Intestinal Effects of Brewers’ Spent Grain Extract In Ovo (Gallus gallus)—A Pilot Study
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Brewers’ Spent Grain Extract (BSGE) Preparation
2.2. High-Performance Liquid Chromatography (HPLC) Analysis of BSG and BSGE
2.3. Intra-Amniotic Administration (In Ovo)
2.4. Duodenal Histology
2.5. Cecal Bacterial 16S rRNA PCR
2.6. Synchrotron X-Ray Fluorescence Imaging of Duodenal Tissue
2.7. Quantitative Reverse Transcription Polymerase Chain Reaction (RT-qPCR)
2.8. Statistical Analyses
3. Results
3.1. Phenolic Composition of BSG and BSGE
3.2. Duodenal Villi and Crypts
3.3. Duodenal Goblet Cells
3.4. Cecal Bacterial Abundances
3.5. Zinc and Iron Localization in Duodenal Tissue
3.6. Relative Expression of Duodenal Proteins
4. Discussion
4.1. Impact of BSGE on Duodenal Morphology
4.2. Impact of BSGE on Cecal Bacterial Populations
4.3. Impact of BSGE on Zinc and Iron Localization, Concentration, and Transport in Duodena
4.4. An Elaboration on Synchrotron X-Ray Fluorescence Microscopy
4.5. Study Limitations
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Nyhan, L.; Sahin, A.W.; Schmitz, H.H.; Siegel, J.B.; Arendt, E.K. Brewers’ Spent Grain: An Unprecedented Opportunity to Develop Sustainable Plant-Based Nutrition Ingredients Addressing Global Malnutrition Challenges. J. Agric. Food Chem. 2023, 71, 10543–10564. [Google Scholar] [CrossRef] [PubMed]
- Lynch, K.M.; Steffen, E.J.; Arendt, E.K. Brewers’ Spent Grain: A Review with an Emphasis on Food and Health. J. Inst. Brew. 2016, 122, 553–568. [Google Scholar] [CrossRef]
- Spratt, O.; Suri, R.; Deutsch, J. Defining Upcycled Food Products. J. Culin. Sci. Technol. 2021, 19, 485–496. [Google Scholar] [CrossRef]
- Ikram, S.; Huang, L.; Zhang, H.; Wang, J.; Yin, M. Composition and Nutrient Value Proposition of Brewers Spent Grain. J. Food Sci. 2017, 82, 2232–2242. [Google Scholar] [CrossRef]
- Zeko-Pivač, A.; Tišma, M.; Žnidaršič-Plazl, P.; Kulisic, B.; Sakellaris, G.; Hao, J.; Planinić, M. The Potential of Brewer’s Spent Grain in the Circular Bioeconomy: State of the Art and Future Perspectives. Front. Bioeng. Biotechnol. 2022, 10, 870744. [Google Scholar] [CrossRef] [PubMed]
- Alhotan, R.A. Commercial Poultry Feed Formulation: Current Status, Challenges, and Future Expectations. Worlds Poult. Sci. J. 2021, 77, 279–299. [Google Scholar] [CrossRef]
- El-Hack, M.E.A.; Alagawany, M.; Patra, A.; Abdel-Latif, M.; Ashour, E.A.; Arif, M.; Farag, M.R.; Dhama, K. Use of Brewers Dried Grains as an Unconventional Feed Ingredient in the Diets of Broiler Chickens: A Review. Adv. Anim. Vet. Sci. 2019, 7, 218–224. [Google Scholar] [CrossRef]
- Bikker, P.; Jansman, A.J.M. Review: Composition and Utilisation of Feed by Monogastric Animals in the Context of Circular Food Production Systems. Animal 2023, 17, 100892. [Google Scholar] [CrossRef] [PubMed]
- Owens, F.N.; Basalan, M. Ruminal Fermentation. In Rumenology; Millen, D.D., De Beni Arrigoni, M., Lauritano Pacheco, R.D., Eds.; Springer International Publishing: Cham, Switzerland, 2016; pp. 63–102. [Google Scholar] [CrossRef]
- Hoover, W.H. Chemical Factors Involved in Ruminal Fiber Digestion. J. Dairy Sci. 1986, 69, 2755–2766. [Google Scholar] [CrossRef] [PubMed]
- Vieira, S.L.; Stefanello, C.; Sorbara, J.O.B. Formulating Poultry Diets Based on Their Indigestible Components. Poult. Sci. 2014, 93, 2411–2416. [Google Scholar] [CrossRef]
- Bianco, A.; Budroni, M.; Zara, S.; Mannazzu, I.; Fancello, F.; Zara, G. The Role of Microorganisms on Biotransformation of Brewers’ Spent Grain. Appl. Microbiol. Biotechnol. 2020, 104, 8661–8678. [Google Scholar] [CrossRef] [PubMed]
- Bartolomé, B.; Santos, M.; Jiménez, J.J.; Del Nozal, M.J.; Gómez-Cordovés, C. Pentoses and Hydroxycinnamic Acids in Brewer’s Spent Grain. J. Cereal Sci. 2002, 36, 51–58. [Google Scholar] [CrossRef]
- Forssell, P.; Kontkanen, H.; Schols, H.A.; Hinz, S.; Eijsink, V.G.H.; Treimo, J.; Robertson, J.A.; Waldron, K.W.; Faulds, C.B.; Buchert, J. Hydrolysis of Brewers’ Spent Grain by Carbohydrate Degrading Enzymes. J. Inst. Brew. 2008, 114, 306–314. [Google Scholar] [CrossRef]
- Kostenko, V.; Akimov, O.; Gutnik, O.; Kostenko, H.; Kostenko, V.; Romantseva, T.; Morhun, Y.; Nazarenko, S.; Taran, O. Modulation of Redox-Sensitive Transcription Factors with Polyphenols as Pathogenetically Grounded Approach in Therapy of Systemic Inflammatory Response. Heliyon 2023, 9, e15551. [Google Scholar] [CrossRef] [PubMed]
- Ecevit, K.; Barros, A.A.; Silva, J.M.; Reis, R.L. Preventing Microbial Infections with Natural Phenolic Compounds. Future Pharmacol. 2022, 2, 460–498. [Google Scholar] [CrossRef]
- Huang, Q.; Liu, X.; Zhao, G.; Hu, T.; Wang, Y. Potential and Challenges of Tannins as an Alternative to In-Feed Antibiotics for Farm Animal Production. Anim. Nutr. 2018, 4, 137–150. [Google Scholar] [CrossRef] [PubMed]
- Hassan, Z.M.; Manyelo, T.G.; Selaledi, L.; Mabelebele, M. The Effects of Tannins in Monogastric Animals with Special Reference to Alternative Feed Ingredients. Molecules 2020, 25, 4680. [Google Scholar] [CrossRef]
- Choi, J.; Kim, W.K. Dietary Application of Tannins as a Potential Mitigation Strategy for Current Challenges in Poultry Production: A Review. Animals 2020, 10, 2389. [Google Scholar] [CrossRef]
- Liu, S.; Wang, K.; Lin, S.; Zhang, Z.; Cheng, M.; Hu, S.; Hu, H.; Xiang, J.; Chen, F.; Li, G.; et al. Comparison of the Effects between Tannins Extracted from Different Natural Plants on Growth Performance, Antioxidant Capacity, Immunity, and Intestinal Flora of Broiler Chickens. Antioxidants 2023, 12, 441. [Google Scholar] [CrossRef] [PubMed]
- Hou, T.; Tako, E. The In Ovo Feeding Administration (Gallus gallus)—An Emerging In Vivo Approach to Assess Bioactive Compounds with Potential Nutritional Benefits. Nutrients 2018, 10, 418. [Google Scholar] [CrossRef]
- Tako, E.; Ferket, P.R.; Uni, Z. Effects of in Ovo Feeding of Carbohydrates and Beta-Hydroxy-Beta-Methylbutyrate on the Development of Chicken Intestine. Poult. Sci. 2004, 83, 2023–2028. [Google Scholar] [CrossRef] [PubMed]
- Tako, E.; Reed, S.; Anandaraman, A.; Beebe, S.E.; Hart, J.J.; Glahn, R.P. Studies of Cream Seeded Carioca Beans (Phaseolus vulgaris L.) from a Rwandan Efficacy Trial: In Vitro and In Vivo Screening Tools Reflect Human Studies and Predict Beneficial Results from Iron Biofortified Beans. PLoS ONE 2015, 10, e0138479. [Google Scholar] [CrossRef] [PubMed]
- Da Silva, M.; Dombre, C.; Brionne, A.; Monget, P.; Chessé, M.; De Pauw, M.; Mills, M.; Combes-Soia, L.; Labas, V.; Guyot, N.; et al. The Unique Features of Proteins Depicting the Chicken Amniotic Fluid. Mol. Cell. Proteom. 2019, 18, S174–S190. [Google Scholar] [CrossRef]
- Uni, Z.; Ferket, P.R. Enhancement of Development of Oviparous Species by In Ovo Feeding. U.S. Patent 6,592,878 B2, 15 July 2003. [Google Scholar]
- Pushie, M.J.; Sylvain, N.J.; Hou, H.; Hackett, M.J.; Kelly, M.E.; Webb, S.M. X-Ray Fluorescence Microscopy Methods for Biological Tissues. Metallomics 2022, 14, mfac032. [Google Scholar] [CrossRef]
- Pascolo, L.; Gianoncelli, A.; Kaulich, B.; Rizzardi, C.; Schneider, M.; Bottin, C.; Polentarutti, M.; Kiskinova, M.; Longoni, A.; Melato, M. Synchrotron Soft X-Ray Imaging and Fluorescence Microscopy Reveal Novel Features of Asbestos Body Morphology and Composition in Human Lung Tissues. Part. Fibre Toxicol. 2011, 8, 7. [Google Scholar] [CrossRef]
- Agarwal, N.; Shukla, V.; Kolba, N.; Jackson, C.; Cheng, J.; Padilla-Zakour, O.I.; Tako, E. Comparing the Effects of Concord Grape (Vitis labrusca L.) Puree, Juice, and Pomace on Intestinal Morphology, Functionality, and Bacterial Populations In Vivo (Gallus gallus). Nutrients 2022, 14, 3539. [Google Scholar] [CrossRef] [PubMed]
- Gilmore, A.M.; Sui, Q.; Blair, B.; Pan, B.S. Accurate Varietal Classification and Quantification of Key Quality Compounds of Grape Extracts Using the Absorbance-Transmittance Fluorescence Excitation Emission Matrix (A-TEEM) Method and Machine Learning. OENO One 2022, 56, 107–115. [Google Scholar] [CrossRef]
- Peng, Z.; Iland, P.G.; Oberholster, A.; Sefton, M.A.; Waters, E.J. Analysis of Pigmented Polymers in Red Wine by Reverse Phase HPLC. Aust. J. Grape Wine Res. 2002, 8, 70–75. [Google Scholar] [CrossRef]
- Yalcin, S.; Özkan, S.; Shah, T. Incubation Temperature and Lighting: Effect on Embryonic Development, Post-Hatch Growth, and Adaptive Response. Front. Physiol. 2022, 13, 899977. [Google Scholar] [CrossRef] [PubMed]
- Preece, A. A Manual for Histologic Technicians, 3rd ed.; Brown and Company: Boston, MA, USA, 1972. [Google Scholar]
- McManus, J.F.A.; Mowry, R.W. Staining Methods; Harper & Row: New York, NY, USA, 1960. [Google Scholar]
- Agarwal, N.; Kolba, N.; Jung, Y.; Cheng, J.; Tako, E. Saffron (Crocus sativus L.) Flower Water Extract Disrupts the Cecal Microbiome, Brush Border Membrane Functionality, and Morphology In Vivo (Gallus gallus). Nutrients 2022, 14, 220. [Google Scholar] [CrossRef]
- Amit-Romach, E.; Sklan, D.; Uni, Z. Microflora Ecology of the Chicken Intestine Using 16S Ribosomal DNA Primers. Poult. Sci. 2004, 83, 1093–1098. [Google Scholar] [CrossRef] [PubMed]
- Al Hakeem, W.G.; Acevedo Villanueva, K.Y.; Selvaraj, R.K. The Development of Gut Microbiota and Its Changes Following C. jejuni Infection in Broilers. Vaccines 2023, 11, 595. [Google Scholar] [CrossRef] [PubMed]
- Wilson, K.M.; Rodrigues, D.R.; Briggs, W.N.; Duff, A.F.; Chasser, K.M.; Bielke, L.R. Evaluation of the Impact of in Ovo Administered Bacteria on Microbiome of Chicks through 10 Days of Age. Poult. Sci. 2019, 98, 5949–5960. [Google Scholar] [CrossRef] [PubMed]
- Smieska, L.; Page, K.A.; Ree, B.; Zheng, B.; Koerner, H.; Woll, A.R. The Functional Materials Beamline at CHESS. Synchrotron Radiat. News 2023, 36, 4–11. [Google Scholar] [CrossRef]
- Stoupin, S.; Krawczyk, T.; Sagan, D.; Temnykh, A.; Smieska, L.; Woll, A.; Ruff, J.; Lyndaker, A.; Pauling, A.; Croom, B.P.; et al. Side-Bounce Beamlines Using Single-Reflection Diamond Monochromators at Cornell High Energy Synchrotron Source. J. Synchrotron Radiat. 2021, 28, 429–438. [Google Scholar] [CrossRef]
- Github Praxes/Praxes. Praxes/Praxes: Extensible Framework for Scientific Analysis. Available online: https://github.com/praxes/praxes (accessed on 12 September 2024).
- Pfaffl, M.W. A New Mathematical Model for Relative Quantification in Real-Time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
- Thissen, D.; Steinberg, L.; Kuang, D. Quick and Easy Implementation of the Benjamini-Hochberg Procedure for Controlling the False Positive Rate in Multiple Comparisons. J. Educ. Behav. Stat. 2002, 27, 77–83. [Google Scholar] [CrossRef]
- Wasserstein, R.L.; Lazar, N.A. The ASA Statement on P-Values: Context, Process, and Purpose. Am. Stat. 2016, 70, 129–133. [Google Scholar] [CrossRef]
- Hernanz, D.; Nuñez, V.; Sancho, A.I.; Faulds, C.B.; Williamson, G.; Bartolomé, B.; Gómez-Cordovés, C. Hydroxycinnamic Acids and Ferulic Acid Dehydrodimers in Barley and Processed Barley. J. Agric. Food Chem. 2001, 49, 4884–4888. [Google Scholar] [CrossRef] [PubMed]
- Bonifácio-Lopes, T.; Vilas Boas, A.A.; Coscueta, E.R.; Costa, E.M.; Silva, S.; Campos, D.; Teixeira, J.A.; Pintado, M. Bioactive Extracts from Brewer’s Spent Grain. Food Funct. 2020, 11, 8963–8977. [Google Scholar] [CrossRef] [PubMed]
- Brglez Mojzer, E.; Knez Hrnčič, M.; Škerget, M.; Knez, Ž.; Bren, U. Polyphenols: Extraction Methods, Antioxidative Action, Bioavailability and Anticarcinogenic Effects. Molecules 2016, 21, 901. [Google Scholar] [CrossRef] [PubMed]
- Das, A.K.; Islam, M.d.N.; Faruk, M.d.O.; Ashaduzzaman, M.; Dungani, R. Review on Tannins: Extraction Processes, Applications and Possibilities. S. Afr. J. Bot. 2020, 135, 58–70. [Google Scholar] [CrossRef]
- Erben, U.; Loddenkemper, C.; Doerfel, K.; Spieckermann, S.; Haller, D.; Heimesaat, M.M.; Zeitz, M.; Siegmund, B.; Kühl, A.A. A Guide to Histomorphological Evaluation of Intestinal Inflammation in Mouse Models. Int. J. Clin. Exp. Pathol. 2014, 7, 4557–4576. [Google Scholar]
- Ducatelle, R.; Goossens, E.; De Meyer, F.; Eeckhaut, V.; Antonissen, G.; Haesebrouck, F.; Van Immerseel, F. Biomarkers for Monitoring Intestinal Health in Poultry: Present Status and Future Perspectives. Vet. Res. 2018, 49, 43. [Google Scholar] [CrossRef]
- Brus, M.; Gradišnik, L.; Trapečar, M.; Škorjanc, D.; Frangež, R. Beneficial Effects of Water-Soluble Chestnut (Castanea sativa Mill.) Tannin Extract on Chicken Small Intestinal Epithelial Cell Culture. Poult. Sci. 2018, 97, 1271–1282. [Google Scholar] [CrossRef] [PubMed]
- Jamroz, D.; Wiliczkiewicz, A.; Skorupińska, J.; Orda, J.; Kuryszko, J.; Tschirch, H. Effect of Sweet Chestnut Tannin (SCT) on the Performance, Microbial Status of Intestine and Histological Characteristics of Intestine Wall in Chickens. Br. Poult. Sci. 2009, 50, 687–699. [Google Scholar] [CrossRef]
- De Meyer, F.; Eeckhaut, V.; Ducatelle, R.; Dhaenens, M.; Daled, S.; Dedeurwaerder, A.; De Gussem, M.; Haesebrouck, F.; Deforce, D.; Van Immerseel, F. Host Intestinal Biomarker Identification in a Gut Leakage Model in Broilers. Vet. Res. 2019, 50, 46. [Google Scholar] [CrossRef] [PubMed]
- Parker, A.; Maclaren, O.J.; Fletcher, A.G.; Muraro, D.; Kreuzaler, P.A.; Byrne, H.M.; Maini, P.K.; Watson, A.J.M.; Pin, C. Cell Proliferation within Small Intestinal Crypts Is the Principal Driving Force for Cell Migration on Villi. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 2017, 31, 636–649. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.S.; Ho, S.B. Intestinal Goblet Cells and Mucins in Health and Disease: Recent Insights and Progress. Curr. Gastroenterol. Rep. 2010, 12, 319–330. [Google Scholar] [CrossRef] [PubMed]
- Pelaseyed, T.; Bergström, J.H.; Gustafsson, J.K.; Ermund, A.; Birchenough, G.M.H.; Schütte, A.; Van Der Post, S.; Svensson, F.; Rodríguez-Piñeiro, A.M.; Nyström, E.E.L.; et al. The Mucus and Mucins of the Goblet Cells and Enterocytes Provide the First Defense Line of the Gastrointestinal Tract and Interact with the Immune System. Immunol. Rev. 2014, 260, 8–20. [Google Scholar] [CrossRef]
- Duangnumsawang, Y.; Zentek, J.; Goodarzi Boroojeni, F. Development and Functional Properties of Intestinal Mucus Layer in Poultry. Front. Immunol. 2021, 12, 745849. [Google Scholar] [CrossRef] [PubMed]
- Da Silva, B.P.; Martino, H.S.D.; Tako, E. Plant Origin Prebiotics Affect Duodenal Brush Border Membrane Functionality and Morphology, In Vivo (Gallus gallus). Food Funct. 2021, 12, 6157–6166. [Google Scholar] [CrossRef]
- Yang, S.; Yu, M. Role of Goblet Cells in Intestinal Barrier and Mucosal Immunity. J. Inflamm. Res. 2021, 14, 3171–3183. [Google Scholar] [CrossRef]
- Reynolds, K.L.; Cloft, S.E.; Wong, E.A. Changes with Age in Density of Goblet Cells in the Small Intestine of Broiler Chicks. Poult. Sci. 2020, 99, 2342–2348. [Google Scholar] [CrossRef]
- Redondo, E.A.; Redondo, L.M.; Bruzzone, O.A.; Diaz-Carrasco, J.M.; Cabral, C.; Garces, V.M.; Liñeiro, M.M.; Fernandez-Miyakawa, M.E. Effects of a Blend of Chestnut and Quebracho Tannins on Gut Health and Performance of Broiler Chickens. PLoS ONE 2022, 17, e0254679. [Google Scholar] [CrossRef]
- Mannelli, F.; Minieri, S.; Tosi, G.; Secci, G.; Daghio, M.; Massi, P.; Fiorentini, L.; Galigani, I.; Lancini, S.; Rapaccini, S.; et al. Effect of Chestnut Tannins and Short Chain Fatty Acids as Anti-Microbials and as Feeding Supplements in Broilers Rearing and Meat Quality. Animals 2019, 9, 659. [Google Scholar] [CrossRef] [PubMed]
- Redondo, L.M.; Chacana, P.A.; Dominguez, J.E.; Fernandez Miyakawa, M.E. Perspectives in the Use of Tannins as Alternative to Antimicrobial Growth Promoter Factors in Poultry. Front. Microbiol. 2014, 5, 118. [Google Scholar] [CrossRef]
- O’Dell, B.L.; Newberne, P.M.; Savage, J.E. Significance of Dietary Zinc for the Growing Chicken. J. Nutr. 1958, 65, 503–523. [Google Scholar] [CrossRef] [PubMed]
- Vahl, H.A.; Van ‘T Klooster, A.T. Dietary Iron and Broiler Performance. Br. Poult. Sci. 1987, 28, 567–576. [Google Scholar] [CrossRef] [PubMed]
- Pajarillo, E.A.B.; Lee, E.; Kang, D.-K. Trace Metals and Animal Health: Interplay of the Gut Microbiota with Iron, Manganese, Zinc, and Copper. Anim. Nutr. 2021, 7, 750–761. [Google Scholar] [CrossRef]
- McMahon, R.J.; Cousins, R.J. Regulation of the Zinc Transporter ZnT-1 by Dietary Zinc. Proc. Natl. Acad. Sci. USA 1998, 95, 4841–4846. [Google Scholar] [CrossRef] [PubMed]
- Nishito, Y.; Kambe, T. Zinc Transporter 1 (ZNT1) Expression on the Cell Surface Is Elaborately Controlled by Cellular Zinc Levels. J. Biol. Chem. 2019, 294, 15686–15697. [Google Scholar] [CrossRef] [PubMed]
- Geiser, J.; De Lisle, R.C.; Andrews, G.K. The Zinc Transporter Zip5 (Slc39a5) Regulates Intestinal Zinc Excretion and Protects the Pancreas against Zinc Toxicity. PLoS ONE 2013, 8, e82149. [Google Scholar] [CrossRef] [PubMed]
- Aydemir, T.B.; Cousins, R.J. The Multiple Faces of the Metal Transporter ZIP14 (SLC39A14). J. Nutr. 2018, 148, 174–184. [Google Scholar] [CrossRef]
- Nemeth, E.; Ganz, T. Hepcidin-Ferroportin Interaction Controls Systemic Iron Homeostasis. Int. J. Mol. Sci. 2021, 22, 6493. [Google Scholar] [CrossRef]
- Castillo-Michel, H.A.; Larue, C.; Pradas Del Real, A.E.; Cotte, M.; Sarret, G. Practical Review on the Use of Synchrotron Based Micro- and Nano- X-Ray Fluorescence Mapping and X-Ray Absorption Spectroscopy to Investigate the Interactions between Plants and Engineered Nanomaterials. Plant Physiol. Biochem. 2017, 110, 13–32. [Google Scholar] [CrossRef] [PubMed]
- Hackett, M.J.; McQuillan, J.A.; El-Assaad, F.; Aitken, J.B.; Levina, A.; Cohen, D.D.; Siegele, R.; Carter, E.A.; Grau, G.E.; Hunt, N.H.; et al. Chemical Alterations to Murine Brain Tissue Induced by Formalin Fixation: Implications for Biospectroscopic Imaging and Mapping Studies of Disease Pathogenesis. The Analyst 2011, 136, 2941. [Google Scholar] [CrossRef] [PubMed]
- X-Ray Attenuation Length. Available online: https://henke.lbl.gov/optical_constants/atten2.html (accessed on 12 September 2024).
- Solé, V.A.; Papillon, E.; Cotte, M.; Walter, P.; Susini, J. A Multiplatform Code for the Analysis of Energy-Dispersive X-Ray Fluorescence Spectra. Spectrochim. Acta Part B At. Spectrosc. 2007, 62, 63–68. [Google Scholar] [CrossRef]
- Seong, P.N.; Cho, S.H.; Park, K.M.; Kang, G.H.; Park, B.Y.; Moon, S.S.; Ba, H.V. Characterization of Chicken By-Products by Mean of Proximate and Nutritional Compositions. Korean J. Food Sci. Anim. Resour. 2015, 35, 179–188. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward Primer (5′→3′) | Reverse Primer (5′→3′) | Amplicon Length (bp) | Annealing Temp (°C) | Accession # |
---|---|---|---|---|---|
ZnT1 | AGCCAAGAGAAGCTGGGTGA | TTAAGCTGCGCGCTAGAGTC | 119 | 52 | NM_001389457.2 |
ZIP5 | AGCTGATCTGGTGTGGATGG | GCGAGGTCACCCAGCTC | 159 | 52 | XM_025145573.3 |
ZIP14 | GTTCTGCCCCGCTGTCCT | GGTCTGCCCTCCTCCGTCT | 96 | 52 | XM_040689606.2 |
Ferroportin | CTCAGCAATCACTGGCATCA | ACTGGGCAACTCCAGAAATAAG | 98 | 60 | NM_001012913.2 |
MUC2 | CTCTGGCTGGCTCTTTCCAA | AATGGTTGTTCCCCCAGGTG | 94 | 55 | XM_421035.2 |
GAPDH | TCGGAGTCAACGGATTTGGC | TTCCCGTTCTCAGCCTTGAC | 181 | 53 | NM_204305.2 |
Compound | BSG (mg/L) | BSGE (mg/L) |
---|---|---|
phenolic acids | ||
gallic acid | 1.2 | nd |
protocatechuic acid | 0.9 | nd |
syringic acid | nd | nd |
p-coumaric acid | 0.4 | nd |
ferulic acid | 1.1 | nd |
other hydroxycinnamic acids | 72.4 | nd |
flavonoids | ||
astilbin | 0.5 | nd |
catechin | nd | nd |
epicatechin | 32.0 | nd |
quercetin dihydrate | nd | nd |
tannins | ||
polymeric tannins | 67.1 | 23.1 |
Villus Surface Area (µm2) | Villus Height (µm) | Crypt Depth (µm) | VH:CD | |
---|---|---|---|---|
No injection | 25,560.2 ± 715.5 b | 193.1 ± 3.8 a | 25.0 ± 1.0 c | 10.2 ± 0.5 a |
18 MΩ H2O | 24,482.2 ± 697.1 c | 171.5 ± 4.0 b | 37.3 ± 1.1 a | 5.3 ± 0.2 c |
BSGE | 33,286.7 ± 1048.8 a | 199.3 ± 4.9 a | 31.0 ± 0.6 b | 6.8 ± 0.2 b |
Villi | Crypt | |||
---|---|---|---|---|
Quantity | Diameter (µm) | Quantity | Diameter (µm) | |
No injection | 12.6 ± 0.4 b | 3.37 ± 0.06 b | 6.4 ± 0.3 b | 2.92 ± 0.06 c |
18 MΩ H2O | 11.9 ± 0.3 c | 3.15 ± 0.07 c | 7.1 ± 0.3 a | 3.04 ± 0.07 b |
BSGE | 16.0 ± 0.5 a | 3.91 ± 0.07 a | 5.2 ± 0.2 c | 3.32 ± 0.06 a |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huang, M.Y.; Smieska, L.M.; Tako, E. Intestinal Effects of Brewers’ Spent Grain Extract In Ovo (Gallus gallus)—A Pilot Study. Animals 2025, 15, 303. https://doi.org/10.3390/ani15030303
Huang MY, Smieska LM, Tako E. Intestinal Effects of Brewers’ Spent Grain Extract In Ovo (Gallus gallus)—A Pilot Study. Animals. 2025; 15(3):303. https://doi.org/10.3390/ani15030303
Chicago/Turabian StyleHuang, Melissa Y., Louisa M. Smieska, and Elad Tako. 2025. "Intestinal Effects of Brewers’ Spent Grain Extract In Ovo (Gallus gallus)—A Pilot Study" Animals 15, no. 3: 303. https://doi.org/10.3390/ani15030303
APA StyleHuang, M. Y., Smieska, L. M., & Tako, E. (2025). Intestinal Effects of Brewers’ Spent Grain Extract In Ovo (Gallus gallus)—A Pilot Study. Animals, 15(3), 303. https://doi.org/10.3390/ani15030303