Next Article in Journal
Comparative Analysis of Ascaris suum and Macracanthorhynchus hirudinaceus Infections in Free-Ranging and Captive Wild Boars (Sus scrofa) in Hungary
Previous Article in Journal
Efficacy and Safety of Lidocam Topical Gel (4% Lidocaine—0.3% Meloxicam) for Pain and Inflammation Management during Castration and Tail Docking in Piglets
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 14
Issue 6
10.3390/ani14060931
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Whole-Genome Identification and Characterization of the DKK Gene Family and Its Transcription Profiles: An Analysis of the Chinese Soft-Shell Turtle (Pelodiscus sinensis)

by
Yongchang Wang
1,2,†,
Junxian Zhu
1,†,
Chen Chen
1,
Liqin Ji
1,
Xiaoyou Hong
1,
Xiaoli Liu
1,
Haigang Chen
1,
Chengqing Wei
1,
Junjie Zhang
2,*,
Xinping Zhu
1 and
Wei Li
1,*
1
Key Laboratory of Tropical and Subtropical Fishery Resource Application and Cultivation, Ministry of Agriculture and Rural Affairs, Pearl River Fisheries Research Institute, Chinese Academy of Fishery Sciences, Guangzhou 510380, China
2
College of Life Sciences, Xinjiang Agricultural University, Urumqi 830052, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Animals 2024, 14(6), 931; https://doi.org/10.3390/ani14060931
Submission received: 24 December 2023 / Revised: 23 February 2024 / Accepted: 11 March 2024 / Published: 18 March 2024
(This article belongs to the Section Animal Genetics and Genomics)
Browse Figures
Review Reports Versions Notes

Abstract

:

Simple Summary

The DKK gene family plays an important role in immune mechanisms and embryonic development, but studies on Pelodiscus sinensis have not been reported. In this study, for the first time in the context of P. sinensis, we analyzed the relevant features of the DKK gene family using bioinformatics methods and constructed transcriptional profiles and tissue expression profiles. The DKK1 and DKK3 genes were found to be highly expressed in the ovaries, while DKKL1 and DKK4 were significantly differentiated in the testes. In this study, we preliminarily investigated the function of the DKK gene family in the context of P. sinensis, and this study lays the foundation for further systematic research on the molecular mechanism of sex differentiation in P. sinensis.

Abstract

The DKK family is a canonical small family of WNT antagonists. Though recent studies have suggested that the DKK gene family may be involved in sex differentiation in Pelodiscus sinensis, there are still a lot of things about the DKK gene family that we do not know. In this study, we used bioinformatics methods to identify members of the DKK gene family in P. sinensis and analyzed their phylogeny, covariance, gene structure, structural domains, promoter conserved sites, signal peptides, gonadal transcription factors, transcriptional profiles, and tissue expression profiles. Additionally, qRT-PCR results were utilized for the validation and preliminary investigation of the function of the DKK gene family in P. sinensis. The results showed that the DKK gene family is divided into six subfamilies, distributed on six different chromosomal scaffolds containing different gene structures and conserved motifs with the same structural domains, and all of the members were secreted proteins. Our transcriptional profiling and embryonic expression analysis showed that DKKL1 and DKK4 were significantly expressed in the testes, whereas DKK1 and DKK3 were significantly upregulated in the ovaries. This suggests a potential function in sex differentiation in P. sinensis. Our results may provide a basic theoretical basis for the sex differentiation process in P. sinensis.

1. Introduction

The Dickkopf (DKK) genes are a small evolutionarily conserved gene family consisting of four members (DKK1-4) and a unique DKK3-related gene, DKKL1, all of which encode secreted proteins with two distinct cysteine-rich structural domains [1]. DKK proteins were first identified in amphibians as endogenous inhibitors of WNT signaling and inducers of head development [2]. Among them, Dickkopf-1 (DKK1), a founding member of the family, is a secreted glycoprotein that has been identified as a head inducer and WNT antagonist in early Xenopus laevis embryos, and its overexpression induces abnormal cranial development [3]. Its expression was observed to be elevated in Mus musculus tissues mediating the epithelial–mesenchymal transition, suggesting that this protein may be involved in cardiac, dental, hair follicle, and limb development, as well as osteoinduction [4]. In Homo sapiens, DKK1, Dickkopf-2 (DKK2), and Dickkopf-4 (DKK4) are located in the same homologous chromosome group [5]. All of these genes are able to regulate WNT signaling, and in most cases, their actions are inhibitory. DKK1, DKK2, and DKK4 can directly bind to LRP6 and act as WNT antagonists [6]. In addition, DKK1 and DKK2 can induce the endocytosis of LRP6, thereby inhibiting WNT–β-catenin signaling [7]. It has recently been found that DKK2 can also activate the WNT signaling pathway [8,9]. In contrast, DKK4 has mainly been associated with a large number of H. sapiens cancers, including colorectal cancer [10], melanomas [11], hepatocellular carcinomas [12], and gastric cancer [13].
Dickkopf-3 (DKK3) was identified after screening a H. sapiens brain cDNA library for homology to Xenopus laevis DKK1. Compared to the DKK1 gene, the DKK3 gene is more strongly expressed in later stages of embryonic development, with DKK3a (DKK3L) being expressed predominantly in the posterior ganglion, while DKK3b (DKK3) is expressed in the endocrine pancreas [14]. Like DKK1, DKK3 has mainly been studied in oncology. It has been proposed as a potential tumor suppressor and therapeutic target for several H. sapiens cancers [15], and due to the DKK3 gene being the subject of increasing studies, a gene possessing a sequence homology with DKK3 has been identified, namely DKKL1 (Dickkopf-like 1), a distant member of the DKK family that is a secreted glycoprotein with a potential role in spermatogenesis [16]. DKKL1 has been shown to inhibit the WNT-induced stabilization of β-catenin in many cell types and vertebrate species [17,18]. In adult M. musculus, DKKL1 gene expression was restricted to the testes, and DKKL1 mRNA was abundantly expressed in developing spermatocytes, first in the developing acrosome and then accumulating in the acrosome of mature spermatozoa [19,20]. By targeting the knockout of the DKKL1 gene, M. musculus embryos develop normally and form fertile offspring [21]. However, the deletion of the DKKL1 gene results in the severe impairment of in vitro sperm fertilization. In addition, the DKKL1 gene has been closely associated with the development of weak spermatogenesis [22] and infertility [23] in H. sapiens.
The Chinese soft-shell turtle (Pelodiscus sinensis) belongs to Reptilia, Testudoformes, Trionychidae, and Pelodiscus, and it is an important species of Chinese freshwater aquaculture [24]. The growth rate of male P. sinensis exhibits a pronounced sexual dimorphism, increasing at a rate 1.5 times faster compared to that of the females [25]. Therefore, the study of sex differentiation in P. sinensis and the discovery of more primary genes involved in sex differentiation are essential for the breeding of all male P. sinensis. Previous studies have shown that the sex differentiation of P. sinensis is the result of multi-gene regulation. For example, Sun et al. discovered that the gene Dmrt1 plays a pivotal role in the sexual differentiation of male P. sinensis. Furthermore, they observed that the suppression of Dmrt1 led to a reversal in sex (from male to female) [26]. In a study by Jin et al., the knockdown of Foxl2 in ZW embryos resulted in the sexual reversal of females to males, along with the significant up-regulation of the testicular markers Dmrt1 and Sox9, whereas the overexpression of Foxl2 in ZZ embryos resulted in males experiencing a large degree of feminization [27]. Zhang et al. found that Rspo1 was required for female sex differentiation in Pelodiscus sinensis. Rspo1 loss of function by RNA interference led to partial female-to-male sex reversal, with masculinized changes in the phenotype of the gonads, the distribution of germ cells, and the expression of testicular regulators [28]. Zhou et al. knocked out the Amh gene using RNA interference technology and proved that the Amh gene had a necessary and sufficient role in promoting testicular development and spermatogenesis in P. sinensis [29]. Recently, a new study involving RNA-Seq found that a member of the DKK gene family, DKKL1, was sexually dimorphic in the male and female gonads of P. sinensis during early development, and its expression in the testes was significantly higher than that in the ovaries, which implies that DKKL1 is likely involved in the sex differentiation of P. sinensis [30]. However, there is still an extreme lack of relevant studies on the DKK family in P. sinensis. In this study, Based on the whole set of transcriptome data available in our group, we screened to obtain the gene sequences of the DKK-able family members [31]. We used bioinformatics to identify the members of the DKK gene family in the P. sinensis genome and further analyzed their phylogenetic relationships, covariance analysis, genetic structure, conserved motifs, structural domains, conserved sites in the promoter region, gonadal expression profiles, transcriptional profile, and tissue expression profiles. The findings of this research will enhance our knowledge of DKK genes and establish a theoretical foundation for future comprehensive investigations into the regulatory mechanisms underlying sexual differentiation in P. sinensis.

2. Materials and Methods

2.1. Whole-Genome Identification and a Physicochemical Analysis of the DKK Genes

All genome sequences, protein sequences, and annotation files of P. sinensis were obtained from the National Center for Biotechnology Information (NCBI) database in the United States. We downloaded Hidden Markov Model (HMM) files for the DKK gene (IPR039863) from the Pfam Protein Family Database (https://www.ebi.ac.uk/interpro/entry/InterPro/IPR039863, accessed on 10 July 2023). The HMMER 3.0 software [32] was employed to identify members of the DKK gene family within the P. sinensis genome. Subsequently, the candidate sequences were validated and redundant ones were eliminated through detailed analysis using the NCBI Conserved Domain tool (https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi, accessed on 17 July 2023) [33] and SMART database (https://smart.embl.de/smart/set_mode.cgi?NORMAL=1, accessed on 20 July 2023) [34]. Finally, the physicochemical properties of the DKK proteins were analyzed using ProtParam (https://web.expasy.org/protparam/, accessed on 20 July 2023) [35].

2.2. Analysis of Phylogeny and Synteny within the DKK Gene Family

The amino acid sequences of vertebrate species typically found in P. sinensis, Salmo salar, Danio rerio, Alligator mississippiensis, Xenopus tropicalis, Chrysemys picta bellii, Rana temporaria, Chelonia mydas, H. sapiens, Mus musculus, Mauremys reevesii, and Lacerta agilis were obtained from the NCBI database. Sequence alignment was performed using MUSCLE 5.1 [36], after which unrooted evolutionary trees were constructed using the Jones–Taylor–Thornton (JTT) and GammaDistributed (G) models and the maximum likelihood method with 1000 self-expanding replicates using MEGA 7 software [37], and the rootless evolutionary trees were landscaped using the online website ChiPlot (https://www.chiplot.online/, accessed on 3 August 2023) to beautify the linear evolutionary trees. Utilizing the NCBI genome browser (https://www.ncbi.nlm.nih.gov, accessed on 3 August 2023) and Ensembl (https://www.ensembl.org/index.html, accessed on 4 August 2023), a collinear analysis was conducted across species including H. sapiens, P. sinensis, Alligator mississippiensis, Xenopus tropicalis, and Danio rerio.

2.3. Analysis of Gene Structure, Structural Domains, and Promoter Conserved Sites

Gene density files for each scaffold were generated based on genome annotation files, and DKK gene structures were displayed using the TBtools II visualization tool [38]. The amino acid sequences of the DKK genes were uploaded to the MEME Suite database, accessible at http://meme.nbcr.net, accessed on 8 August 2023 [39], for the prediction of conserved motifs, and the number of motifs was examined until the default threshold was exceeded. Meanwhile, the NCBI Conserved Domain tool (http://www.ncbi.nlm.nih.gov/Structure/cdd/cdd.shtml, accessed on 11 August 2023) [33] was utilized to screen the conserved structural domains of DKK proteins with default parameters. The conserved motifs and structural domains of the DKK proteins were visualized using TBtools software [38].

2.4. Transcription Factor Analysis and Signal Peptides

A promoter region 2 kb upstream of the transcription start site of the DKK gene family was extracted using TBtools software. Potential transcriptional binding factors in the core region of the promoter were predicted by setting a threshold greater than 90% using the online software PROMO (https://alggen.lsi.upc.es/cgi-bin/promo_v3/promo/promoinit.cgi?dirDB=TF_8.3, accessed on 15 August 2023) and JASPAR (https://jaspar.elixir.no/, accessed on 15 August 2023). Afterwards, the predicted results were subjected to database comparison, and the intersections were filtered to label the transcription factor binding sequences in the promoter core region 2 kb upstream of the DKK gene family of P. sinensis, respectively. The prediction of signal peptides was performed using the online prediction website SignalP 5.0 [40].

2.5. Sexually Dimorphic Expression Profiling of the DKK Gene Family Based on Transcriptomics Data

The gonadal transcriptome data of P. sinensis were downloaded from the SRA database at NCBI SRA accession (PRJNA838782). Valid data (clean reads) were obtained by filtering out low-quality data with splice sequences from raw reads using Trimmomatic 0.39 software [41]. Clean reads were compared to the P. sinensis genome using HISAT 2.2.1 [42], after which the default parameters of the String Tie (v2.1.4) software [43] were applied to calculate the expression of the DKK genes and normalized by the number of fragments per kilobase (FPKM) value. After identifying differentially expressed genes, we employed the edgeR package 4.3 [44] to conduct a detailed analysis. Genes were considered significantly differentially expressed if they met a p-value less than 0.05. For genes exhibiting high significance, we further applied additional criteria of FDR < 0.05 and |log2 FC| > 1. Subsequently, the normalized expression levels, expressed as log2TPM+1, were visualized in a gene expression heat map using TBtools, allowing us to correlate and compare the expression patterns across genes.

2.6. Quantitative Real-Time Fluorescence-Based PCR Analysis of the DKK Gene Family

2.6.1. Sample Collection

To explore the functionality of DKK gene family members, qRT-PCR was utilized to measure their relative expression levels across various tissues of adult male and female ovaries. All experimental methods were conducted in compliance with the Pearl River Fisheries Research Institute’s animal husbandry regulations, located in Guangzhou, China. Three adult male and three adult female P. sinensis, all sourced from Huizhou Wealth Xing Industrial Co. (Huizhou, China), were chosen as the subjects for this experiment. The corresponding tissue samples were obtained following the sample collection protocol described by Lei et al. [31] and were promptly preserved in liquid nitrogen for RNA isolation.

2.6.2. RNA Extraction, cDNA Synthesis, and Quantitative Real-Time PCR (qRT-PCR)

Total RNA extraction for all samples was conducted adhering to the guidelines provided by RNAiso Plus (Takara, Beijing, China). The RNA quality was then assessed through RNA electrophoresis on a Bio-Rad PowerPacTM system (Bio-Rad, Hercules, CA, USA) and using a NanoDrop 2000 spectrophotometer (ThermoFisher, NanoDropOne, Waltham, MA, USA). Subsequently, cDNA synthesis was carried out following the specifications outlined in a reverse-transcription kit from Takara (Beijing, China). The qRT-PCR assay was conducted in accordance with the directions provided by the iTaq Universal SYBR Supermix (BIO-RAD, Hercules, CA, USA). All primers were developed based on the nucleotide sequences of the DKK family genes of P. sinensis available on NCBI. The Ef1α gene, which exhibits a consistent expression pattern in P. sinensis [30], was selected as the reference gene for calculating the relative expression of the target gene. Three biological samples were selected for qRT-PCR experiments and three biological replicates were performed for each individual.
The primer sequences for both the target and reference genes are presented in Table 1. The expression levels of transcripts were quantitatively analyzed using the 2−ΔΔCT method [45]. Differential expression analysis was performed by conducting an ANOVA [46]. The results were expressed as the mean ± SEM of three replicates, and statistical significance was established at p < 0.05.

3. Results

3.1. Identification and Physicochemical Characterization of DKK Gene Family Members in the Genome of P. sinensis

Six DKK gene family members were initially identified in the P. sinensis genome, namely DKK1, DKK2, DKK3, DKK3L, DKK4, and DKKL1. Our analysis of the physicochemical properties of the proteins showed that the length of the DKK family sequence of P. sinensis ranged from 201 to 389, and the molecular weight varied between 22,229.6 and 43,169.58 kDa (Table 2).

3.2. Phylogenetic Analysis of the DKK Genes

The phylogenetic relationships of the DKK genes in P. sinensis were investigated by constructing a linear phylogenetic tree. The results showed that the DKK genes of P. sinensis can be categorized into six subfamilies: DKK1, DKK2, DKK3, DKK4, DKK3L, and DKKL1. The topology of the phylogenetic tree showed that the DKK genes of P. sinensis first clustered with turtles, followed by reptiles and mammals, and the DDK genes of P. sinensis were distinct from those of fish (Figure 1).

3.3. Collinear Analysis

We performed a covariate analysis on H. sapiens, Alligator mississippiensis, P. sinensis, Xenopus tropicalis, and Danio rerio. The results showed that the DKK1 gene of H. sapiens, P. sinensis, and X. tropicalis was located downstream of PRKG1 in all cases, while the D. rerio DKK1 was upstream of PRKG1B, which may be due to the fact that PRKG1 evolved from PRKG1B (Figure 2A). The DKK2 gene of P. sinensis and X. tropicalis was located in the chromosome segment SGMS2-PAPSS1-DKK2, whereas that of H. sapiens and P. sinensis was located in the chromosome segment composed of the genes LEF1-HADH-CYP2U1–SGMS2-PAPSS1-DKK2-GIMD1-AIMP1-TBCK-NPNT-GSTCD (Figure 2B). The DKK3 gene in H. sapiens, P. sinensis, X. tropicalis, and D. rerio was tightly linked to USP47 in all cases, suggesting that this chromosome segment was highly conserved during evolution (Figure 2C). The POLB-DKK4-VDAC3 chromosome fragment was highly conserved among H. sapiens, P. sinensis, and Rhincodon typus, but POLB was replaced by IKBK3 in A. mississippiensis (Figure 2D). The DKKL1 gene in both A. mississippiensis and P. sinensis was located upstream of CCDC155 (Figure 2E).

3.4. Gene Structures

In the gene structure analysis, we found significant differences in the gene length, exons, and introns of the DKK gene of P. sinensis. The highest number of exons among the six genes was seven (DKK3), and the lowest was four (DKK2, DKK3L, DKK4, and DKKL1) (Figure 3A). By comparison with the Homo sapiens DKK gene, we found that the two genes have identical numbers of exons and introns, even though their gene lengths are different. It was predicted that the DKK gene of P. sinensis is highly conserved in vertebrates (Figure 3B).

3.5. Prediction of Structural Domains and Signal Peptides of the DKK Family

DKK1, DKK2, DKK3L, and DKK4 all contain two cysteine-rich structural domains (CRD1 and 2), and Sgy is uniquely present in DKK3 and DKKL1, demonstrating their unique homology (Figure 4). Our signal peptide prediction of P. sinensis DKK proteins showed that all six proteins have signal peptides, indicating that they are all secreted proteins (Figure 5A–F). Among them, DKK3 had the longest signal peptide length (57 amino acids; Figure 5C), and DKK4 had the shortest signal peptide length (18 amino acids; Figure 5E).

3.6. Transcription Factor Predictions and Conserved Promoter Loci of the DKK Gene Family

We performed a prediction analysis of transcription factors, and we forecast that 548 transcription factors interacted with the promoter region of the 2 kb region upstream of the 5′ of the DKK genes in P. sinensis. We selected the top 10 transcription factors for visualization (Figure 6) and found that PRDM9 and ZNF281 were the most common transcription factors, with zinc finger proteins being the most widely distributed. Not only that, transcription factors related to sex differentiation (RARA, FOXL2, DMRT1, SOX9, SRY, SOX17, PAX2, and TBX1) were also predicted.
In addition, we performed predictive analyses of conserved sites in the promoters of the DKK gene family in turtles and tortoises. We found that the DKK gene promoter region has a large number of identical conserved sites in all three species. Among them, DKK1 has more identical conserved sites, such as DKK1: “TGGAAAGTTT”, “ACAAGGCCCGATCCTGCCTCTAAT”, and “CCTAACAGAGCCG”. In contrast, DKKL1 and DKK3L have fewer identical conserved sites, such as DKKL1: “GATTGG” and “GCTTGT”; and DKK3L: “CAGGCCTGG”. It suggests that DKK1 is strongly conserved in turtles and tortoises and that the gene functions may be similar (Figure 7).

3.7. Gonadal Transcriptional Profiling

To explore the transcriptional patterns of DKK genes in the male and female gonads of P. sinensis, we conducted an analysis of transcriptomic datasets derived from the early stages of gonad development in this species. DKK1 and DKK3 were highly expressed in the ovaries, DKKL1 was highly expressed in the testes, and DKK4 was minimally expressed in the testes. There were extremely low expression levels of DKK2 and DKK3L in the ovaries and testes (Figure 8).

3.8. Expression Profiling of the DKK Genes in Different Tissues of P. sinensis

To further corroborate the transcriptome findings and investigate the expression patterns of DKK genes across various adult tissues of P. sinensis, we conducted additional studies. We performed qRT-PCR on six DKK genes in the heart, brain, kidney, spleen, liver, testis, and ovary tissues of P. sinensis. The results showed that there were significant differences in the expression patterns of these six DKK genes. DKKL1 was highly expressed in the testes and significantly higher than in other tissues, consistent with the transcriptome results. While DKK1 was highly expressed in the spleen and DKK4 and DKK3 were highly expressed in the heart, their expression in the ovaries and testes was significantly different. Both DKK2 and DKK3L were highly expressed in the spleen (Figure 9).

4. Discussion

In the present study, we successfully identified all members of the DKK gene family within the P. sinensis genome, revealing that they possess a conserved structural domain. Nevertheless, notable variations were observed in terms of gene structures, amino acid sequences, and conserved motifs, indicating potential functional distinctions among these genes. The results of our gene structure analysis showed significant differences in intron–exon structure and motif composition among different DKK subfamilies, suggesting that DKK family members may be functionally diverse. For example, DKKL1 had only the Sgy structural domain, and its exon length was significantly different from the other subfamilies. Tissue expression profiling showed that DKKL1 was highly expressed in the testes of P. sinensis, which was significantly different from the expression pattern of other DKK gene subfamilies. The conserved regions of the DKK gene family and the results of our covariance analysis showed that the genes neighboring the DKK family genes can be highly conserved in H. sapiens and P. sinensis, except for DKKL1 and DKK3L. This indicates a possibility that they might be governed by comparable mechanisms and execute analogous functions across both species. Phylogenetic relationship analysis can provide important evidence for the classification and evolution of gene families. In a phylogenetic tree, the closer the relatives in the evolutionary tree, the more similar the gene structures are [47]. All protein sequences were categorized into six subfamilies based on the evolutionary tree, and all subfamily members, except for the DKKL1 gene, were highly conserved among the different species.
Transcription factors have the ability to bind to cis-acting elements, thereby modulating gene expression and playing a crucial role in developmental processes [48]. The WNT signaling pathway has been shown to be associated with testicular and ovarian development [49,50,51]. For example, high expression levels of WNT11 and WNT9b were found in granulosa cells and oocytes of Oncorhynchus mykiss, suggesting that they are involved in folliculogenesis and oogenesis in bryozoans [52]. Typical WNT signaling was transduced to the β-catenin protein signaling cascade via the frizzled (FZD) family of receptors and LRP5/LRP6 co-receptors [53,54]. In contrast, DKK family members can interact with and trigger endocytosis of the LRP5/LRP6 co-receptor to prevent the formation of the WNT-FZD-LRP5/LRP6 complex used for typical WNT signaling [55]. For example, in H. sapiens, the gonadal cell line TP53 was able to inhibit the activity of the typical WNT signaling pathway through the up-regulation of DKK1 expression, thereby affecting gonadal differentiation [56]. The epigenetic silencing of DKK3 disrupts normal WNT/β-catenin protein signaling and apoptosis regulation [57]. Therefore, the DKK family of genes in P. sinensis is likely to affect gonadal differentiation by negatively regulating the WNT signaling pathway. Among the 548 transcription factors in the promoter region of the 2 kb region 5′ upstream of the DKK genes in P. sinensis, a large number of transcription factors related to sex differentiation were predicted. FOXL2 and DMRT1 are key members of the feminization and masculinization pathways, respectively [58]. A decrease in SOX9 expression in H. sapiens and M. musculus leads to XY female development, while its activation in XX embryonic gonads leads to male development [59]. SOX17 is a key factor in SV flap formation and ST healthy spermatogenesis in M. musculus (the seminiferous tubules (ST) in the mammalian testes are connected to the testes (RT) by a supporting valve (SV). Sperm produced in the ST are released into the luminal fluid and passively translocated to the RT via the SV) [60]. In mammals, the master switch regulating the testis-determining pathway is the SRY (sex-determining region Y) gene on the Y chromosome [61,62,63]. SRY directly up-regulates SOX9 (SRY-BOX 9) expression, triggering a complex genetic network cascade that mediates testicular differentiation [64,65]. PAX2 can affect the ovarian development process in Silurus asotus directly or indirectly through the WNT signaling pathway. TBX1 can interact with the retinoic acid (RA) signaling pathway and has been shown to be involved in the control of O. mykiss gonadal differentiation [65,66]. Therefore, it is likely that some members of the DKK gene family control sex differentiation in P. sinensis by interacting with the above transcription factors.
The expression patterns of genes are known to be intricately linked to their functional roles [67]. The analysis of gene expression patterns in different tissues can provide a basic reference for predicting the functions of some unknown functional genes. For the first time in P. sinensis, we analyzed the expression pattern of the DKK family, and we found that DKKL1 was highly expressed in the testes, DKK3 was highly expressed in the heart, and DKK1, DKK2, DKK3L, and DKK4 were all highly expressed in the spleen. These findings are similar to those of some previous studies: Yan et al. found that the expression of the DKKL1 gene was restricted to the adult M. musculus testis and that DKKL1 mRNA was abundantly expressed in developing spermatocytes, first in the developing acrosome and subsequently accumulating in the acrosome of mature spermatozoa [68]. Not only that, Kohn et al. found that DKKL1 is also an N-glycosylated protein involved in sperm synthesis during spermatocyte maturation [21]. Piek et al. reported that DKK3 exhibits a notably elevated expression level in the heart tissues and secreted proteins of H. sapiens, indicating a relatively high absolute cardiac expression [69]. In reptiles, although the spleen has some hematopoietic function, the immune function it plays in the organism is more important [70]. Although functional studies of DKK1, DKK2, DKK3L, and DKK4 in the spleen are rare, all their main functions are understood to be related to immune aspects [71,72,73]. Interestingly, although DKK1 and DKK3 were highly expressed in the spleen and heart, respectively, we found that their expression in the ovaries was significantly higher than in the testes. Some studies suggest that the WNT signaling pathway plays an important role in ovarian development and hormone secretion [74,75]. DKK1 has an important role in the WNT signaling pathway and is involved in embryonic development [76,77]. Although DKK1 has been reported to play a role in the normal development of M. musculus testes [78], DKK1 has been found to be up-regulated in the ovaries of Shovelnose Sturgeon, and some researchers have hypothesized its involvement in oocyte maintenance, folliculogenesis, and oogenesis [79]. DKK3, as a soluble WNT inhibitor that can positively or negatively regulate the WNT signaling pathway, is involved in embryonic development. It has been shown that DKK3 function and expression can influence ovarian development [75]. In Muscovy ducks, DKK3 can interact with HTRA3 and RSPO3 to affect their ovarian differentiation [80]. Similarly, although DKK4 was highly expressed in the spleen, we found its expression to be significantly differentiated from the ovaries and testes. Previous studies have shown that WNT/β-catenin signaling is required for the designation of primordial germ cells and the normal development of the male fetal reproductive tract and that the WNT signaling pathway in the testes specifically contributes to the proliferation of SSC and progenitor cells [81,82]. Takase et al. found that the WNT inhibitor DKK4 is highly expressed in the canalicular compartment in mice. DKK4 blocks the activation of WNT/β-catenin protein signaling in meiotic spermatocytes, spermatids, and the lumen, where spermatozoa are located [83]. Therefore, DKK1, DKK3, DKK4, and DKKL1 may be involved in the sex differentiation process and may regulate the related functions in P. sinensis.

5. Conclusions

In conclusion, we have effectively recognized all components of the DKK gene family within P. sinensis. Transcription profiling and tissue expression profiling revealed that DKKL1 and DKK4 may be associated with testicular development and spermatogenesis in male P. sinensis. In addition to their involvement in autoimmunity and heart formation in P. sinensis, DKK1 and DKK3 may also be related to oocyte maintenance, folliculogenesis, and oogenesis in females.

Author Contributions

Y.W. wrote the manuscript text. J.Z. (Junxian Zhu) and C.C. prepared the figures and tables. L.J. and X.H. were responsible for analyzing the data. X.L. and H.C. were responsible for data validation. C.W. prepared experimental samples. J.Z. (Junjie Zhang), X.Z. and W.L. were responsible for the experimental design. All authors reviewed the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This work was funded by the National Natural Science Foundation of China (32102792), the Construction of a DNA Molecular Fingerprinting Library for the Germplasm Resources of the Grass Carp and the Chinese Soft-Shelled Turtle (2022-SJS-00-001), the Selection Breeding of the high-quality fast-growing Chinese Soft-Shelled Turtle and Studies on Efficient and Healthy Farming Technology (2022-SPY-00-015), the Central Public-interest Scientific Institution Basal Research Fund, CAFS (NO. 2023SJHX1), the National Freshwater Genetic Resource Center (NFGR-2022), the Guangdong Agricultural Research System (2019KJ150), the Guangdong Rural Revitalization Strategy Special Provincial Organization and Implementation Project Funds (2022-SBH-00-001), and the China-ASEAN Maritime Cooperation Fund (CAMC-2018F).

Institutional Review Board Statement

The Animal Care and Ethics Committee of the Pearl River Fisheries Research Institute, Chinese Academy of Fishery Sciences (Guangzhou, China) approved this research (Approval Code: LAEC-PRFRI-20210148; Approval Date:10 January 2021), and all experimental protocols and methods were performed in accordance with the relevant guidelines and regulations.

Informed Consent Statement

Not applicable.

Data Availability Statement

All datasets generated or analyzed during this study are included in the published article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Katase, N.; Nagano, K.; Fujita, S. DKK3 expression and function in head and neck squamous cell carcinoma and other cancers. J. Oral Biosci. 2020, 62, 9–15. [Google Scholar] [CrossRef]
  2. Del Barco Barrantes, I.; Davidson, G.; Gröne, H.J.; Westphal, H.; Niehrs, C. Dkk1 and noggin cooperate in mammalian head induction. Genes Dev. 2003, 17, 2239–2244. [Google Scholar] [CrossRef]
  3. Glinka, A.; Wu, W.; Delius, H.; Monaghan, A.P.; Blumenstock, C.; Niehrs, C. Dickkopf-1 is a member of a new family of secreted proteins and functions in head induction. Nature 1998, 391, 357–362. [Google Scholar] [CrossRef]
  4. Monaghan, A.P.; Kioschis, P.; Wu, W.; Zuniga, A.; Bock, D.; Poustka, A.; Delius, H.; Niehrs, C. Dickkopf genes are co-ordinately expressed in mesodermal lineages. Mech. Dev. 1999, 87, 45–56. [Google Scholar] [CrossRef]
  5. Wen, B.; Hu, S.; Yin, J.; Wu, J.; Guo, W. Molecular Evolution and Protein Structure Variation of Dkk Family. Genes 2023, 14, 1863. [Google Scholar] [CrossRef]
  6. Patel, S.; Barkell, A.M.; Gupta, D.; Strong, S.L.; Bruton, S.; Muskett, F.W.; Addis, P.W.; Renshaw, P.S.; Slocombe, P.M.; Doyle, C.; et al. Structural and functional analysis of Dickkopf 4 (Dkk4): New insights into Dkk evolution and regulation of Wnt signaling by Dkk and Kremen proteins. J. Biol. Chem. 2018, 293, 12149–12166. [Google Scholar] [CrossRef]
  7. Kikuchi, A.; Matsumoto, S.; Sada, R. Dickkopf signaling, beyond Wnt-mediated biology. Semin. Cell Dev. Biol. 2022, 125, 55–65. [Google Scholar] [CrossRef]
  8. Wang, H.; Duan, X.L.; Qi, X.L.; Meng, L.; Xu, Y.S.; Wu, T.; Dai, P.G. Concurrent Hypermethylation of SFRP2 and DKK2 Activates the Wnt/β-Catenin Pathway and Is Associated with Poor Prognosis in Patients with Gastric Cancer. Mol. Cells 2017, 40, 45–53. [Google Scholar] [CrossRef]
  9. Devotta, A.; Hong, C.S.; Saint-Jeannet, J.P. Dkk2 promotes neural crest specification by activating Wnt/β-catenin signaling in a GSK3β independent manner. eLife 2018, 7, e34404. [Google Scholar] [CrossRef]
  10. Liang, J.; Sun, L.; Li, Y.; Liu, W.; Li, D.; Chen, P.; Wang, X.; Hui, J.; Zhou, J.; Liu, H.; et al. Wnt signaling modulator DKK4 inhibits colorectal cancer metastasis through an AKT/Wnt/β-catenin negative feedback pathway. J. Biol. Chem. 2022, 298, 102545. [Google Scholar] [CrossRef]
  11. Lou, X.; Meng, Y.; Hou, Y. A literature review on function and regulation mechanism of DKK4. J. Cell. Mol. Med. 2021, 25, 2786–2794. [Google Scholar] [CrossRef]
  12. Chouhan, S.; Singh, S.; Athavale, D.; Ramteke, P.; Vanuopadath, M.; Nair, B.G.; Nair, S.S.; Bhat, M.K. Sensitization of hepatocellular carcinoma cells towards doxorubicin and sorafenib is facilitated by glucosedependent alterations in reactive oxygen species, P-glycoprotein and DKK4. J. Biosci. 2020, 45, 97. [Google Scholar] [CrossRef]
  13. Gao, C.; Xie, R.; Ren, C.; Yang, X. Dickkopf-1 expression is a novel prognostic marker for gastric cancer. J. Biomed. Biotechnol. 2012, 2012, 804592. [Google Scholar] [CrossRef]
  14. Untergasser, G.; Martowicz, A.; Hermann, M.; Töchterle, S.; Meyer, D. Distinct expression patterns of dickkopf genes during late embryonic development of Danio rerio. Gene Expr. Patterns 2011, 11, 491–500. [Google Scholar] [CrossRef]
  15. Hamzehzadeh, L.; Caraglia, M.; Atkin, S.L.; Sahebkar, A. Dickkopf homolog 3 (DKK3): A candidate for detection and treatment of cancers? J. Cell. Physiol. 2018, 233, 4595–4605. [Google Scholar] [CrossRef]
  16. Cruciat, C.M.; Niehrs, C. Secreted and transmembrane wnt inhibitors and activators. Cold Spring Harb. Perspect. Biol. 2013, 5, a015081. [Google Scholar] [CrossRef]
  17. Ostler, J.B.; Jones, C. The Bovine Herpesvirus 1 Latency-Reactivation Cycle, a Chronic Problem in the Cattle Industry. Viruses 2023, 15, 552. [Google Scholar] [CrossRef]
  18. Pakula, H.; Xiang, D.; Li, Z. A Tale of Two Signals: AR and WNT in Development and Tumorigenesis of Prostate and Mammary Gland. Cancers 2017, 9, 14. [Google Scholar] [CrossRef]
  19. Kaneko, K.J.; DePamphilis, M.L. Soggy, a spermatocyte-specific gene, lies 3.8 kb upstream of and antipodal to TEAD-2, a transcription factor expressed at the beginning of mouse development. Nucleic Acids Res. 2000, 28, 3982–3990. [Google Scholar] [CrossRef]
  20. Kohn, M.J.; Kaneko, K.J.; DePamphilis, M.L. DkkL1 (Soggy), a Dickkopf family member, localizes to the acrosome during mammalian spermatogenesis. Mol. Reprod. Dev. 2005, 71, 516–522. [Google Scholar] [CrossRef]
  21. Kohn, M.J.; Sztein, J.; Yagi, R.; DePamphilis, M.L.; Kaneko, K.J. The acrosomal protein Dickkopf-like 1 (DKKL1) facilitates sperm penetration of the zona pellucida. Fertil. Steril. 2010, 93, 1533–1537. [Google Scholar] [CrossRef]
  22. Yan, Q.; Tang, A.; Lai, Y.; Cai, Z.; Gui, Y. Expression difference of Dickkopf-like 1 gene (DKKL1) in testis of normal and male infertile patients. J. Pract. Med. 2014, 30, 36–39. [Google Scholar] [CrossRef]
  23. Yan, Q.; Ma, Y.; Chen, R.; Zhou, X.; Qiao, J.; Xian, Y.; Feng, L.; Chen, C. Expression of DKKL1 in spermatozoa of men with asthenospermia. J. S. Med. Univ. 2018, 38, 324–328. [Google Scholar] [CrossRef]
  24. Wang, F.; Chen, Z.; Cheng, Y.; Hou, G.; Ji, S.; Zhang, Y.; Li, J.; Zhu, C.; Wu, Y.; Song, G. Nutritional evaluation of two strains of Chinese soft-shelled turtle, Pelodiscus sinensis. J. Food Compos. Anal. 2021, 101, 103971. [Google Scholar] [CrossRef]
  25. Zhu, J.; Lei, L.; Chen, C.; Wang, Y.; Liu, X.; Geng, L.; Li, R.; Chen, H.; Hong, X.; Yu, L.; et al. Whole-Transcriptome Analysis Identifies Gender Dimorphic Expressions of Mrnas and Non-Coding Rnas in Chinese Soft-Shell Turtle (Pelodiscus sinensis). Biology 2022, 11, 834. [Google Scholar] [CrossRef]
  26. Sun, W.; Cai, H.; Zhang, G.; Zhang, H.; Bao, H.; Wang, L.; Ye, J.; Qian, G.; Ge, C. Dmrt1 is required for primary male sexual differentiation in Chinese soft-shelled turtle Pelodiscus sinensis. Sci. Rep. 2017, 7, 4433. [Google Scholar] [CrossRef] [PubMed]
  27. Jin, L.; Sun, W.; Bao, H.; Liang, X.; Li, P.; Shi, S.; Wang, Z.; Qian, G.; Ge, C. The forkhead factor Foxl2 participates in the ovarian differentiation of Chinese soft-shelled turtle Pelodiscus sinensis. Dev. Biol. 2022, 492, 101–110. [Google Scholar] [CrossRef]
  28. Zhang, Y.; Xiao, L.; Sun, W.; Li, P.; Zhou, Y.; Qian, G.; Ge, C. Knockdown of R-spondin1 leads to partial sex reversal in genetic female Chinese soft-shelled turtle Pelodiscus sinensis. Gen. Comp. Endocrinol. 2021, 309, 113788. [Google Scholar] [CrossRef]
  29. Zhou, Y.; Sun, W.; Cai, H.; Bao, H.; Zhang, Y.; Qian, G.; Ge, C. The Role of Anti-Müllerian Hormone in Testis Differentiation Reveals the Significance of the TGF-β Pathway in Reptilian Sex Determination. Genetics 2019, 213, 1317–1327. [Google Scholar] [CrossRef]
  30. Zhu, J.; Wang, Y.; Lei, L.; Chen, C.; Ji, L.; Li, J.; Wu, C.; Yu, W.; Luo, L.; Chen, W.; et al. Comparative genomic survey and functional analysis of DKKL1 during spermatogenesis in the Chinese soft-shelled turtle (Pelodiscus sinensis). Int. J. Biol. Macromol. 2024, 254, 127696. [Google Scholar] [CrossRef]
  31. Lei, L.; Chen, C.; Zhu, J.; Wang, Y.; Liu, X.; Liu, H.; Geng, L.; Su, J.; Li, W.; Zhu, X. Transcriptome analysis reveals key genes and pathways related to sex differentiation in the Chinese soft-shelled turtle (Pelodiscus sinensis). Comp. Biochem. Physiol. Part D Genom. Proteom. 2022, 42, 100986. [Google Scholar] [CrossRef]
  32. Fu, Y.; He, J.; Liu, L.; Huang, X.; Xu, Y.; Wang, C. Comprehensive Genome-Wide Analysis of Wnt Gene Family and Expression Profiling during Limb Regeneration in Portunus trituberculatus. Fishes 2022, 7, 258. [Google Scholar] [CrossRef]
  33. Lu, S.; Wang, J.; Chitsaz, F.; Derbyshire, M.K.; Geer, R.C.; Gonzales, N.R.; Gwadz, M.; Hurwitz, D.I.; Marchler, G.H.; Song, J.S.; et al. CDD/SPARCLE: The conserved domain database in 2020. Nucleic Acids Res. 2020, 48, D265–D268. [Google Scholar] [CrossRef]
  34. Letunic, I.; Khedkar, S.; Bork, P. SMART: Recent updates, new developments and status in 2020. Nucleic Acids Res. 2021, 49, D458–D460. [Google Scholar] [CrossRef] [PubMed]
  35. Huang, X.; Liang, Y.; Zhang, R.; Zhang, B.; Song, X.; Liu, J.; Lu, M.; Qin, Z.; Li, D.; Li, S.; et al. Genome-Wide Identification of the PP2C Gene Family and Analyses with Their Expression Profiling in Response to Cold Stress in Wild Sugarcane. Plants 2023, 12, 2418. [Google Scholar] [CrossRef] [PubMed]
  36. Pervez, M.T.; Babar, M.E.; Nadeem, A.; Aslam, M.; Awan, A.R.; Aslam, N.; Hussain, T.; Naveed, N.; Qadri, S.; Waheed, U.; et al. Evaluating the accuracy and efficiency of multiple sequence alignment methods. Evol. Bioinform. Online 2014, 10, 205–217. [Google Scholar] [CrossRef] [PubMed]
  37. Luo, S.; Zhang, G.; Zhang, Z.; Wan, Z.; Liu, Z.; Lv, J.; Yu, J. Genome-wide identification and expression analysis of BZR gene family and associated responses to abiotic stresses in cucumber (Cucumis sativus L.). BMC Plant Biol. 2023, 23, 214. [Google Scholar] [CrossRef]
  38. Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef]
  39. Gao, T.; Shu, J.; Cui, J. A systematic approach to RNA-associated motif discovery. BMC Genom. 2018, 19, 146. [Google Scholar] [CrossRef] [PubMed]
  40. Almagro Armenteros, J.J.; Tsirigos, K.D.; Sønderby, C.K.; Petersen, T.N.; Winther, O.; Brunak, S.; von Heijne, G.; Nielsen, H. SignalP 5.0 improves signal peptide predictions using deep neural networks. Nat. Biotechnol. 2019, 37, 420–423. [Google Scholar] [CrossRef]
  41. Gaffo, E.; Buratin, A.; Dal Molin, A.; Bortoluzzi, S. Sensitive, reliable and robust circRNA detection from RNA-seq with CirComPara2. Brief. Bioinform. 2022, 23, bbab418. [Google Scholar] [CrossRef] [PubMed]
  42. Hua, Y.; Dai, B.; Luo, Y.; Ding, Y. Integrated analysis of multiple metabolome and transcriptome revealed the accumulation of flavonoids and associated molecular regulation mechanisms in Rubus chingii Hu at different developmental stages. Plant Physiol. Biochem. 2023, 204, 108085. [Google Scholar] [CrossRef] [PubMed]
  43. Li, R.; Zhang, M.; Cha, M.; Xiang, J.; Yi, X. Chromosome-level genome assembly of the Siberian chipmunk (Tamias sibiricus). Sci. Data 2022, 9, 783. [Google Scholar] [CrossRef] [PubMed]
  44. Liao, Y.; Smyth, G.K.; Shi, W. featureCounts: An efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 2014, 30, 923–930. [Google Scholar] [CrossRef] [PubMed]
  45. Si, Y.; Zhang, L.; Zhang, L.; Zhao, F.; Wang, Q.; Qian, G.; Yin, S. Transcriptome analysis provides insight into the role of the melanin pathway in two differently pigmented strains of the turtle Pelodiscus sinensis. Dev. Genes Evol. 2019, 229, 183–195. [Google Scholar] [CrossRef] [PubMed]
  46. Chen, M.; Zhang, Y.; Zhang, M.; Qu, C.; Zou, G.; Liang, H. Characterization and expression pattern of Wnt5b gene in Pelodiscus sinensis. Aquac. Res. 2022, 53, 2937–2946. [Google Scholar] [CrossRef]
  47. Liu, M.; Sun, W.; Ma, Z.; Zheng, T.; Huang, L.; Wu, Q.; Zhao, G.; Tang, Z.; Bu, T.; Li, C.; et al. Genome-wide investigation of the AP2/ERF gene family in tartary buckwheat (Fagopyum tataricum). BMC Plant Biol. 2019, 19, 84. [Google Scholar] [CrossRef]
  48. Gil, N.; Ulitsky, I. Regulation of gene expression by cis-acting long non-coding RNAs. Nat. Rev. Genet. 2020, 21, 102–117. [Google Scholar] [CrossRef]
  49. Garcia-Moreno, S.A.; Lin, Y.T.; Futtner, C.R.; Salamone, I.M.; Capel, B.; Maatouk, D.M. CBX2 is required to stabilize the testis pathway by repressing Wnt signaling. PLoS Genet. 2019, 15, e1007895. [Google Scholar] [CrossRef]
  50. Knarston, I.M.; Robevska, G.; van den Bergen, J.A.; Eggers, S.; Croft, B.; Yates, J.; Hersmus, R.; Looijenga, L.H.J.; Cameron, F.J.; Monhike, K.; et al. NR5A1 gene variants repress the ovarian-specific WNT signaling pathway in 46,XX disorders of sex development patients. Hum. Mutat. 2019, 40, 207–216. [Google Scholar] [CrossRef]
  51. Hernandez Gifford, J.A. The role of WNT signaling in adult ovarian folliculogenesis. Reproduction 2015, 150, R137–R148. [Google Scholar] [CrossRef] [PubMed]
  52. Nicol, B.; Guiguen, Y. Expression profiling of Wnt signaling genes during gonadal differentiation and gametogenesis in rainbow trout. Sex. Dev. 2011, 5, 318–329. [Google Scholar] [CrossRef] [PubMed]
  53. Davidson, G. LRPs in WNT Signalling. Handb. Exp. Pharmacol. 2021, 269, 45–73. [Google Scholar] [CrossRef] [PubMed]
  54. Ren, Q.; Chen, J.; Liu, Y. LRP5 and LRP6 in Wnt Signaling: Similarity and Divergence. Front. Cell Dev. Biol. 2021, 9, 670960. [Google Scholar] [CrossRef] [PubMed]
  55. Katoh, M.; Katoh, M. WNT signaling and cancer stemness. Essays Biochem. 2022, 66, 319–331. [Google Scholar] [CrossRef] [PubMed]
  56. Wang, J.; Shou, J.; Chen, X. Dickkopf-1, an inhibitor of the Wnt signaling pathway, is induced by p53. Oncogene 2000, 19, 1843–1848. [Google Scholar] [CrossRef] [PubMed]
  57. Voorham, Q.J.; Janssen, J.; Tijssen, M.; Snellenberg, S.; Mongera, S.; van Grieken, N.C.; Grabsch, H.; Kliment, M.; Rembacken, B.J.; Mulder, C.J.; et al. Promoter methylation of Wnt-antagonists in polypoid and nonpolypoid colorectal adenomas. BMC Cancer 2013, 13, 603. [Google Scholar] [CrossRef] [PubMed]
  58. Becking, T.; Giraud, I.; Raimond, M.; Moumen, B.; Chandler, C.; Cordaux, R.; Gilbert, C. Diversity and evolution of sex determination systems in terrestrial isopods. Sci. Rep. 2017, 7, 1084. [Google Scholar] [CrossRef]
  59. Gonen, N.; Lovell-Badge, R. The regulation of Sox9 expression in the gonad. Curr. Top Dev. Biol. 2019, 134, 223–252. [Google Scholar] [CrossRef]
  60. Uchida, A.; Imaimatsu, K.; Suzuki, H.; Han, X.; Ushioda, H.; Uemura, M.; Imura-Kishi, K.; Hiramatsu, R.; Takase, H.M.; Hirate, Y.; et al. SOX17-positive rete testis epithelium is required for Sertoli valve formation and normal spermiogenesis in the male mouse. Nat. Commun. 2022, 13, 7860. [Google Scholar] [CrossRef]
  61. Gubbay, J.; Collignon, J.; Koopman, P.; Capel, B.; Economou, A.; Münsterberg, A.; Vivian, N.; Goodfellow, P.; Lovell-Badge, R. A gene mapping to the sex-determining region of the mouse Y chromosome is a member of a novel family of embryonically expressed genes. Nature 1990, 346, 245–250. [Google Scholar] [CrossRef]
  62. Sinclair, A.H.; Berta, P.; Palmer, M.S.; Hawkins, J.R.; Griffiths, B.L.; Smith, M.J.; Foster, J.W.; Frischauf, A.M.; Lovell-Badge, R.; Goodfellow, P.N. A gene from the human sex-determining region encodes a protein with homology to a conserved DNA-binding motif. Nature 1990, 346, 240–244. [Google Scholar] [CrossRef]
  63. Larney, C.; Bailey, T.L.; Koopman, P. Switching on sex: Transcriptional regulation of the testis-determining gene Sry. Development 2014, 141, 2195–2205. [Google Scholar] [CrossRef]
  64. Sekido, R.; Lovell-Badge, R. Sex determination involves synergistic action of SRY and SF1 on a specific Sox9 enhancer. Nature 2008, 453, 930–934. [Google Scholar] [CrossRef]
  65. Barrionuevo, F.; Scherer, G. SOX E genes: SOX9 and SOX8 in mammalian testis development. Int. J. Biochem. Cell Biol. 2010, 42, 433–436. [Google Scholar] [CrossRef] [PubMed]
  66. Yano, A.; Nicol, B.; Guerin, A.; Guiguen, Y. The duplicated rainbow trout (Oncorhynchus mykiss) T-box transcription factors 1, tbx1a and tbx1b, are up-regulated during testicular development. Mol. Reprod. Dev. 2011, 78, 172–180. [Google Scholar] [CrossRef] [PubMed]
  67. Zhang, C.; Xu, X.; Xu, X.; Li, Y.; Zhao, P.; Chen, X.; Shen, X.; Zhang, Z.; Chen, Y.; Liu, S.; et al. Genome-wide identification, evolution analysis of cytochrome P450 monooxygenase multigene family and their expression patterns during the early somatic embryogenesis in Dimocarpus longan Lour. Gene 2022, 826, 146453. [Google Scholar] [CrossRef] [PubMed]
  68. Yan, Q.; Wu, X.; Chen, C.; Diao, R.; Lai, Y.; Huang, J.; Chen, J.; Yu, Z.; Gui, Y.; Tang, A.; et al. Developmental expression and function of DKKL1/Dkkl1 in humans and mice. Reprod. Biol. Endocrinol. 2012, 10, 51. [Google Scholar] [CrossRef] [PubMed]
  69. Piek, A.; Suthahar, N.; Voors, A.A.; de Boer, R.A.; Silljé, H.H.W. A combined bioinformatics, experimental and clinical approach to identify novel cardiac-specific heart failure biomarkers: Is Dickkopf-3 (DKK3) a possible candidate? Eur. J. Heart Fail. 2020, 22, 2065–2074. [Google Scholar] [CrossRef] [PubMed]
  70. Claver, J.A.; Quaglia, A.I. Comparative morphology, development, and function of blood cells in nonmammalian vertebrates. J. Exot. Pet Med. 2009, 18, 87–97. [Google Scholar] [CrossRef]
  71. Chu, H.Y.; Chen, Z.; Wang, L.; Zhang, Z.K.; Tan, X.; Liu, S.; Zhang, B.T.; Lu, A.; Yu, Y.; Zhang, G. Dickkopf-1: A Promising Target for Cancer Immunotherapy. Front. Immunol. 2021, 12, 658097. [Google Scholar] [CrossRef]
  72. Heil, J.; Olsavszky, V.; Busch, K.; Klapproth, K.; de la Torre, C.; Sticht, C.; Sandorski, K.; Hoffmann, J.; Schönhaber, H.; Zierow, J.; et al. Bone marrow sinusoidal endothelium controls terminal erythroid differentiation and reticulocyte maturation. Nat. Commun. 2021, 12, 6963. [Google Scholar] [CrossRef]
  73. Hirata, H.; Hinoda, Y.; Majid, S.; Chen, Y.; Zaman, M.S.; Ueno, K.; Nakajima, K.; Tabatabai, Z.L.; Ishii, N.; Dahiya, R. DICKKOPF-4 activates the noncanonical c-Jun-NH2 kinase signaling pathway while inhibiting the Wnt-canonical pathway in human renal cell carcinoma. Cancer 2011, 117, 1649–1660. [Google Scholar] [CrossRef]
  74. Fan, H.Y.; O’Connor, A.; Shitanaka, M.; Shimada, M.; Liu, Z.; Richards, J.S. Beta-catenin (CTNNB1) promotes preovulatory follicular development but represses LH-mediated ovulation and luteinization. Mol. Endocrinol. 2010, 24, 1529–1542. [Google Scholar] [CrossRef]
  75. Sanchez, A.M.; Viganò, P.; Quattrone, F.; Pagliardini, L.; Papaleo, E.; Candiani, M.; Panina-Bordignon, P. The WNT/β-catenin signaling pathway and expression of survival promoting genes in luteinized granulosa cells: Endometriosis as a paradigm for a dysregulated apoptosis pathway. Fertil. Steril. 2014, 101, 1688–1696. [Google Scholar] [CrossRef]
  76. Ye, S.; Wang, J.; Yang, S.; Xu, W.; Xie, M.; Han, K.; Zhang, B.; Wu, Z. Specific inhibitory protein Dkk-1 blocking Wnt/β-catenin signaling pathway improve protectives effect on the extracellular matrix. J. Huazhong Univ. Sci. Technol. Med. Sci. 2011, 31, 657. [Google Scholar] [CrossRef] [PubMed]
  77. Kong, X.B.; Zhang, C. Dickkopf (Dkk) 1 promotes the differentiation of mouse embryonic stem cells toward neuroectoderm. In Vitro Cell Dev. Biol. Anim. 2009, 45, 185–193. [Google Scholar] [CrossRef] [PubMed]
  78. Manuylov, N.L.; Smagulova, F.O.; Leach, L.; Tevosian, S.G. Ovarian development in mice requires the GATA4-FOG2 transcription complex. Development 2008, 135, 3731–3743. [Google Scholar] [CrossRef] [PubMed]
  79. Amberg, J.J.; Goforth, R.R.; Sepúlveda, M.S. Antagonists to the Wnt cascade exhibit sex-specific expression in gonads of sexually mature shovelnose sturgeon. Sex. Dev. 2013, 7, 308–315. [Google Scholar] [CrossRef] [PubMed]
  80. Bai, D.P.; Chen, Y.; Hu, Y.Q.; He, W.F.; Shi, Y.Z.; Fan, Q.M.; Luo, R.T.; Li, A. Transcriptome analysis of genes related to gonad differentiation and development in Muscovy ducks. BMC Genom. 2020, 21, 438. [Google Scholar] [CrossRef]
  81. Jeays-Ward, K.; Dandonneau, M.; Swain, A. Wnt4 is required for proper male as well as female sexual development. Dev. Biol. 2004, 276, 431–440. [Google Scholar] [CrossRef] [PubMed]
  82. Ohinata, Y.; Ohta, H.; Shigeta, M.; Yamanaka, K.; Wakayama, T.; Saitou, M. A signaling principle for the specification of the germ cell lineage in mice. Cell 2009, 137, 571–584. [Google Scholar] [CrossRef] [PubMed]
  83. Takase, H.M.; Nusse, R. Paracrine Wnt/β-catenin signaling mediates proliferation of undifferentiated spermatogonia in the adult mouse testis. Proc. Natl. Acad. Sci. USA 2016, 113, E1489–E1497. [Google Scholar] [CrossRef] [PubMed]
Animals 14 00931 g001
Figure 1. The phylogenetic tree illustrates the relationship among DKK gene family members across different vertebrate species. Distinct colors are used to designate various DKK gene subfamilies.
Figure 1. The phylogenetic tree illustrates the relationship among DKK gene family members across different vertebrate species. Distinct colors are used to designate various DKK gene subfamilies.
Animals 14 00931 g001
Animals 14 00931 g002
Figure 2. Collinear analysis of DKK1 (A), DKK2 (B), DKK3 (C), DKK4 (D), DKKL1 (E), and their neighboring genes in H. sapiens, Alligator mississippiensis, P. sinensis, Xenopus tropicalis, and Danio rerio. The direction of the arrow indicates the direction of transcription, and each solid line represents a chromosome scaffold.
Figure 2. Collinear analysis of DKK1 (A), DKK2 (B), DKK3 (C), DKK4 (D), DKKL1 (E), and their neighboring genes in H. sapiens, Alligator mississippiensis, P. sinensis, Xenopus tropicalis, and Danio rerio. The direction of the arrow indicates the direction of transcription, and each solid line represents a chromosome scaffold.
Animals 14 00931 g002
Animals 14 00931 g003
Figure 3. (A) Gene structure of the DKK gene in P. sinensis. (B) Gene structure of Homo sapiens DKK gene. Green boxes, yellow boxes, and black lines, respectively, indicate non-translated regions, exons, and introns.
Figure 3. (A) Gene structure of the DKK gene in P. sinensis. (B) Gene structure of Homo sapiens DKK gene. Green boxes, yellow boxes, and black lines, respectively, indicate non-translated regions, exons, and introns.
Animals 14 00931 g003
Animals 14 00931 g004
Figure 4. DKK family structural domains. Green boxes, N-terminal signal peptides; Sgy, Soggy domain; CRD, cysteine-rich domain. Uniprot ID: DKK1, K7GBU1; DKK2, K7FG86; DKK3, K7FZM3; DKK4, K7FAY0.
Figure 4. DKK family structural domains. Green boxes, N-terminal signal peptides; Sgy, Soggy domain; CRD, cysteine-rich domain. Uniprot ID: DKK1, K7GBU1; DKK2, K7FG86; DKK3, K7FZM3; DKK4, K7FAY0.
Animals 14 00931 g004
Animals 14 00931 g005
Figure 5. Signal peptide predictions for the DKK proteins. The figures (A–F) show the signal peptide prediction results for DKK1, DKK2, DKK3, DKK3L, DKK4 and DKKL1, respectively. The forecasting tool is SignalP 5.0, an online forecasting website.
Figure 5. Signal peptide predictions for the DKK proteins. The figures (A–F) show the signal peptide prediction results for DKK1, DKK2, DKK3, DKK3L, DKK4 and DKKL1, respectively. The forecasting tool is SignalP 5.0, an online forecasting website.
Animals 14 00931 g005
Animals 14 00931 g006
Figure 6. Analysis of the DKK gene promoters in P. sinensis. The different colored rectangles indicate the different transcription factors. The prediction tools used were the TBtools software and the online software PROMO (https://alggen.lsi.upc.es/cgi-bin/promo_v3/promo/promoinit.cgi?dirDB=TF_8.3, accessed on 15 August 2023) and JASPAR (https://jaspar.elixir.no/, accessed on 15 August 2023).
Figure 6. Analysis of the DKK gene promoters in P. sinensis. The different colored rectangles indicate the different transcription factors. The prediction tools used were the TBtools software and the online software PROMO (https://alggen.lsi.upc.es/cgi-bin/promo_v3/promo/promoinit.cgi?dirDB=TF_8.3, accessed on 15 August 2023) and JASPAR (https://jaspar.elixir.no/, accessed on 15 August 2023).
Animals 14 00931 g006
Animals 14 00931 g007
Figure 7. Conserved promoter loci of the DKK gene family in P. sinensis, Mauremys reevesii, and Chrysemyspictabellii. (a) DKK1; (b) DKK2; (c) DKK3; (d) DKK3L; (e) DKK4; and (f) DKK1L.
Figure 7. Conserved promoter loci of the DKK gene family in P. sinensis, Mauremys reevesii, and Chrysemyspictabellii. (a) DKK1; (b) DKK2; (c) DKK3; (d) DKK3L; (e) DKK4; and (f) DKK1L.
Animals 14 00931 g007
Animals 14 00931 g008
Figure 8. Expression analysis of DKK genes in P. sinensis. The expression levels of the DKK genes are indicated by FPKM values. The color range is 0~200. Blue indicates high expression, while white indicates low expression. F1, ovary 1; F2, ovary 2; F3, ovary 3; M1, testis 1; M2, testis 2; M3, testis 3.
Figure 8. Expression analysis of DKK genes in P. sinensis. The expression levels of the DKK genes are indicated by FPKM values. The color range is 0~200. Blue indicates high expression, while white indicates low expression. F1, ovary 1; F2, ovary 2; F3, ovary 3; M1, testis 1; M2, testis 2; M3, testis 3.
Animals 14 00931 g008
Animals 14 00931 g009
Figure 9. Analysis of the expression levels of DKK genes in different tissues of P. sinensis using qRT-PCR. The efα1 gene was used as an internal reference. Means shared with different superscripts differ significantly (p < 0.05), differences labeled with the same lowercase letter are not significant, and differences labeled with different lowercase letters are significant.
Figure 9. Analysis of the expression levels of DKK genes in different tissues of P. sinensis using qRT-PCR. The efα1 gene was used as an internal reference. Means shared with different superscripts differ significantly (p < 0.05), differences labeled with the same lowercase letter are not significant, and differences labeled with different lowercase letters are significant.
Animals 14 00931 g009
Table 1. The primer sequences of our qRT-PCR analysis.
Table 1. The primer sequences of our qRT-PCR analysis.
Primer NameSequence (5′–3′)Product Size (bp)
DKK1-F
DKK1-R		CCTCAACTCCAACGCTATCAA123
ACGGGCTGGTGCTTGTTA
DKK2-F
DKK2-R		ATCGGCAAGGAGAGGCATAC130
TCTCTGTGGCAACGCTTCTT
DKK3-F
DKK3-R		GGAGGAGGCGAGTCTGA181
TTTGGTGTCCGTGTTGG
DKK3L-F
DKK3L-R		TGTATTCGCTGCCCTACCAC240
TGTGGCACTGGCCAAACATA
DKK4-F
DKK4-R		GCGTTCCTGAAGAATGGT
ACTCCTGATGGCGTTGTAG		97
DKKL1-F
DKKL1-R		ATGGCTAGCAGCCTGTGTCT
GACCTGGCAAAGAGATGGAG		230
Ef1α-F
Ef1α-R		ACTCGTCCAACTGACAAGCCTC
CACGGCGAACATCTTTCACAG		337
Table 2. DKK protein analysis of P. sinensis.
Table 2. DKK protein analysis of P. sinensis.
NameGene IDNumber of Amino AcidMolecular Weight
DKK1XM_006130932.326128,025.89
DKK2XM_006119304.326829,923.9
DKK3XM_006113024.238943,169.58
DKK3LXM_025186202.120122,229.6
DKK4XM_006113233.321823,646.1
DKKL1XM_014572465.222224,848.67
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, Y.; Zhu, J.; Chen, C.; Ji, L.; Hong, X.; Liu, X.; Chen, H.; Wei, C.; Zhang, J.; Zhu, X.; et al. Whole-Genome Identification and Characterization of the DKK Gene Family and Its Transcription Profiles: An Analysis of the Chinese Soft-Shell Turtle (Pelodiscus sinensis). Animals 2024, 14, 931. https://doi.org/10.3390/ani14060931

AMA Style

Wang Y, Zhu J, Chen C, Ji L, Hong X, Liu X, Chen H, Wei C, Zhang J, Zhu X, et al. Whole-Genome Identification and Characterization of the DKK Gene Family and Its Transcription Profiles: An Analysis of the Chinese Soft-Shell Turtle (Pelodiscus sinensis). Animals. 2024; 14(6):931. https://doi.org/10.3390/ani14060931

Chicago/Turabian Style

Wang, Yongchang, Junxian Zhu, Chen Chen, Liqin Ji, Xiaoyou Hong, Xiaoli Liu, Haigang Chen, Chengqing Wei, Junjie Zhang, Xinping Zhu, and et al. 2024. "Whole-Genome Identification and Characterization of the DKK Gene Family and Its Transcription Profiles: An Analysis of the Chinese Soft-Shell Turtle (Pelodiscus sinensis)" Animals 14, no. 6: 931. https://doi.org/10.3390/ani14060931

APA Style

Wang, Y., Zhu, J., Chen, C., Ji, L., Hong, X., Liu, X., Chen, H., Wei, C., Zhang, J., Zhu, X., & Li, W. (2024). Whole-Genome Identification and Characterization of the DKK Gene Family and Its Transcription Profiles: An Analysis of the Chinese Soft-Shell Turtle (Pelodiscus sinensis). Animals, 14(6), 931. https://doi.org/10.3390/ani14060931

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop