Quantitative Proteome Analysis in Response to Glucose Concentration in C2C12 Myotubes

Abstract

Glucose is important for the maintenance of muscle function; however, it is still unclear how changes in glucose concentration affect muscle. Here, we analyzed the effect of glucose concentration on protein expression under different glucose concentration media in C2C12 myotubes. First, we performed proteome analysis in C2C12 myotubes cultured in Low (1.0 g/L), Medium (2.0 g/L), and High (4.5 g/L) glucose media. Proteome analysis revealed 113 proteins were significantly changed in group cultured in Low or Medium glucose media compared to group cultured in High glucose media. Furthermore, glycolysis, oxidative phosphorylation, and fatty acid metabolism were increased in the Medium and Low groups. Among these pathways, HK2, PFKP, NDUFA11, and FABP3 were especially upregulated proteins in Low and Medium groups. In this context, ATP production in C2C12 myotubes cultured in Low and Medium glucose media was increased. There was no significant change in myotubes morphology and myogenic differentiation factors in all groups. Finally, we examined the effect on glucose concentration in culture media on myosin isoforms expression by qRT-PCR. As a result, Myh2 and Myh4 were significantly increased in Low and Medium conditions. Altogether, Low and Medium glucose conditions induced Myh expression probably via enhancement glucose utilization.

1. Introduction

Muscle fibers that make up skeletal muscle are composed of slow muscle fibers, which are rich in mitochondria and predominate in aerobic energy production pathways, and fast muscle fibers (or intermediate types), which predominate in anaerobic energy production pathways [1]. Therefore, energy metabolism and muscle fiber type are closely related. It is also well known that skeletal muscle changes its metabolic properties in response to changes in the systemic environment [2,3]. However, the mechanism that coordinates metabolic changes with muscle status remains unclear.

Glucose is one of the essential nutrients for living organisms, and it plays a particularly important role in energy production. Glucose is metabolized via glycolytic pathway to ATP and pyruvate, a substrate of the TCA cycle for more efficient ATP production. Although skeletal muscle is a major organ that metabolizes glucose, reduction in muscle mass and function cause disruption of glucose metabolism, result in the risk of developing type-2 diabetes [4,5]. Therefore, maintenance of muscle mass and function may be important for maintaining glucose metabolism.

In cultured cell lines, some research reported that glucose concentration in culture media affects muscle metabolism and morphology. Recently, Meng et al. reported that C2C12 myotubes themselves have a mechanism that senses a decrease in extracellular glucose concentration via the Baf60c-Deptor-AKT signaling pathway and increases glucose uptake from extracellular sources [6]. Furthermore, in C2C12 cells cultured in DMEM with Low glucose (1.0 g/L) or High glucose (4.5 g/L), which are commonly used for culture, mitochondria-mediated energy production was activated in cells cultured in Low glucose media compared to High glucose media [7]. In another study, the expression of GLUT1, which is responsible for glucose uptake into cells, and hexokinase II, a rate-limiting enzyme in the glycolytic system, was upregulated in C2C12 cells cultured in DMEM with Low glucose media [8]. In addition, the proliferative activity of muscle satellite cells, which plays a central role in muscle regeneration, was higher when cultured in glucose-free media than in High glucose media, suggesting that the High concentration of glucose in the culture media has a negative effect on muscle [9]. In other cell line, HT-29 cells cultured with Low glucose media showed increased mitochondrial respiratory activity and decreased lipid levels compared to those cultured with High glucose media, suggesting that Low glucose media enhances mitochondrial respiratory capacity [10].

Although these findings suggest the importance of glucose concentration in muscle, it remains unclear how glucose concentration affects muscle metabolism. To clarify this relationship, we tested C2C12 cells cultured in DMEM with High (4.5 g/L), Medium (2.0 g/L), and Low (1.0 g/L) concentrations.

2. Materials and Methods

2.1. Cell Culture

C2C12 myoblasts were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Sigma, St. Louis, MO, USA) containing 10% fetal bovine serum (10099-141, Thermo Fischer Scientific, Waltham, MA, USA) and 1% penicillin–streptomycin mixture (26253-84, Nacalai Tesque, Kyoto, Japan) at three different glucose concentrations [1.0 g/L (Low), 2.0 g/L (Medium), and 4.5 g/L (High)] in a 5% CO₂ atmosphere at 37 °C. After culturing to 100% confluence, the cells were cultured in DMEM containing 2% horse serum (16050-122, Thermo Fischer Scientific, Waltham, MA, USA) with different glucose concentrations to differentiate into myotubular cells. The differentiation media was changed every 2 days.

2.2. Proteomics

Myotubes at 5 days post-differentiation were washed with Hepes–Saline buffer [20 mM Hepes-NaOH (pH 7.5), 137 mM NaCl], and cells were lysed in guanidine hydrochloric acid buffer [6 M guanidine hydrochloride, 100 mM Tris-HCl (pH 8.0), 2 mM DTT]. Proteins were digested with Trypsin/Lys-C mix (Promega, Madison, WI, USA) at 37 °C overnight. Then, LC-MS/MS analysis of the resultant peptides (200 ng each) was conducted on an EASY-nLC 1200 UHPLC connected to a Q Exactive Plus mass spectrometer through a nanoelectrospray ion source (Thermo Fisher Scientific). The peptides were separated on a 75 µm inner diameter 120 mm C18 reversed-phase column (Nikkyo Technos, Tokyo, Japan) with a linear gradient from 4 to 28% acetonitrile for 0–150 min followed by an increase to 80% acetonitrile during min 150–170. The mass spectrometer was performed in a data-dependent acquisition mode with a top 10 MS/MS method. Raw data were analyzed directly against the SwissProt database restricted to Mus musculus using Proteome Discoverer, version 2.2 (Thermo Fisher Scientific) for identification and label-free precursor ion quantification. Normalization was performed in such a way that the total sum of abundance values for each sample over all peptides was the same [11]. We detected a total of 4099 proteins with LC-MS/MS analysis. Of the 4099 proteins, conditiona with “Protein FDR Confidence” value of High and “Peptides” value of 2 or more were extracted, then 3157 proteins were analyzed. Principal component analysis was performed with Python sklearn.decomposition library. Differentially expressed proteins were determined by an exact test after normalization. Hierarchical clustering of 113 differentially expressed proteins was performed by Python seaborn library. Pathway analysis was performed by using DAVID Bioinformatics Resources [12,13]. To visualize the results of proteomics, we analyzed the proteomics of C2C12 myotubes under High, Medium, and Low glucose conditions by IPA.

2.3. ATP Measurement

ATP concentration was measured by CellTiter-Glo 2.0 Cell Viability Assay (G9241, Promega, Madison, WI, USA) accodring to manufacuturer’s instruction. Myotubes at 5 days post-differentiation were equilibrated at room temperature for 30 min, and the same volume of CellTiter-Glo 2.0 Reagent as the culture media was added and incubated at room temperature for 10 min. The contents were then transferred to 1.5 mL microtubes and the luminescence was measured using a tube-based luminometer (Glomax 20/20 Luminometer, Promega, Madison, WI, USA).

2.4. Quantitative Real-Time PCR Analysis (qRT-PCR)

Myotubes at 3 or 5 days post-differentiation were lysed by ISOGEN Reagent (319-90211, Nippon Gene, Tokyo, Japan), mixed vigorously with chloroform, allowed to stand at room temperature for 3 min, and centrifuged at 12,000 rpm for 15 min at 4 °C. The supernatant was purified by isopropanol precipitation and 80% ethanol precipitation. The resulting precipitate was dissolved in DEPC-treated water to obtain RNA. Then, 1 µg of RNA was added to 10 µM Oligo dT Primer (Thermo Fisher Science, Waltham, MA, USA) and 10 µM Random Primer (Thermo Fisher Science, Waltham, MA, USA), heated at 70 °C for 5 min, and cooled at 4 °C for 5 min. The mixture was heated at 70 °C for 5 min and cooled at 4 °C for 5 min. Then, M-MLV Reverse Transcriptase (Promega, Madison, WI, USA), 2.5 mM dNTP MIX (Promega, Madison, WI, USA), and M-MLV RT 5X Buffer (Promega, Madison, WI, USA) were added, and the reaction was carried out at 42 °C for 1 h and at 95 °C for 5 min to prepare cDNA. The prepared cDNA was subjected to qRT-PCR using the ABI7300 real-time PCR system (Applied Biosystems, Waltham, MA, USA) with Power SYBR Green Master Mix (Thermo Fisher Science, Waltham, MA, USA). The primer sequences used are shown in

Table 1. Sequence of the oligonucleotides for qRT-PCR.

Gene Name	Forward (5′-3′)	Reverse (5′-3′)
Myod1	AGGAGCACGCACACTTCTCT	TCTCGAAGGCCTCATTCACT
Myf5	AGACGCCTGAAGAAGGTCAA	GTTCTCCACCTGTTCCCTCA
Myog	CTACAGGCCTTGCTCAGCTC	ACGATGGACGTAAGGGAGTG
Myh1	AATCAAAGGTCAAGGCCTACAA	GAATTTGGCCAGGTTGACAT
Myh2	CAGCACGAGCTGGAGGAAG	CTCGCTTCGGTCATTCCAC
Myh4	GCTGAGGAGGCTGAGGAAC	GTGTGAACCTCTCGGCTCTT
Myh7	AGTCCCAGGTCAACAAGCTG	TTCCACCTAAAGGGCTGTTG
18S rRNA	CATTCGAACGTCTGCCCTA	CCTGCTGCCTTCCTTGGA

. 18S rRNA was used as the internal control.

2.5. Statistical Analysis

All graphs represent mean values ± standard error. One-way ANOVA were used for three groups, and multiple comparison tests using the Tukey–Kramer method were performed as a subtest, with p < 0.05 being considered a significant difference. Statistical analysis were performed using Excel Statistics ver. 7.0 (Social Information System).

3. Results

3.1. Proteome Analysis in C2C12 Myotubes under Low, Medium or High Glucose Conditions

C2C12 myotubes were cultured in Low (1.0 g/L), Medium (2.0 g/L), and High (4.5 g/L) glucose media. At 5 days post-differentiation, proteome analysis was performed to examine the intracellular dynamics of the C2C12 myotubes at different glucose concentrations in the culture media (Table S1). Principal component analysis (PCA) revealed three clusters of High, Medium, and Low groups (Figure 1a). The contribution ratio of PC1 and PC2 are 0.27 and 0.14, respectively. The p-value was corrected by empirical Bayes method. In total, 113 proteins were identified as differentially expressed proteins with statistical significance (q < 0.05) and were classified by their expression patterns into two major groups (Figure 1b). Compared with High, Low and Medium showed similar protein expression patterns. Comparison between Low and Medium did not show any statistically significant difference. The differentially expressed proteins were analyzed by KEGG pathway and IPA analysis (Figure 1c,d). The KEGG and IPA results showed that glycolysis, oxidative phosphorylation, and fatty acid metabolism were increased in the Medium and Low groups compared to the High group. It is noted that PPARGC1A was suggested as an upstream regulator in Medium condition (Figure 1d). Specifically, in the Medium and Low groups, the glycolytic pathways included hexokinase 2 (HK2), which catalyzes the reaction of glucose-to-glucose hexaphosphate, and phosphofructokinase (PFKP), which catalyzes the reaction of fructose hexaphosphate to fructose 1,6-bisphosphate was increased (Figure 1e). Moreover, the expression of NDUFA11, a subunit of mitochondrial complex 1 of the electron transport system [14], and the expression of FABP3, which is involved in the intracellular transport of fatty acids [15], were also increased (Figure 1e). Proteome analyses suggested that Low or Medium glucose media induces the metabolic change.

3.2. ATP Levels in C2C12 Myotubes under Low, Medium or High Glucose Conditions

To evaluate the metabolic impact of the glucose concentration in the culture media on energy metabolism, ATP levels were determined in C2C12 myotubes cultured in Low (1.0 g/L), Medium (2.0 g/L), and High (4.5 g/L) glucose media (Figure 2). The results showed that ATP levels were significantly increased in the Low and Medium groups compared to the High group. This result clearly indicated that increased expression of proteins involving glycolysis, oxidative phosphorylation, and fatty acid oxidation positively contributes to cellular ATP metabolism.

3.3. mRNA Expression of Myosin Heavy Chain (Myh) in C2C12 Myotubes under Low, Medium or High Glucose Conditions

Next, we examined the effects of glucose concentration in culture media on myotubes formation. First, we analyzed the morphology of C2C12 cells from 3 to 5 days post-differentiation using a phase-contrast microscope (Figure 3a). There was no significant change in myotubes formation in either group. To analyze the effects of glucose concentration on differentiation induction, transcriptomic changes of Myod1, Myog and Myf5, which are regulators of myogenic differentiation, were determined in myotubes at 3 days post-differentiation, and no significant changes were observed (Figure 3b).

Myofibers consist of slow and fast muscle fibers, which are classified by fiber type specific Myh proteins, and muscle fiber types are also characterized by different metabolic properties: Myh7/MyHCI, slow-oxidative; Myh2/MyHCIIA, fast-oxidative; Myh1/MyHCIIX, fast-glycolytic; Myh4/MyHCIIB fast-glycolytic [1]. Our proteome analysis revealed that Myh1/MyHCIIX and Myh8/MyHC perinatal were identified as differentially expressed proteins, which are increased in Low and Medium conditions compared with High condition (Figure 1c). To analyze the myosin composition under induced metabolic changes, the expression levels of each myosin isoform at 5 days post-differentiation were confirmed by qRT-PCR (Figure 3c). Myh2 and Myh4 were significantly upregulated in Low and Medium conditions compared with High condition. Myh1 isoform in the Low and Medium groups also showed an increased trend compared to the High group (p = 0.09). These results indicate that growth of C2C12 myocytes at Low and Medium glucose concentrations in culture media result in tendency to increase in myosin isoforms at transcriptional level.

4. Discussion

In this study, we clarified global protein levels under different glucose concentration media using proteome analysis. Low or Medium glucose media increased proteins involving glycolytic system, oxidative phosphorylation, and fatty acid metabolism. Consistent with the proteome observation, ATP contents were increased in myotubes under Low or Medium glucose media. Furthermore, culture in Low or Medium glucose media resulted in an increase in fast and slow Myh genes at the mRNA expression and protein levels.

We identified HK2 and FABP3 in this study. HK2 is an enzyme that catalyzes the first reaction in the glycolysis, producing glucose-6-phosphate from glucose. Four isoforms, HK1-4, exist in mammals, and HK2 is localized at the outer mitochondrial membrane [16]. it has been reported that HK2 can attenuate cellular senescence by maintaining carbohydrate hypermetabolism [16]. Cellular senescence promotes the age-related decline of the skeletal muscular system [17]. Conversely, it has been reported that HK2 activity is upregulated and oxidative phosphorylation is enhanced by 12-week resistance training in young men [18]. In addition, overexpression of FABP3 induces translocation of GLUT4 and enhances glucose uptake in C2C12 myocytes [19]. Based on these reports, the enhancement of glycolysis could be achieved by HK2, PFKP, and FABP3 increased in Low/Medium glucose concentrations in the culture media. Furthermore, NDUFA11, whose expression was found to be upregulated by incubation at Low/Medium glucose concentrations in the present study, is one of the subunits of mitochondrial respiratory chain complex I [14]. Mitochondrial respiratory chain complexes are composed of complex I to V, and complex I is the first enzyme in the respiratory chain reaction [20]. Specifically, it oxidizes NADH produced in the Krebs cycle in the mitochondrial matrix and uses two electrons to reduce ubiquinone to ubiquinol, thereby aiding in the process of ATP production [20]. Defects in human respiratory chain complex I cause impaired energy generation [21]. Furthermore, restoring respiratory chain complex I in mice with mitochondrial myopathy improves their symptoms [22]. These reports supported that upregulated proteins in the proteome analysis are beneficial for muscle health and provide new insights into the relationship between energy metabolism and glucose conditions.

Mitochondria generate energy for cellular activities through ATP production via oxidative phosphorylation [23]. PGC-1α is known to be a factor that enhances the biosynthesis and activity of mitochondria [24] and predicted as an up-stream regulator by IPA analysis (Figure 1d). Therefore, one of the reasons that ATP production was increased in the Low and Medium groups was that the activity of mitochondria was enhanced by the increased expression of PGC-1α. In addition, PGC-1α is also known as a master regulator of slow type fiber genesis, and its decreased expression in the unloading condition contributes to slow muscle fiber-dominant degradation [25]. In mice overexpressing PGC-1α, phosphorylation of Akt1 was observed, accompanied by increased phosphorylation of FOXO3a [26]. FOXO3a is a ubiquitin ligase that is important in muscle atrophy. FOXO3a is a transcription factor that induces the expression of Atrogin-1 and Murf1, ubiquitin ligases important in muscle atrophy, and is inactivated by phosphorylation [27]. Therefore, it would be necessary to examine activity of PGC-1α in order to clarify the molecular mechanism of metabolic protein expression changes induced by glucose concentration. Skeletal muscle fibers are composed of slow muscle fibers, which are rich in mitochondria and predominantly use an oxidative metabolism, and fast muscle fibers, which predominantly use glycolysis. Under conditions of reduced mechanical load, such as when bedridden or in space, it is known that slow muscle fibers are dominantly degraded accompanied with impaired oxidative metabolism [28]. Therefore, it is suggested that intracellular energy metabolism and myofiber degradation are tightly related. The metabolic reprograming by glucose concentration could counteract unloading-induced muscle atrophy. Actually, in this study, we observed increased Myh mRNA expression and proteins. It would be interesting to examine protective effect of Low glucose condition on muscle unloading stress in future sturdy.

Glucose induces nonenzymatic production of advanced glycation end products (AGEs) from proteins. AGEs are involved with senescence, diabetes, cardiovascular diseases, neurological disorders and cancers [29]. AGE’s action is mainly mediated by the binding to receptor of AGE (RAGEs), which activates various signaling pathways as the mitogen-activated protein kinases (MAPKs), extracellular signal-regulated kinases 1 and 2 (ERK), p21^ras, p38, and Janus kinase [29]. In skeletal muscles, AGEs accumulate on skeletal muscles’ extracellular matrix (ECM), which increases stiffness and activates AGE–RAGE signaling in satellite cells and muscle fibers [30]. Recently, histone glycation has been reported as an epigenetic modification, which might affect the transcriptional regulation [31,32]. The underlying mechanism of glucose condition in this study might be related with AGE–RAGE signaling and/or epigenetic regulation by glycation of histone proteins.

In the present study, we found that the aerobic metabolism of C2C12 myocytes was activated by decreasing the glucose concentration in the culture media. We also identified the molecules responsible for these phenomena by proteomic analysis and found HK2, PFKP, FABP3, and NDUFA11 as targets. Now, we need to investigate whether these molecules play a key role in intracellular metabolism in cell/animal models in which the expression of individual molecules is regulated or overexpressed.