bao 2005, 32, 354–359. [Google Scholar] [PubMed]
- Gui, L.S.; Raza, S.H.A.; Memon, S.; Li, Z.; Abd El-Aziz, A.H.; Ullah, I.; Jahejo, A.R.; Shoorei, H.; Khan, R.; Quan, G.; et al. Association of hormone-sensitive lipase (HSL) gene polymorphisms with the intramuscular fat content in two Chinese beef cattle breeds. Genomics 2020, 112, 3883–3889. [Google Scholar] [CrossRef] [PubMed]
- Liu, M.; Peng, J.; Xu, D.Q.; Zheng, R.; Li, F.E.; Li, J.L.; Zuo, B.; Lei, M.G.; Xiong, Y.Z.; Deng, C.Y.; et al. Association of MYF5 and MYOD1 gene polymorphisms and meat quality traits in Large White x Meishan F2 pig populations. Biochem. Genet. 2008, 46, 720–732. [Google Scholar] [CrossRef] [PubMed]
- Shackelford, S.D.; Wheeler, T.L.; Koohmaraie, M. Evaluation of slice shear force as an objective method of assessing beef longissimus tenderness. J. Anim. Sci. 1999, 77, 2693–2699. [Google Scholar] [CrossRef]
- Honikel, K.O. Reference methods for the assessment of physical characteristics of meat. Meat Sci. 1998, 49, 447–457. [Google Scholar] [CrossRef]
- Nei, M.; Roychoudhury, A.K. Sampling variances of heterozygosity and genetic distance. Genetics 1974, 76, 379–390. [Google Scholar] [CrossRef]
- Botstein, D.; White, R.L.; Skolnick, M.; Davis, R.W. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet. 1980, 32, 314–331. [Google Scholar]
- Nishimura, T.; Hattori, A.; Takahashi, K. Structural changes in intramuscular connective tissue during the fattening of Japanese black cattle: Effect of marbling on beef tenderization. J. Anim. Sci. 1999, 77, 93–104. [Google Scholar] [CrossRef]
- O’Quinn, T.G.; Brooks, J.C.; Polkinghorne, R.J.; Garmyn, A.J.; Johnson, B.J.; Starkey, J.D.; Rathmann, R.J.; Miller, M.F. Consumer assessment of beef strip loin steaks of varying fat levels. J. Anim. Sci. 2012, 90, 626–634. [Google Scholar] [CrossRef] [PubMed]
- Jeong, J.; Kwon, E.G.; Im, S.K.; Seo, K.S.; Baik, M. Expression of fat deposition and fat removal genes is associated with intramuscular fat content in longissimus dorsi muscle of Korean cattle steers. J. Anim. Sci. 2012, 90, 2044–2053. [Google Scholar] [CrossRef]
- Blaise, R.; Guillaudeux, T.; Tavernier, G.; Daegelen, D.; Evrard, B.; Mairal, A.; Holm, C.; Jegou, B.; Langin, D. Testis hormone-sensitive lipase expression in spermatids is governed by a short promoter in transgenic mice. J. Biol. Chem. 2001, 276, 5109–5115. [Google Scholar] [CrossRef]
- Yeaman, S.J. Hormone-sensitive lipase--new roles for an old enzyme. Biochem. J. 2004, 379, 11–22. [Google Scholar] [CrossRef]
- Xu, Y.; Zhou, Y.; Wang, N.; Lan, X.; Zhang, C.; Lei, C.; Chen, H. Integrating haplotypes and single genetic variability effects of the Pax7 gene on growth traits in two cattle breeds. Genome 2013, 56, 9–15. [Google Scholar] [CrossRef]
- Gerbens, F.; de Koning, D.J.; Harders, F.L.; Meuwissen, T.H.; Janss, L.L.; Groenen, M.A.; Veerkamp, J.H.; Van Arendonk, J.A.; te Pas, M.F. The effect of adipocyte and heart fatty acid-binding protein genes on intramuscular fat and backfat content in Meishan crossbred pigs. J. Anim. Sci. 2000, 78, 552–559. [Google Scholar] [CrossRef]
- Goszczynski, D.E.; Mazzucco, J.P.; Ripoli, M.V.; Villarreal, E.L.; Rogberg-Munoz, A.; Mezzadra, C.A.; Melucci, L.M.; Giovambattista, G. Characterization of the bovine gene LIPE and possible influence on fatty acid composition of meat. Meta Gene 2014, 2, 746–760. [Google Scholar] [CrossRef] [PubMed]
- Ipsaro, J.J.; Huang, L.; Mondragon, A. Structures of the spectrin-ankyrin interaction binding domains. Blood 2009, 113, 5385–5393. [Google Scholar] [CrossRef] [PubMed]
- Yang, G.; Forrest, R.; Zhou, H.; Hickford, J. Variation in the ovine hormone-sensitive lipase gene (HSL) and its association with growth and carcass traits in New Zealand Suffolk sheep. Mol. Biol. Rep. 2014, 41, 2463–2469. [Google Scholar] [CrossRef]
- Shaul, O. How introns enhance gene expression. Int. J. Biochem. Cell Biol. 2017, 91, 145–155. [Google Scholar] [CrossRef]
- Nott, A.; Meislin, S.H.; Moore, M.J. A quantitative analysis of intron effects on mammalian gene expression. RNA 2003, 9, 607–617. [Google Scholar] [CrossRef]
- Dadi, H.; Kim, J.J.; Yoon, D.; Kim, K.S. Evaluation of Single Nucleotide Polymorphisms (SNPs) Genotyped by the Illumina Bovine SNP50K in Cattle Focusing on Hanwoo Breed. Asian-Australas J. Anim. Sci. 2012, 25, 28–32. [Google Scholar] [CrossRef]
- Orozco, G.; Hinks, A.; Eyre, S.; Ke, X.; Gibbons, L.J.; Bowes, J.; Flynn, E.; Martin, P.; Wellcome Trust Case Control, C.; Consortium, Y.; et al. Combined effects of three independent SNPs greatly increase the risk estimate for RA at 6q23. Hum. Mol. Genet. 2009, 18, 2693–2699. [Google Scholar] [CrossRef]
- Horne, B.D.; Camp, N.J. Principal component analysis for selection of optimal SNP-sets that capture intragenic genetic variation. Genet. Epidemiol. 2004, 26, 11–21. [Google Scholar] [CrossRef]
- Ciobanu, D.C.; Bastiaansen, J.W.; Lonergan, S.M.; Thomsen, H.; Dekkers, J.C.; Plastow, G.S.; Rothschild, M.F. New alleles in calpastatin gene are associated with meat quality traits in pigs. J. Anim. Sci. 2004, 82, 2829–2839. [Google Scholar] [CrossRef]
- Gui, L.S.; Raza, S.H.A.; Sun, Y.G.; Khan, R.; Ullah, I.; Han, Y.C. Detection of polymorphisms in the promoter of bovine gene and their effects on intramuscular fat content in Chinese indigenous cattle. Gene 2019, 700, 47–51. [Google Scholar] [CrossRef]
- Zhao, P.; He, Z.; Xi, Q.; Sun, H.; Luo, Y.; Wang, J.; Liu, X.; Zhao, Z.; Li, S. Variations in HIF-1alpha Contributed to High Altitude Hypoxia Adaptation via Affected Oxygen Metabolism in Tibetan Sheep. Animals 2021, 12, 58. [Google Scholar] [CrossRef]
Gene | Region | Primer Sequence (5′–3′) | Amplicon Size (bp) | Primer Usage |
---|---|---|---|---|
HSL | Exon 2 | F: TGTGAGTCAGGGGGAGGAGAGGGTA R: AGATGCTGCGGCGGTTGGAG | 430 | PCR |
Exon 8 | F: CTCTCAGCGTGCTCTCCAAGTGCGT R: TGTGGACTAAGGCTTTATGG | 525 | PCR | |
Intron 3 | F: TGGACTGGTGTCCTTCGGGGAGCAC R: CGAGGTCAGAGGCATTTCA | 587 | PCR | |
CDS | F: CGGGACCGCGGAAAATTGAT R: GCGCCTTTGACTTTTGGACC | 169 | qRT-PCR | |
β-actin | CDS | F: AGCCTTCCTTCCTGGGCATGGA R: GGACAGCACCGTGTTGGCGTAGA | 113 | qRT-PCR |
Region | Primer Sequence (5′–3′) | Primer_AlleleGG (5′–3′) | Primer_AlleleAA (5′–3′) |
---|---|---|---|
Exon 2 | TGACCCTGGCAG AGGACAAC | GAAGGTGACCAAGTTCATGCT CGGGCCGTCTCCCC | GAAGGTCGGAGTCAACGGA TTCCGGGCCGTCTCCCT |
Exon 8 | CGACTCAGACAGAAGGCG | GAAGGTGACCAAGTTCATGCTCTCGCAAGAGCAGGGCC | GAAGGTCGGAGTCAACGGATTG TCTCGCAAGAGCAGGGCT |
Intron 3 | CCCCTACCCTTCCTGTCCCT | GAAGGTGACCAAGTTCATGCTCCCCTGGTGGCCTTGC | GAAGGTCGGAGTCAACGGATTGCCCCTGGTGGCCTTGT |
SNPs | Genotype Frequency | Allele Frequency | Genetic Polymorphism | HWE | ||||||
---|---|---|---|---|---|---|---|---|---|---|
Genotype | Number | Frequency (%) | Allele | Frequency (%) | Ne | Ho | He | PIC | ||
Exon 2 | GG | 353 | 67.37 | G | 82.00 | 1.41 | 0.71 | 0.29 | 0.25 | p > 0.05 |
AG | 155 | 29.58 | A | 18.00 | ||||||
AA | 16 | 3.05 | ||||||||
Intron 3 | GG | 256 | 48.85 | G | 71.00 | 1.71 | 0.58 | 0.42 | 0.33 | p > 0.05 |
AG | 227 | 43.32 | A | 29.00 | ||||||
AA | 46 | 7.82 | ||||||||
Exon 8 | GG | 257 | 48.12 | G | 70.00 | 1.71 | 0.58 | 0.42 | 0.33 | p > 0.05 |
AG | 230 | 44.75 | A | 30.00 | ||||||
AA | 38 | 7.11 |
SNP1 | SNP2 | SNP3 | |
---|---|---|---|
SNP2 | 0.08 | ||
SNP3 | 0.08 | 1 |
Haplotypes | SNP1 | SNP2 | SNP3 | Frequency/% | Haplotype Combinations | Frequency/% |
---|---|---|---|---|---|---|
H1 | G | G | G | 42.8 | H1H1 | 28.2 |
H2 | G | A | A | 37.6 | H1H2 | 30.1 |
H3 | A | G | G | 19.4 | H2H3 | 15.0 |
H2H2 | 7.2 | |||||
H1H3 | 15.4 | |||||
H3H3 | 3.9 |
SNPs | Genotype | Meat Quality | Carcass Quality | |||||
---|---|---|---|---|---|---|---|---|
n | WBSF | CLR | DLR | REA | n | HCW | ||
SNP1 | GG | 353 | 5.58 ± 0.11 a | 65.97 ± 0.42 a | 21.22 ± 0.40 | 32.49 ± 0.61 | 123 | 105.65 ± 3.97 |
AG | 155 | 5.68 ± 0.14 a | 66.21 ± 0.56 a | 21.64 ± 0.554 | 31.95 ± 0.82 | 46 | 105.93 ± 5.27 | |
AA | 16 | 4.06 ± 0.45 b | 58.13 ± 1.74 b | 20.44 ± 0.68 | 30.92 ± 2.55 | 4 | 101.20 ± 17.88 | |
p | 0.002 | <0.001 | 0.608 | 0.687 | 0.967 | |||
SNP2 | GG | 256 | 5.50 ± 0.12 a | 65.36 ± 0.47 | 22.44 ± 0.44 a | 32.50 ± 0.68 | 80 | 105.30 ± 4.27 |
AG | 227 | 5.74 ± 0.12 a | 65.45 ± 0.48 | 21.04 ± 0.46 b | 32.01 ± 0.70 | 77 | 106.56 ± 4.42 | |
AA | 41 | 4.97 ± 0.31 b | 65.42 ± 1.22 | 21.61 ± 1.16 b | 33.47 ± 1.76 | 16 | 102.63 ± 10.34 | |
p | 0.022 | 0.187 | 0.024 | 0.627 | 0.924 | |||
SNP3 | GG | 257 | 5.51 ± 0.12 a | 66.41 ± 0.47 | 22.43 ± 0.44 a | 32.54 ± 0.67 | 80 | 105.30 ± 4.27 |
AG | 230 | 5.76 ± 0.12 a | 65.43 ± 0.48 | 21.19 ± 0.46 b | 32.01 ± 0.70 | 77 | 106.56 ± 4.42 | |
AA | 38 | 4.99 ± 0.31 b | 65.46 ± 1.22 | 21.81 ± 1.16 b | 33.51 ± 1.76 | 16 | 102.63 ± 10.34 | |
p | 0.020 | 0.143 | 0.038 | 0.605 | 0.924 |
n | Single-Haplotype Model | p | |||||
---|---|---|---|---|---|---|---|
Traits | Haplotype | Other Haplotypes in Model | Present | Absent | Present | Absent | |
WBSF | H1 | 396 | 89 | 5.64 ± 0.10 | 5.45 ± 0.17 | 0.251 | |
H2 | 238 | 247 | 5.69 ± 0.12 | 5.51 ± 0.12 | 0.151 | ||
H3 | 152 | 333 | 5.60 ± 0.11 | 5.60 ± 0.14 | 0.985 | ||
H1 | H2 | 328 | 247 | 5.66 ± 0.11 | 5.34 ± 0.17 | 0.071 | |
H3 | H2 | 152 | 333 | 5.62 ± 0.14 | 5.59 ± 0.111 | 0.843 | |
CLR | H1 | 396 | 89 | 65.71 ± 0.40 a | 63.83 ± 0.63 b | 0.003 | |
H2 | 238 | 247 | 65.00 ± 0.46 | 65.69 ± 0.45 | 0.151 | ||
H3 | 152 | 333 | 65.54 ± 0.54 | 65.28 ± 0.41 | 0.617 | ||
H1 | H2 | 396 | 89 | 65.69 ± 0.40 a | 63.89 ± 0.66 b | 0.008 | |
H2 | H1 | 238 | 247 | 64.71 ± 0.47 | 64.88 ± 0.54 | 0.742 | |
H3 | H1H2 | 152 | 333 | 65.48 ± 0.54 a | 64.13 ± 0.53 b | 0.033 | |
DLR | H1 | 396 | 89 | 21.88 ± 0.40 | 22.773 ± 0.58 | 0.789 | |
H2 | 238 | 247 | 21.25 ± 0.44 a | 22.43 ± 0.44 b | 0.012 | ||
H3 | 152 | 333 | 21.67 ± 0.53 | 21.91 ± 0.53 | 0.650 | ||
REA | H1 | 396 | 89 | 32.51 ± 0.60 | 31.66 ± 0.94 | 0.357 | |
H2 | 238 | 247 | 32.15 ± 0.68 | 32.55 ± 0.67 | 0.579 | ||
H3 | 152 | 333 | 32.92 ± 0.81 | 32.92 ± 0.81 | 0.452 | ||
HCW | H1 | 124 | 30 | 106.34 ± 3.67 | 103.20 ± 5.97 | 0.617 | |
H2 | 79 | 75 | 106.06 ± 4.19 | 105.24 ± 4.25 | 0.870 | ||
H3 | 44 | 110 | 105.64 ± 5.13 | 105.67 ± 3.78 | 0.996 |
Diplotypes | Meat Quality | Carcass Quality | |||||
---|---|---|---|---|---|---|---|
n | WBSF | CLR | DLR | REA | n | HCW | |
H1H1 | 144 | 5.54 ± 0.13 a | 65.68 ± 0.50 a | 22.88 ± 0.49 a | 32.56 ± 0.76 | 48 | 104.50 ± 5.01 |
H1H2 | 145 | 5.71 ± 0.13 a | 65.18 ± 0.51 a | 20.88 ± 0.51 b | 32.32 ± 0.78 | 55 | 107.51 ± 5.02 |
H1H3 | 75 | 5.58 ± 0.18 a | 66.59 ± 0.66 a | 21.61 ± 0.66 ab | 32.61 ± 1.01 | 29 | 107.68 ± 6.87 |
H2H2 | 35 | 4.97 ± 0.31 ab | 62.80 ± 1.15 a | 21.74 ± 1.15 ab | 33.48 ± 1.77 | 15 | 102.79 ± 10.44 |
H2H3 | 69 | 5.84 ± 0.20 a | 65.22 ± 0.74 a | 21.78 ± 0.74 ab | 31.06 ± 1.37 | 20 | 103.80 ± 7.68 |
H3H3 | 21 | 4.06 ± 0.45 b | 57.84 ± 1.67 a | 20.62 ± 1.66 b | 30.95 ± 2.55 | 6 | 101.25 ± 18.04 |
p | 0.004 | <0.001 | 0.011 | 0.856 | 0.989 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, X.; Qi, Y.; Zhu, C.; Zhou, R.; Ruo, Z.; Zhao, Z.; Liu, X.; Li, S.; Zhao, F.; Wang, J.; et al. Variation in the HSL Gene and Its Association with Carcass and Meat Quality Traits in Yak. Animals 2023, 13, 3720. https://doi.org/10.3390/ani13233720
Wang X, Qi Y, Zhu C, Zhou R, Ruo Z, Zhao Z, Liu X, Li S, Zhao F, Wang J, et al. Variation in the HSL Gene and Its Association with Carcass and Meat Quality Traits in Yak. Animals. 2023; 13(23):3720. https://doi.org/10.3390/ani13233720
Chicago/Turabian StyleWang, Xiangyan, Youpeng Qi, Chune Zhu, Ruifeng Zhou, Zhoume Ruo, Zhidong Zhao, Xiu Liu, Shaobin Li, Fangfang Zhao, Jiqing Wang, and et al. 2023. "Variation in the HSL Gene and Its Association with Carcass and Meat Quality Traits in Yak" Animals 13, no. 23: 3720. https://doi.org/10.3390/ani13233720
APA StyleWang, X., Qi, Y., Zhu, C., Zhou, R., Ruo, Z., Zhao, Z., Liu, X., Li, S., Zhao, F., Wang, J., Hu, J., & Shi, B. (2023). Variation in the HSL Gene and Its Association with Carcass and Meat Quality Traits in Yak. Animals, 13(23), 3720. https://doi.org/10.3390/ani13233720