Next Article in Journal
Potential Food Inclination of Crab-Eating Macaques in Laboratory Environments: Enhancing Positive Reinforcement Training and Health Optimization
Next Article in Special Issue
Effect of Composite Probiotics on Antioxidant Capacity, Gut Barrier Functions, and Fecal Microbiome of Weaned Piglets and Sows
Previous Article in Journal
Treatment Comparison for Medial Femoral Condyle Subchondral Cystic Lesions and Prognosis in Yearling Thoroughbred Racehorse Prospects
Previous Article in Special Issue
The Impact of a Proprietary Blend of Yeast Cell Wall, Short-Chain Fatty Acids, and Zinc Proteinate on Growth, Nutrient Utilisation, and Endocrine Hormone Secretion in Intestinal Cell Models
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 14
Issue 7
10.3390/ani14071121
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Effects of Poria cocos Polysaccharides on Growth Performance, Immunity, and Cecal Microflora Composition of Weaned Piglets

by
Jinzhou Zhang
1,
Heming Wang
1,
Shuaitao Meng
1,
Chuankuan Zhang
1,
Liping Guo
2 and
Zhiguo Miao
1,*
1
College of Animal Science and Veterinary Medicine, Henan Institute of Science and Technology, No. 90, East Section of Hualan Avenue, Xinxiang 453003, China
2
School of Food Science, Henan Institute of Science and Technology, No. 90, East Section of Hualan Avenue, Xinxiang 453003, China
*
Author to whom correspondence should be addressed.
Animals 2024, 14(7), 1121; https://doi.org/10.3390/ani14071121
Submission received: 17 February 2024 / Revised: 31 March 2024 / Accepted: 5 April 2024 / Published: 7 April 2024
(This article belongs to the Special Issue Feed Additives and Micronutrients on Performance, Nutrient Utilization, Immunity, Oxidative Stress, and Gut Health of Pigs and Sows — 2nd Edition)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

Over recent decades, the rapid growth in the use of antibiotics in animal husbandry worldwide has increased awareness of their adverse effects, which pose high risks to public health. The fungus Poria cocos is commonly used as both a traditional Chinese medicine and has a broad range of effects, e.g., strengthening body resistance. Polysaccharides are the main bioactive components of Poria cocos. In this paper, we assessed the potential of Poria cocos polysaccharides (PCPs) as a feed additive for animal production and found that PCP treatment positively influenced the growth performance, immunity, and cecal microbiota composition in weaned piglets.

Abstract

This paper aims to identify Poria cocos polysaccharides (PCPs) as a potential feed additive used for swine production; thus, we explored the effects of different dietary inclusion levels of PCP on growth performance, immunity, and cecal microflora composition in weaned piglets. For this, a total of 120 28-day-old Duroc × Landrace × Yorkshire weaned piglets (8.51 ± 0.19 kg; 28 ± 1 days of age) were randomly allocated to five groups that were fed a basal diet supplemented with 0, 0.025%, 0.05%, 0.1%, and 0.2% PCP, respectively, for 42 days. The results indicated that the average daily gain (ADG) and gain/feed ratio were higher in the PCP treatment groups than in the control group, with a linear effect. The serum concentrations of IgG, IgA, IL-2, IFN-γ, the number of CD4+ T cells, and the CD4+-to-CD8+ T-cell ratio (CD4+/CD8+) were increased, while the levels of IL-6 and TNF-α were decreased in the PCP supplementation groups compared with those in the control group. Furthermore, the cytokine mRNA expression levels exhibited a similar trend in the spleen. PCP supplementation also reduced the abundance of Escherichia coli and Salmonella and enhanced that of Lactobacilli and Bifidobacteria in the cecum. In summary, dietary PCP inclusion exerted positive effects on the growth performance, immunity, and cecal microbiota of piglets and showed potential for use as a feed additive for improving the health of weaned piglets, with 0.1% being the optimal dosage.

1. Introduction

Weaning is a critical time in the life of a pig. During this period, piglets face complex and stressful challenges, including maternal separation, feed conversion, environmental changes, and mixing with unfamiliar piglets [1]. These stress reactions lead to weakened immunity, indigestion, diarrhea, slowed growth, and even death in weaned piglets, resulting in heavy losses to swine farms [2]. Pig farmers have traditionally relied on the addition of antibiotics to alleviate weaning stress and prevent piglet diarrhea. Krishnasamy et al. [3] reported that 38.5 million kg of antibiotics were used in the Chinese pig and poultry industries in 2012. However, following market research on commonly used antibiotics in China, Zhang et al. [4] estimated that 48.4 million kg of antibiotics were consumed in the Chinese swine industry in 2013. Van Boeckelet al. [5] predicted that, by 2030, the worldwide use of antibiotics in food animals would reach 200.2 million kg, far exceeding that consumed by humans. However, accurately predicting antibiotic usage in the pig farming industry globally is a highly complex and unresolved task.
The rapid growth in the use of antibiotics in animal husbandry worldwide has increasingly highlighted their negative effects, such as environmental pollution and antibiotic resistance, which pose high risks to public health [6,7]. To address this concern, since 1 January 2006, a comprehensive legal ban on the use of antibiotics as growth promoters has been in force in the European Union, while on 1 July 2020, the Chinese government banned the use of antibiotics as additives in feed. These observations underscore the need to identify and develop alternatives to antibiotics in the livestock industry. One potential substitute for antibiotics is polysaccharides extracted from natural products. Studies have shown that natural polysaccharides have a wide range of properties, including immune regulatory, anti-inflammatory, and antioxidant activities; have good safety profiles; and are widely sourceable [8,9,10]. Chenet al. [11] reported that the addition of Achyranthes bidentata polysaccharides to the feed of weaned piglets enhanced the yield of complement (C3, C4), cytokines (interleukin-2 [IL-2], interferon-γ [IFN-γ]), and immunoglobulins (IgG, IgA, IgM) in the animals, thereby facilitating cellular and humoral immunity and affording significant protection against infection through nonspecific defense mechanisms. IFN-γ, tumor necrosis factor α (TNF-α), and IL-2 produced by Type 1 T helper (Th1) cells are in charge of the cell-mediated immunity against intracellular pathogens, while IL-4 and IL-10 produced by Th2 cells are in charge of the promotion of antibody responses [12]. Wang et al. [8] found that Angelica and Radix isatidis polysaccharides could mitigate cyclophosphamide-induced immunosuppression in Sprague–Dawley rats, as well as improve their weight restoration and spleen indexes, suggesting that the two polysaccharides have the potential for use as raw material resources for novel veterinary drugs. In a different study, the authors found that the polysaccharide extracted from the mushroom Caripia montagnei exerted anti-inflammatory effects on rats with carrageenan-induced pleuritis. Moreover, Zhang et al. [10] confirmed that the dietary supplementation of Gan cao polysaccharides improved the average daily weight gain and the profile of the cecal microflora in broilers.
Polysaccharides are the major bioactive components of the fungus Poria cocos (Schw.), commonly used as both a traditional Chinese medicine and food. β-Glucan, the major Poria cocos polysaccharide (PCP), possesses a β-(1→3)-linked glucose backbone and β-(1→6)-linked glucose side chains [13]. PCP has a wide range of pharmacological effects, including as an immune enhancer, and has wide prospects for application as a prebiotic in the animal industry [14,15]. Xu et al. [16] found that PCP played an immune-regulatory role in mice, alleviating antibiotic-related diarrhea by modulating the homeostasis of intestinal microorganisms and the gut mucosal barrier. Dong et al. [17] also reported that PCP enhanced cellular Th1 immune responses. However, no study to date has evaluated the effect of Poria cocos polysaccharides on the growth performance, immunity, and cecal microbiota composition in pigs.
The above results suggested that the inclusion of PCP in the diet may exert positive effects on growth and immunity in weaned piglets. Accordingly, in this study, we investigated the influence of different PCP dietary inclusion levels on growth performance, immunity, and cecal microflora composition in weaned piglets, aiming to identify a potential feed additive for use in swine production.

2. Materials and Methods

2.1. Ethical Statement

All animal experiments were approved by the Animal Protection and Utilization Committee of the Henan Academy of Science and Technology (approval number 2023HIST018, Xinxiang, China).

2.2. Poria cocos Polysaccharide Preparation

Poria cocos polysaccharide was purchased from Hubei Huisheng Biotechnology Co., Ltd. (Wuhan, China) as a grayish-white powder with a drying weight loss of less than 5% and a polysaccharide content ≥90%.

2.3. Animals, Trial Design, and Management

A total of 120, healthy, 28-day-old Duroc×Landrace×Yorkshire (DLY) weaned piglets were provided by Chunfa Farm in Shenqiu County, Henan, China. The basal diet for the experiment was formulated to meet the NRC (2012) nutritional standard for weaned piglets. Its composition and nutritional level are displayed in Table 1. The piglets were randomly allocated to five groups, namely, a control group, in which the piglets were fed the basal diet, and four PCP groups, in which the animals were fed the basal diet supplemented with 0.025%, 0.05%, 0.1%, and 0.2% PCP. This study used a feed mixer to mix PCP and feed. Firstly, the required amount of PCP for each group was mixed evenly with the 10% of the feed and then mixed evenly with the remaining feed. Each group had three replicates, with eight piglets per replicate (sex-balanced). The animals were raised in a pigsty in an artificially controlled environment, one replicate (eight piglets) per pigpen, and allowed free access to feed and water. The feeding management was performed according to the piggery’s procedures. The experiment lasted for 49 days, including a 7-day pretrial period. The first 7 days were the pretrial period. During the pretrial period, the pigs adapted to new pens, new populations, and reduced stress and only a basal diet was fed. The last 42 days were the trial period; five groups were fed the basal diet, or the basal diet supplemented with 0.025%, 0.05%, 0.1%, and 0.2% PCP, respectively.At the beginning and end of the experiment, the piglets were fasted for 12 h (with free access to drinking water) and weighed to determine the initial body weight (IBW) and final body weight (FBW), respectively. Daily feed consumption and residual feed were recorded during the experiment, and the values were used to calculate the average daily gain (ADG), average daily feed intake (ADFI), and gain/feed ratio.

2.4. Sample Collection

2.4.1. Serum Collection

On the morning of trial day 43, two piglets (one male and one female, close to the replicate average weight) were chosen from each replicate for blood collection. Blood (10 mL) was collected from the anterior vena cava either into sterile tubes (5 mL, for immunoglobulin and cytokine concentration analyses) or vacuum tubes containing heparin (5 mL, for lymphocyte isolation). The non-anticoagulated blood samples were placed at room temperature for 1h and centrifuged at 1500× g for 15 min. The serum was carefully collected and stored at −20 °C for serum index analysis.

2.4.2. Lymphocyte Isolation

Lymphocytes were isolated from heparinized blood samples by density gradient centrifugation following the manufacturer’s instructions (Solarbio, Beijing, China). After centrifugation at 600× g for 30 min at room temperature, the lymphocytes were aspirated into new centrifuge tubes, washed three times with PBS with centrifugation at 250× g for 10 min, and then resuspended in RPMI-1640 containing 5% fetal bovine serum (HyClone, UT, USA) to a density of 1 × 107 cells/mL for use in flow cytometry.

2.4.3. Tissue Sample Collection

After blood collection, the piglets were euthanized using electrical stunning methods. The spleen was subsequently separated from visceral organs, immediately placed in liquid nitrogen, and then placed at −80 °C in 1.5 mL sterile tubes for later analysis.

2.4.4. Intestinal Sample Collection

After euthanasia, the cecal contents were collected from the same location in each animal into sterile tubes, placed in an ice box, and transported back to laboratory for microbial analysis.

2.5. Determination of Immunoglobulin and Cytokine Contents and the CD4+/CD8+ T Cell Ratio

Immunoglobulin (Ig) and cytokine concentrations in serum were determined using enzyme-linked immunosorbent assays (ELISAs) following the kits’ instructions of therespective kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). The immune indicators tested included IgA, IgG, IgM, IL-1β, IL-2, IL-6, IL-10, IFN-γ, and tumor necrosis factor-alpha (TNF-α).
The ratio of CD4+ to CD8+ T lymphocytes was assessed by flow cytometry according to Lestari et al. [18]. Briefly, 1 × 106 cells per sample were added to a 1.5 mL centrifuge tube and incubated with 2 μL of anti-CD4α-FITC, anti-CD8α-R-PE, and anti-CD3ε-SPRD antibodies (SouthernBiotech, Birmingham, AL, USA) at 4 °C in the dark for 30 min. Subsequently, the suspensions were centrifuged, the supernatant was discarded, and the cells were washed three times with PBS, resuspended in 300 μL of PBS, and subjected to flow cytometric analysis using a FACSCalibur (Becton, Dickinson and Company, New Jersey, NJ, USA).

2.6. Measurement of Cytokine mRNA Levels in the Spleen

Total RNA was extracted from 50 mg of spleen tissue from each sample with TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) following the instructions of the manual and then reverse-transcribed using an M-MuLV First Strand cDNA Synthesis Kit (Sangon Biotech, Shanghai, China). The expression levels of cytokines in spleen tissue were assessed by quantitative real-time PCR (qPCR) and calculated using the 2−ΔΔCt method [19]; β-actin served as the housekeeping gene. The sequences of the primer pairs used for qPCR are shown in Table 2.

2.7. Analysis of the Cecal Microflora

Analysis of the cecal microflora was performed as described by Zhang et al. [10]. Cecal contents (0.5 g) were placed in a sterile test tube to which 5 mL of sterile normal saline was added. After shaking for 10 min, the suspension was diluted 10-fold and then further serially diluted with sterile normal saline from 1 × 102 to 1 × 108. Subsequently, 0.1 mL of the 105, 106, 107, and 108 dilutions were plated on Petri dishes (three replicates per dilution). Lactobacilli, Bifidobacteria, Escherichia coli, and Salmonella were anaerobically cultured at 37 °C for 48 h on Man–Rogosa–Sharpe agar, BBL, eosin methylene blue agar, and MacConkey agar, respectively. Finally, bacterial units were recorded and expressed as the number of colony-forming units (CFUs) per 1g of cecal sample.

2.8. Statistical Analysis

The data were analyzed using SPSS 25.0 software. The significance of differences among the five groups was assessed using one-way ANOVA followed by Duncan’s post hoc test. The data are presented as means ± standard error of the mean (SEM), with p < 0.05 indicating significant differences among the groups.

3. Results

3.1. The Effect of PCP on Growth Performance

The effect of dietary PCP supplementation on weight gain in weaned piglets is presented in Table 3. The results showed that adding different levels of PCP to the diet improved the ADG. Meanwhile, the different doses of PCP exerted differential effects on the weight of the piglets. As shown in Table 3, the ADFI was not affected (p = 0.683) by dietary PCP administration; in contrast, both the ADG (p < 0.05) and gain/feed ratio (p < 0.05) were significantly improved in piglets receiving 0.05%, 0.1%, and 0.2% PCP in the diet, except for 0.025% PCP; furthermore, they were linearly correlated with the amount of PCP supplementation (p = 0.021; p = 0.035). Overall, the addition of 0.1% PCP exerted the best effect on growth performance in the weaned piglets.

3.2. The Effect of PCP on Serum Immunoglobulin and Cytokine Contents

The influence of dietary PCP supplementation on serum Ig and cytokine contents in weaned piglets is shown in Table 4. We found that the dietary supplementation of 0.05%, 0.1%, and 0.2% PCP markedly increased serum IgG and IgA concentrations (p < 0.05); the serum IgG concentration linearly increased with the dietary supplementation of PCP (p = 0.009) but did not influence IgM levels (p = 0.423). Meanwhile, PCP supplementation did not affect the serum levels of IL-1β (p = 0.541) or IL-10 (p = 0.134). However, compared with the control condition, dietary PCP increased the serum concentrations of IL-2 (p < 0.05; 0.025%, 0.05%, 0.1%, and 0.2% PCP) and IFN-γ (p < 0.05; 0.05%, 0.1%, and 0.2% PCP) and decreased those of IL-6 (p < 0.05; 0.05%, 0.1%, and 0.2% PCP) and TNF-α (p < 0.05; 0.1% and 0.2% PCP); the serum IL-2 (p = 0.011), IFN-γ (p = 0.047), and TNF-α (p = 0.030) levels were linearly correlated with the amount of PCP supplementation. These data demonstrated that the dietary inclusion of 0.1% and 0.2% PCP (p < 0.05) improved serum immune indexes in the weaned piglets.

3.3. The Effect of PCP on the CD4+/CD8+ T Cell Ratio

As shown in Table 5, there were no differences in the number of CD3+ (p = 0.268) or CD8+ (p = 0.163) lymphocytes among the groups. The number of CD4+ lymphocytes and the CD4+/CD8+ ratio were higher both in the 0.1% and 0.2% PCP treatment groups than in the control group (p < 0.05), and they linearly increased with the dietary supplementation of PCP (p = 0.046; p = 0.025). The dietary supplementation of 0.1% and 0.2% PCP (p < 0.05) exerted the best effect on the CD4+/CD8+ ratio in weaned piglets.

3.4. The Effect of PCP on Cytokine mRNA Levels in the Spleen

The mRNA levels of cytokines in the spleen of weaned piglets, as detected by qPCR, are displayed in Figure 1. The mRNA levels of IL-1β (p = 0.214) and IL-10 (p = 0.165) in the spleen were not affected by dietary PCP administration. However, compared with the control group, the mRNA levels of IL-6 and TNF-α were down regulated in the 0.1% and 0.2% PCP treatment groups (p < 0.05), and they were linearly correlated with the amount of PCP supplementation (IL-6: p = 0.021, p = 0.035; TNF-α: p = 0.010, p = 0.016), while those of IL-2 in the 0.25%, 0.1%, and 0.2% PCP treatment groups and of IFN-γ in the 0.1% and 0.2% PCP treatment groups were upregulated (p < 0.05), and they linearly increased with the dietary supplementation of PCP (IL-2: p = 0.032, p = 0.022, p = 0.045; IFN-γ: p = 0.006, p = 0.001). Overall, the 0.1% and 0.2% PCP concentrations (p < 0.05) exerted the greatest influence on the mRNA expression levels of cytokines in the spleen of weaned piglets (Figure 1).

3.5. The Effect of PCP on the Cecal Microflora

The abundance of Escherichia coli, Salmonella, Lactobacilli, and Bifidobacteria in the cecum of piglets in the PCP treatment groups displayed a changing trend relative to that in the control group (Table 6). The abundance of Escherichia coli and Salmonella was significantly reduced, and they linearly decreased with the dietary supplementation of PCP (p = 0.020; p = 0.012), whereas that of Lactobacilli and Bifidobacteria was significantly increased in the 0.05%, 0.1%, and 0.2% PCP treatment groups (p < 0.05). In summary, the addition of PCP to the diet positively influenced the cecal microbial profile, with the 0.1% PCP concentration producing the best effect.

4. Discussion

In this work, we explored the potential for the use of PCP as a feed additive in the pig-rearing industry and presented valuable data regarding the effects of PCP on the growth, serum immune indexes, expression of immune-related genes, and cecal microbiota composition of weaned piglets. Our results indicated that the addition of appropriate concentrations of PCP to the diet can increase the growth performance of weaned piglets with a linear effect. Growth performance is the core indicator for evaluating the success of pig farm management, as increased growth results in higher yields and greater economic benefits. Hence, how to best improve growth efficiency in pigs has become a hot topic of discussion for piggeries. However, there is a lack of information regarding the impact of PCP on porcine growth performance in the literature; recent studies have shown that dietary PCP supplementation exerts a positive effect on the growth performance in Dabry’s sturgeons and spotted sea bass, with suggested optimal dosages of 0.2 and 1.2 g/kg, respectively [20,21]. Furthermore, PCP administration was reported to mitigate the 5-fluorouracil treatment-induced body weight reduction in ApcMin/+ mice [14]. Combined, these data confirmed that PCP has a promotive effect on animal growth, which is expected to improve the economic benefits of pig farms, and more studies focusing on the underlying molecular pharmacological mechanism are warranted.
Recent studies have shown that the bioactive components of Poria cocos are polysaccharides, triterpenoids, fatty acids, sterols, etc.; PCP accounts for 84% of bioactive components in dried Poria cocos and can act as an immune enhancer, improving both humoral and cellular immunity [13,22,23,24]. Serum IgG, IgA, and IgM play key roles in immune function, and their concentrations can reflect the health status of pigs. Jiang et al. [25] found that feeding PCP to normal mice boosted the serum contents of IgA, IgM, and IgG, and this effect was dose-dependent. Liu et al. [26] found that the addition of PCP to the diet significantly elevated serum IgG and IgM levels in immunosuppressed mice and contributed to the restoration of the suppressed humoral immune function by modulating the TLR4/NF-κB signaling pathway. In this study, we found that dietary PCP addition significantly increased the serum concentrations of IgG and IgA in weaned piglets, which is in line with the abovementioned findings. However, PCP supplementation did not influence the levels of IgM, an observation that requires further exploration.
Cytokines are low-molecular-weight soluble proteins produced by a wide variety of cell types andserving as important mediators of immune responses [27]. A recent study showed that Cordyceps sinensis polysaccharides promoted cytokine secretion (IFN-γ, TNF-α, IL-2, IL-4, IL-6, IL-10, IL-12, IL-13, IL-17, and IL-21) in cyclophosphamide-treated mice and had a protective effect on intestinal mucosal immune suppression [28]. Liu et al. [29] found that Sanghuangporus vaninii polysaccharides significantly reduced the levels of proinflammatory IL-1β, IL-6, and TNF-α and elevated those of anti-inflammatory IL-10 in lipopolysaccharide-treated RAW 264.7 cells. Alagbaoso and Mizuno [30] reported that Lentinula edodes polysaccharides greatly alleviated weight loss in mice with dextran sulfate sodium-induced colitis and inhibited the expression of proinflammatory cytokines (TNF-α, IL-1β, IL-6, and IFN-γ), suggesting that the polysaccharide may be effective for treating inflammatory bowel disease. In this study, we found that dietary PCP administration elevated the serum levels of IL-2 and IFN-γ, while reducing those of IL-6 and TNF-α in weaned piglets; no effect of PCP was detected on the serum contents of IL-1β and IL-10. Furthermore, the mRNA levels of these cytokines exhibited a similar trend in the spleen. However, our results relating to the effects of PCP treatment on cytokine levels in weaned piglets are inconsistent with those of previous works [28,31], which may be associated with the pleiotropy and complexity of cytokines.
CD4+ and CD8+T cells participate in the recognition of foreign antigens and the clearing of cells that have been invaded by viruses or bacteria [32]. The CD4+/CD8+ ratio is an important indicator of the level of cellular immunity, and an increase in this ratio in blood reflects an improvement in animal immunity [33]. Our results showed that the dietary inclusion of 0.1% and 0.2% PCP exerted the greatest effects on improving the CD4+ T cell count and the CD4+/CD8+ ratio in weaned piglets relative to that in the control group, implying that PCP is effective at elevating cellular immunity in weaned piglets. Shan et al. [34] found that Schisandra chinensis polysaccharides moderated the secretion of numerous inflammatory factors and increased the CD4+/CD8+ T cell ratio in mice with concanavalin A-induced immune-mediated liver injury. A different study reported that Atractylodes macrocephala Koidz. polysaccharides elevated the CD4+/CD8+ lymphocyte ratio in chickens and had a notable regulatory effect on cellar immunity [35]. Our results are consistent with these findings.
In our study, we assessed the abundance offour classic bacteria—Escherichia coli, Salmonella, Lactobacilli, and Bifidobacteria—in the cecum of weaned piglets. Some studies have shown that weaning has a significant impact on the gut microbiota of piglets, mainly manifesting as an increase in the abundance of Escherichia coli and a decrease in that of Lactobacilli, leading to piglet intestinal dysfunction and diarrhea [36,37,38]. Potential pathogens such as Escherichia coli and Salmonella produce endotoxins and other substances in the animal intestine under stress, and these factors damage the intestinal barrier and disrupt intestinal homeostasis, thereby causing diarrhea [16]. In contrast, beneficial bacteria such as Lactobacilli and Bifidobacteria can produce organic acids through the fermentation of substrates such as fructose, starch, and glycogen, leading to a decrease in pH in the intestinal contents and thereby suppressing the proliferation of acid-sensitive pathogenic microorganisms [39]. Moreover, Lactobacilli and Bifidobacteria can adhere to the intestinal epithelium and suppress the growth of pathogenic bacteria by competing with them for adhesion sites [40]. Our findings showed that PCP treatment reduced the abundance of Escherichia coli and Salmonella and enhanced that of Lactobacilli and Bifidobacteria, which agreed with previous studies [39,40]. These results indicated that PCP can ameliorate the composition of the microbial population in the cecal contents of weaned piglets, thus enhancing intestinal health.

5. Conclusions

In summary, the dietary supplementation of PCP positively influenced growth performance, immunity, and cecal microbiota composition in weaned piglets. Poria cocos polysaccharides can be used as a feed additive to improve the health of weaned piglets, with 0.1% being the optimal inclusion level.

Author Contributions

J.Z.: conceptualization, investigation, writing—original draft, writing—review, and editing. H.W., S.M. and C.Z.: data curation, methodology, software, and visualization. L.G.: formal analysis and supervision. Z.M.: project administration and funding acquisition. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Program for Innovative Research Team (in Science and Technology) at University of Henan Province (Henan Province, China; 22IRTSTHN026), Pig Industry Technology System Innovation Team Project of Henan Province (HARS-22-12-G1), Henan Province Science and Technology Research Projects (232102111055; 232102110079), Postgraduate Education Reform and Quality Improvement Project of Henan Province (YJS2023AL051), and Key Scientific Research Projects of Colleges and Universities of Henan Province (Henan Province, China; 23B230003).

Institutional Review Board Statement

All animal experiments were approved by the Animal Protection and Utilization Committee of the Henan Academy of Science and Technology (approval number 2023HIST018, Xinxiang, China).

Informed Consent Statement

Not applicable.

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors without undue reservation.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Campbell, J.M.; Crenshaw, J.D.; Polo, J. The biological stress of early weaned piglets. J. Anim. Sci. Biotechnol. 2013, 4, 19. [Google Scholar] [CrossRef] [PubMed]
  2. Tang, X.; Xiong, K.; Fang, R.; Li, M. Weaning stress and intestinal health of piglets: A review. Front. Immunol. 2022, 13, 1042778. [Google Scholar] [CrossRef]
  3. Krishnasamy, V.; Otte, J.; Silbergeld, E. Antimicrobial use in Chinese swine and broiler poultry production. Antimicrob. Resis. Infect. Control 2015, 4, 17. [Google Scholar] [CrossRef] [PubMed]
  4. Zhang, Q.Q.; Ying, G.G.; Pan, C.G.; Liu, Y.S.; Zhao, J.L. Comprehensive evaluation of antibiotics emission and fate in the river basins of China: Source analysis, multimedia modeling, and linkage to bacterial resistance. Environ. Sci. Technol. 2015, 49, 6772–6782. [Google Scholar] [CrossRef] [PubMed]
  5. Van Boeckel, T.P.; Glennon, E.E.; Chen, D.; Gilbert, M.; Robinson, T.P.; Grenfell, B.T.; Levin, S.A.; Bonhoeffer, S.; Laxminarayan, R. Reducing antimicrobial use in food animals. Science 2017, 357, 1350–1352. [Google Scholar] [CrossRef]
  6. Marshall, B.M.; Levy, S.B. Food animals and antimicrobials: Impacts on human health. Clin. Microbiol. Rev. 2011, 24, 718–733. [Google Scholar] [CrossRef]
  7. Yang, H.; Paruch, L.; Chen, X.; van Eerde, A.; Skomedal, H.; Wang, Y.; Liu, D.; Liu, C.J. Antibiotic application and resistance in swine production in China: Current situation and future perspectives. Front. Vet. Sci. 2019, 6, 136. [Google Scholar] [CrossRef] [PubMed]
  8. Wang, Y.L.; Shu, X.H.; Zhang, X.; Liu, Y.B.; Zhang, Y.J.; Lv, T.; Huang, X.; Song, C.L. Effects of two polysaccharides from traditional Chinese medicines on rat immune function. Front. Vet. Sci. 2021, 8, 703956. [Google Scholar] [CrossRef]
  9. Zou, T.; Yang, J.; Guo, X.; He, Q.; Wang, Z.; You, J. Dietary seaweed-derived polysaccharides improve growth performance of weaned pigs through maintaining intestinal barrier function and modulating gut microbial populations. J. Anim. Sci. Biotechnol. 2021, 12, 28. [Google Scholar] [CrossRef]
  10. Zhang, S.; Zhu, C.; Xie, H.; Wang, L.; Hu, J. Effect of Gan Cao (Glycyrrhiza uralensis Fisch) polysaccharide on growth performance, immune function, and gut microflora of broiler chickens. Poult. Sci. 2022, 101, 102068. [Google Scholar] [CrossRef]
  11. Chen, Q.; Liu, Z.; He, J.H. Achyranthes bidentata polysaccharide enhances immune response in weaned piglets. Immunopharmacol. Immunotoxicol. 2009, 31, 253–260. [Google Scholar] [CrossRef] [PubMed]
  12. Matucci, A.; Maggi, E.; Vultaggio, A. Cellular and humoral immune responses during tuberculosis infection: Useful knowledge in the era of biological agents. J. Rheumatol. Suppl. 2014, 91, 17–23. [Google Scholar] [CrossRef] [PubMed]
  13. Tian, H.; Liu, Z.; Pu, Y.; Bao, Y. Immunomodulatory effects exerted by Poria cocos polysaccharides via TLR4/TRAF6/NF-κB signaling in vitro and in vivo. Biomed. Pharmacother. 2019, 112, 108709. [Google Scholar] [CrossRef] [PubMed]
  14. Yin, L.; Huang, G.; Khan, I.; Su, L.; Xia, W.; Law, B.Y.K.; Wong, V.K.W.; Wu, Q.; Wang, J.; Leong, W.K.; et al. Poria cocos polysaccharides exert prebiotic function to attenuate the adverse effects and improve the therapeutic outcome of 5-FU in ApcMin/+ mice. Chin. Med. 2022, 17, 116. [Google Scholar] [CrossRef] [PubMed]
  15. Ye, H.; Ma, S.; Qiu, Z.; Huang, S.; Deng, G.; Li, Y.; Xu, S.; Yang, M.; Shi, H.; Wu, C.; et al. Poria cocos polysaccharides rescue pyroptosis-driven gut vascular barrier disruption in order to alleviates non-alcoholic steatohepatitis. J. Ethnopharmacol. 2022, 296, 115457. [Google Scholar] [CrossRef] [PubMed]
  16. Xu, H.; Wang, S.; Jiang, Y.; Wu, J.; Chen, L.; Ding, Y.; Zhou, Y.; Deng, L.; Chen, X. Poria cocos polysaccharide ameliorated antibiotic-associated diarrhea in mice via regulating the homeostasis of the gut microbiota and intestinal mucosal barrier. Int. J. Mol. Sci. 2023, 24, 1423. [Google Scholar] [CrossRef] [PubMed]
  17. Dong, X.; Li, B.; Yu, B.; Chen, T.; Hu, Q.; Peng, B.; Sheng, W. Poria cocos polysaccharide induced Th1-type immune responses to ovalbumin in mice. PLoS ONE 2021, 16, e0245207. [Google Scholar] [CrossRef] [PubMed]
  18. Lestari, D.; Murtini, S.; Ulupi, N.; Gunawan, A.; Sumantri, C. Flow cytometric evaluation of CD4+ and CD8+ T-cell in IPB-D2 chickens with different Newcastle disease antibody titers level. Vet. World 2023, 16, 1161–1164. [Google Scholar] [CrossRef] [PubMed]
  19. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2 (-Delta Delta C (T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  20. Zhang, J.; Shu, D.; Cheng, X.; Tian, T.; Xiao, K.; Zhang, D.; Yang, J. Effect of plant polysaccharides (Poria cocos and Astragalus polysaccharides) on immune responses and intestinal microbiota of Dabry’s sturgeons. Biosci. Microbiota Food Health 2023, 49, 6772–6782. [Google Scholar] [CrossRef]
  21. Lu, J.; Huang, Z.; Ye, Y.; Xu, A.; Li, Z. Effects of Poria cocos polysaccharide on growth performance, physiological parameters, and lipid metabolism of spotted sea bass Lateolabrax maculatus. J. Ocean. Limnol. 2023, 11, 8. [Google Scholar] [CrossRef]
  22. Zhao, Y.; Yan, B.; Wang, Z.; Li, M.; Zhao, W. Natural polysaccharides with immunomodulatory activities. Mini. Rev. Med. Chem. 2020, 20, 96–106. [Google Scholar] [CrossRef] [PubMed]
  23. Wu, Y.; Li, S.; Li, H.; Zhao, C.; Ma, H.; Zhao, X.; Wu, J.; Liu, K.; Shan, J.; Wang, Y. Effect of a polysaccharide from Poria cocos on humoral response in mice immunized by H1N1 influenza and HBsAg vaccines. Int. J. Biol. Macromol. 2016, 91, 248–257. [Google Scholar] [CrossRef]
  24. Zhang, W.; Cheng, N.; Wang, Y.; Zheng, X.; Zhao, Y.; Wang, H.; Wang, C.; Han, Q.; Gao, Y.; Shan, J.; et al. Adjuvant activity of PCP-II, a polysaccharide from Poria cocos, on a whole killed rabies vaccine. Virus Res. 2019, 270, 197638. [Google Scholar] [CrossRef]
  25. Jiang, Y.H.; Wang, L.; Chen, W.D.; Duan, Y.T.; Sun, M.J.; Huang, J.J.; Peng, D.Y.; Yu, N.J.; Wang, Y.Y.; Zhang, Y. Poria cocos polysaccharide prevents alcohol-induced hepatic injury and inflammation by repressing oxidative stress and gut leakiness. Front. Nutr. 2022, 9, 963598. [Google Scholar] [CrossRef] [PubMed]
  26. Liu, F.; Zhang, L.; Feng, X.; Ibrahim, S.A.; Huang, W.; Liu, Y. Immunomodulatory activity of carboxymethyl pachymaran on immunosuppressed mice induced by cyclophosphamide. Molecules 2021, 26, 5733. [Google Scholar] [CrossRef]
  27. Kany, S.; Vollrath, J.T.; Relja, B. Cytokines in inflammatory disease. Int. J. Mol. Sci. 2019, 20, 6008. [Google Scholar] [CrossRef] [PubMed]
  28. Ying, M.; Yu, Q.; Zheng, B.; Wang, H.; Wang, J.; Chen, S.; Nie, S.; Xie, M. Cultured Cordyceps sinensis polysaccharides modulate intestinal mucosal immunity and gut microbiota in cyclophosphamide-treated mice. Carbohydr. Polym. 2020, 235, 115957. [Google Scholar] [CrossRef]
  29. Liu, J.; Song, J.; Gao, F.; Chen, W.; Zong, Y.; Li, J.; He, Z.; Du, R. Extraction, purification, and structural characterization of polysaccharides from Sanghuangporus vaninii with anti-inflammatory activity. Molecules 2023, 28, 6081. [Google Scholar] [CrossRef]
  30. Alagbaoso, C.A.; Mizuno, M. Lentinula edodes polysaccharides suppressed pro-inflammatory cytokines expression and colitis in mice. Arq. Gastroenterol. 2022, 59, 288–295. [Google Scholar] [CrossRef]
  31. Lian, Y.Z.; Chang, C.C.; Chen, Y.S.; Tinkov, A.A.; Skalny, A.V.; Chao, J.C. Lycium barbarum polysaccharides and capsaicin modulate inflammatory cytokines and colonic microbiota in colitis rats induced by dextran sulfate sodium. J. Clin. Biochem. Nutr. 2022, 71, 229–237. [Google Scholar] [CrossRef]
  32. Dong, C. Cytokine regulation and function in T cells. Annu. Rev. Immunol. 2021, 39, 51–76. [Google Scholar] [CrossRef] [PubMed]
  33. Cao, S.; Hou, L.; Sun, L.; Gao, J.; Gao, K.; Yang, X.; Jiang, Z.; Wang, L. Intestinal morphology and immune profiles are altered in piglets by early-weaning. Int. Immunopharmacol. 2022, 105, 108520. [Google Scholar] [CrossRef]
  34. Shan, Y.; Jiang, B.; Yu, J.; Wang, J.; Wang, X.; Li, H.; Wang, C.; Chen, J.; Sun, J. Protective effect of Schisandra chinensis polysaccharides against the immunological liver injury in mice based on Nrf2/ARE and TLR4/NF-κB signaling pathway. J. Med. Food 2019, 22, 885–895. [Google Scholar] [CrossRef]
  35. Zhao, X.; Sun, W.; Zhang, S.; Meng, G.; Qi, C.; Fan, W.; Wang, Y.; Liu, J. The immune adjuvant response of polysaccharides from Atractylodis macrocephalae Koidz in chickens vaccinated against Newcastle disease (ND). Carbohydr. Polym. 2016, 141, 190–196. [Google Scholar] [CrossRef]
  36. Zhen, R.; Feng, J.; He, D.; Chen, Y.; Chen, T.; Cai, W.; Xiong, Y.; Qiu, Y.; Jiang, Z.; Wang, L.; et al. Effects of niacin on resistance to enterotoxigenic Escherichia coli infection in weaned piglets. Front. Nutr. 2022, 9, 865311. [Google Scholar] [CrossRef]
  37. Li, L.; Yin, F.; Wang, X.; Yang, C.; Yu, H.; Lepp, D.; Wang, Q.; Lessard, M.; Lo Verso, L.; Mondor, M.; et al. Microencapsulation protected Lactobacillus viability and its activity in modulating the intestinal microbiota in newly weaned piglets. J. Anim. Sci. 2023, 101, skad193. [Google Scholar] [CrossRef] [PubMed]
  38. Mahmud, M.R.; Jian, C.; Uddin, M.K.; Huhtinen, M.; Salonen, A.; Peltoniemi, O.; Venhoranta, H.; Oliviero, C. Impact of intestinal microbiota on growth performance of suckling and weaned piglets. Microbiol. Spectr. 2023, 11, e0374422. [Google Scholar] [CrossRef] [PubMed]
  39. Averina, O.V.; Poluektova, E.U.; Marsova, M.V.; Danilenko, V.N. Biomarkers and utility of the antioxidant potential of probiotic Lactobacilli and Bifidobacteria as representatives of the human gut microbiota. Biomedicines 2021, 9, 1340. [Google Scholar] [CrossRef]
  40. Novik, G.; Savich, V. Beneficial microbiota. Probiotics and pharmaceutical products in functional nutrition and medicine. Microbes Infect. 2020, 22, 8–18. [Google Scholar] [CrossRef]
Animals 14 01121 g001aAnimals 14 01121 g001b
Figure 1. The effect of PCP supplementation on cytokine mRNA levels in the spleen of weaned piglets. (A) IL-1β; (B) IL-2; (C) IL-6; (D) IL-10; (E) IFN-γ; (F) TNF-α. β-actin served as the housekeeping gene. In the figure, different lowercase letters above the columns denote significant differences (p < 0.05).
Figure 1. The effect of PCP supplementation on cytokine mRNA levels in the spleen of weaned piglets. (A) IL-1β; (B) IL-2; (C) IL-6; (D) IL-10; (E) IFN-γ; (F) TNF-α. β-actin served as the housekeeping gene. In the figure, different lowercase letters above the columns denote significant differences (p < 0.05).
Animals 14 01121 g001aAnimals 14 01121 g001b
Table 1. The ingredients and nutrient levels of the experimental diets.
Table 1. The ingredients and nutrient levels of the experimental diets.
IngredientsContent, %Nutrient Levels 2Content, %
Corn59.4Digestible energy (MJ/kg)13.62
Soybean meal19.7Crude protein (%)19.58
Expanded soybean8.0Crude fat (%)3.90
Whey3.6Calcium (%)0.91
Soya oil2.0Available phosphorus (%)0.62
Fish meal3.0Lysine (%)1.48
NaCl0.3
Premix 14.0
1 The premix provided the following per kg of diet: vitamin A, 9750 IU; vitamin D3, 3000 IU; vitamin B1, 3 mg; vitamin B2, 3.7 mg; vitamin B6, 2 mg; vitamin E, 22.5 mg; vitamin K3, 3 mg; folic acid, 1.5 mg; nicotinic acid, 30 mg; pantothenic acid, 15 mg; Cu (as copper sulfate), 5 mg; Fe (as ferrous sulfate), 80 mg; I (as potassiumiodide), 0.14 mg; Mn (as manganese sulfate), 20.5 mg; Se (as sodium selenite), 0.15 mg; and Zn (as zinc sulfate), 80 mg. 2 Nutrient level was calculated according to the Tables of Feed Composition and Nutritive Values in China (2015, twenty-sixthedition).
Table 2. Detailed information for the primersused for qPCR analysis of cytokine genes.
Table 2. Detailed information for the primersused for qPCR analysis of cytokine genes.
GeneIDSequence (5′–3′)Annealing, °CExtension, SProduct
Length, bp
IL-1βNM_214055GCTGGATGCTCCCATTTCTCA
GAAAGCCCAATTCAGGGACCC		6040217
IL-2JN851821AACTGTAAATCCAGCAGCAAT
ACAATGGGTAAGATGCAGCTC		6040131
IL-6AF518322TTTGCCGAGGATGTACTTAA
ATGAACTCCCTCTCCACAAGC		6040190
IL-10HQ236499ACGCCCATCTGGTCCTTCGTT
ATGCCCAGCTCAGCACTGCTC		6040176
TNF-αJF831365CGGGCTTATCTGAGGTTTGAG
GACACCATGAGCACTGAGAGC		6040268
IFN-γNM_213948AAAAGAGGTCCACCATTAGG
CAGAAGCTAACTCTCTCCGAA		6040179
β-actinU07786CGTGGTGGTGAAGCTGTAGCC
ATGTTTGAGACCTTCAACACGC		6040243
Abbreviations: IL-1β, interleukin-1β; IL-2, interleukin-2; IL-6, interleukin-6; IL-10, interleukin-10; IFN-γ, interferon γ; TNF-α, tumor necrosis factor α.
Table 3. The effect of PCP supplementation on the growth performance of weaned piglets.
Table 3. The effect of PCP supplementation on the growth performance of weaned piglets.
PCP Level, % p-Value
Item00.0250.050.10.2SEMGroupsLinearQuadratic
IBW, kg8.518.588.468.488.520.1260.9830.8420.968
FBW, kg24.34 b24.81 b25.72 ab26.31 a26.13 a0.6410.0310.0660.311
ADG, g/d376.90 c386.43 c410.95 b424.52 a419.29 a13.3320.0010.0210.239
ADFI, g/d723.07732.84722.44731.19734.5235.4030.6830.3040.601
Gain/feed ratio0.52 b0.53 b0.57 a0.58 a0.57a0.0020.0010.0310.467
Abbreviations: ADFI, average daily feed intake; ADG, average daily gain; FBW, final body weight; IBW, initial body weight; PCP, Poria cocos polysaccharides; SEM, standard error of the means (n = 24). In the same row, values with different lowercase letters differ significantly from each other (p < 0.05).
Table 4. The effect of PCP supplementation on the serum immune profile of weaned piglets.
Table 4. The effect of PCP supplementation on the serum immune profile of weaned piglets.
PCP Level, % p-Value
Item00.0250.050.10.2SEMGroupsLinearQuadratic
IgG (g/L)3.45 c4.66 b5.16 a5.48 a5.61 a0.1300.0010.0090.878
IgA (g/L)0.20 b0.27 ab0.33 a0.34 a0.33 a0.0510.0280.2980.456
IgM (g/L)0.670.640.670.700.650.0110.4230.6540.751
IL-1β (ng/L)2.332.262.372.412.340.1560.5410.3420.611
IL-2 (ng/L)36.51 c40.46 b42.64 a44.60 a44.63 a1.3170.0050.0110.722
IL-6 (ng/L)16.45 a15.61 ab14.29 b14.33 b14.38 b0.8030.0300.0530.675
IL-10 (ng/L)11.2311.4712.0111.5611.290.3960.1340.5460.203
IFN-γ (ng/L)24.34 c24.52 c26.35 b28.01 a28.16 a1.0140.0150.0470.410
TNF-α (ng/L)0.63 a0.51 ab0.47 ab0.43 b0.41 b0.0230.0160.0300.313
Abbreviations: Ig A, immunoglobulin A; Ig G, immunoglobulin G; Ig M, immunoglobulin M; IL-1β, interleukin-1β; IL-2, interleukin-2; IL-6, interleukin-6; IL-10, interleukin-10; IFN-γ, interferon γ; TNF-α, tumor necrosis factor α; PCP, Poria cocos polysaccharides; SEM, standard error of the means (n = 6). In the same row, values with different lowercase letters differ significantly from each other (p < 0.05).
Table 5. The effect of PCP supplementation on the percentage of lymphocyte subsets and the ratio of CD4+/CD8+ T cells in weaned piglets.
Table 5. The effect of PCP supplementation on the percentage of lymphocyte subsets and the ratio of CD4+/CD8+ T cells in weaned piglets.
PCP Level, % p-Value
Item00.0250.050.10.2SEMGroupsLinearQuadratic
CD3+65.4467.3065.4166.1566.074.2430.2680.3810.524
CD4+41.19 b41.72 b43.56 ab45.20 a45.34 a2.3270.0210.0460.365
CD8+33.4533.5134.0534.2334.112.1340.1630.1130.201
CD4+/CD8+1.23 b1.25 b1.28 ab1.32 a1.33 a0.0570.0360.0250.337
Abbreviations: CD4+/CD8+, ratio of CD4+ to CD8+ of lymphocytes; PCP, Poria cocos polysaccharide; SEM, standard error of the means (n = 6). In the same row, values with different lowercase letters differ significantly from each other (p < 0.05).
Table 6. The effect of PCP supplementation on the cecal microflora of weaned piglets (log10 cfu/g).
Table 6. The effect of PCP supplementation on the cecal microflora of weaned piglets (log10 cfu/g).
PCP Level, % p-Value
Item00.0250.050.10.2SEMGroupsLinearQuadratic
Lactobacilli6.58 b6.85 ab7.20 a7.41 a7.36 a0.1510.0140.1090.351
Bifidobacteria7.32 c7.39 c7.88 b8.34 a8.31 a0.1750.0210.0740.233
Escherichia coli5.24 a5.01 a4.62 b4.45 b4.38 b0.0860.0110.0200.425
Salmonella4.81 a4.56 b4.33 b3.50 c3.44 c0.0620.0030.0120.316
Abbreviations: PCP, Poria cocos polysaccharide; SEM, standard error of the means (n = 6). In the same row, values with different lowercase letters differ significantly from each other (p < 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, J.; Wang, H.; Meng, S.; Zhang, C.; Guo, L.; Miao, Z. The Effects of Poria cocos Polysaccharides on Growth Performance, Immunity, and Cecal Microflora Composition of Weaned Piglets. Animals 2024, 14, 1121. https://doi.org/10.3390/ani14071121

AMA Style

Zhang J, Wang H, Meng S, Zhang C, Guo L, Miao Z. The Effects of Poria cocos Polysaccharides on Growth Performance, Immunity, and Cecal Microflora Composition of Weaned Piglets. Animals. 2024; 14(7):1121. https://doi.org/10.3390/ani14071121

Chicago/Turabian Style

Zhang, Jinzhou, Heming Wang, Shuaitao Meng, Chuankuan Zhang, Liping Guo, and Zhiguo Miao. 2024. "The Effects of Poria cocos Polysaccharides on Growth Performance, Immunity, and Cecal Microflora Composition of Weaned Piglets" Animals 14, no. 7: 1121. https://doi.org/10.3390/ani14071121

APA Style

Zhang, J., Wang, H., Meng, S., Zhang, C., Guo, L., & Miao, Z. (2024). The Effects of Poria cocos Polysaccharides on Growth Performance, Immunity, and Cecal Microflora Composition of Weaned Piglets. Animals, 14(7), 1121. https://doi.org/10.3390/ani14071121

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop