Next Article in Journal
Specialty Rice (Oryza sativa L.) with High and Stable Grain Yield under Rainfed Lowland Conditions
Next Article in Special Issue
Exploring Effective Strategies for ToBRFV Management in Tomato Production: Insights into Seed Transmission Dynamics and Innovative Control Approaches
Previous Article in Journal
Isolation of Pathogenic Bacteria from Dairy Cow Mastitis and Correlation of Biofilm Formation and Drug Resistance of Klebsiella pneumoniae in Jiangsu, China
Previous Article in Special Issue
Characterisation of Pectinolytic Bacillus pumilus and Paenibacillus amyloliticus Strains, New Pathogens of Potato in Tunisia
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agriculture
Volume 13
Issue 10
10.3390/agriculture13101982
agriculture-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Recombinase Polymerase Amplification Assay for Rapid Field Diagnosis of Stewart’s Wilt of Corn Pathogen Pantoea stewartii subsp. stewartii

by
Lulu Cai
1,2,
Qian Tian
2,
Qingqing Meng
1,
Xiaoyang Bao
1,3,
Peidong Xu
1,2,
Ji Liu
3,
Wenjun Zhao
1,2,* and
Hui Wang
4,*
1
Center for Biosafety, Chinese Academy of Inspection and Quarantine, Sanya 572024, China
2
Institute of Plant Quarantine, Chinese Academy of Inspection and Quarantine, Beijing 100176, China
3
National Nanfan Research Institute (Sanya), Chinese Academy of Agricultural Sciences, Sanya 572024, China
4
Southern Breeding Administrate Office of Hainan Province, Sanya 572000, China
*
Authors to whom correspondence should be addressed.
Agriculture 2023, 13(10), 1982; https://doi.org/10.3390/agriculture13101982
Submission received: 5 September 2023 / Revised: 4 October 2023 / Accepted: 9 October 2023 / Published: 12 October 2023
(This article belongs to the Special Issue Molecular Diagnosis and Control of Plant Diseases)
Browse Figures
Review Reports Versions Notes

Abstract

:
Stewart’s vascular wilt and leaf blight of sweet corn is caused by the Gram-negative enteric bacterium Pantoea stewartii subsp. stewartii. Stewart’s wilt results in substantial yield losses worldwide warranting rapid and accurate disease diagnosis. Recombinase polymerase amplification (RPA) is an isothermal technique that is tolerant to host plant-derived inhibitors and is, therefore, ideally suited for rapid in-field detection vis-à-vis traditional polymerase chain reaction-based molecular assays. An RPA assay coupled with a Lateral Flow Device (LFD) was developed for rapid, accurate, and sensitive real-time detection of P. stewartii subsp. stewartii directly from the infected host offering in-field pathogen detection, timely disease management, and satisfying quarantine and phytosanitary requirements. Twelve novel primer sets were designed against conserved genomic regions of P. stewartii subsp. Stewartii; however, only the primers for amplification of the intergenic spacer region between capsular polysaccharide genes cpsA and cpsB were discernibly unique and adequate for unambiguous identification of P. stewartii subsp. stewartii. The P. stewartii subsp. stewartii-specific primers were further validated in a simplex RPA assay for specificity against twenty-six bacterial species representing several Pantoea and other closely related bacterial species/subspecies/strains found in the same niche, and naturally or artificially infected plant samples. The integrated RPA/LFD assay was also optimized for rapid and sensitive on-site detection of P. stewartii subsp. stewartii with an empirical detection limit of 0.0005 pg μL−1 bacterial DNA and 1 × 102 CFU mL−1 (app. two bacterial cells used per RPA reaction) in minimally processed samples for accurate, low-cost, and point-of-need diagnosis of the quarantine pathogen P. stewartii subsp. stewartii.

1. Introduction

Pantoea genus (γ-proteobacteria; Enterobacteriaceae) is present across diverse ecological niches and hosts. Pantoea stewartii subsp. stewartii [previously Erwinia stewartii (Smith) Dye] is an aerobic Gram-negative enteric bacterium that primarily infects field and sweet corn (Zea mays) causing Stewart’s wilt and leaf blight. Infection at the young seedling stage is marked by water-soaked lesions of young expanding leaves, progressing to severe wilting and eventual death of the young seedlings [1,2]. The mature plants, if infected after the emergence of the tassels, are prone to leaf blight due to bacterial colonization of the xylem. Leaf blight presents symptoms such as long linear yellow-gray lesions with a wavy margin running parallel to the leaf veins. These lesions later turn necrotic and dark in color [1]. P. stewartii subsp. stewartii is almost exclusively vectored by the corn flea beetle Chaetocnema pulicaria Melsheimer (Coleoptera; Chrysomelidae). Early maturing sweet corn varieties and some elite inbred maize lines are susceptible to Stewart’s wilt disease. Despite availability of resistant corn varieties, resistance may not always prove adequate due to severity of flea beetle infestations, growth stage of infected seedlings, restricted planting window for processing and fresh market corn [2]. Yield losses frequently range from 40 to 100% when susceptible sweet corn hybrids grown under epidemic conditions are infected prior to the five-leaf stage [3].
P. stewartii subsp. stewartii has been reported as the causal agent of bacterial leaf wilt disease in sugarcane (Saccharum officinarum) [4]. Lately, jackfruit (Artocarpus heterophyllus) bronzing disease—due to P. stewartii subsp. stewartii infection—is causing significant economic losses in Malaysia [5]. Choi et al. [6] reported an outbreak of the occurrence of Stewart’s wilt on Chinese bamboo (Dracaena sanderiana) using physiological and molecular analyses and pathogenicity tests. The host range of P. stewartii subsp. stewartii likely extends to several other Poaceae species such as rice (Oryza sativa), oat (Avena sativa), and common wheat (Triticum aestivum), as well as palm (Bactris gasipaes) [7]. As a consequence, quarantine restrictions have been imposed by many countries due to seed transmission of Stewart’s wilt [8], out of concern for emerging diseases [4,5,6], and due to asymptomatic infections in other crops [7]. Phytosanitation regulations can severely impact international trading as well as increase the surveillance and diagnostic costs at the point of origin. Some Pantoea species also pose a significant threat of nosocomial infections. Notably, P. agglomerans (previously designated Erwinia herbicola or Enterobacter agglomerans) has been implicated in several outbreaks of septicemia [9].
Pantoea are commonly associated with plant hosts as epiphytes or pathogens [10], thereby underscoring a critical need for molecular and phylogenetic characterization at the species and infraspecies levels. Pantoea genus was historically distinguished into seven species: P. agglomerans, the type species of the genus; P. ananatis; P. stewartii (divided into the two subspecies stewartii and indologenes); P. dispersa; P. citrea; P. punctata; and P. terrea; however, recent advances in molecular taxonomy has resulted in the identification of several new Pantoea species, and currently Pantoea genus comprises 29 valid and distinct published species [11]. Pantoea species/subspecies and strains are often marked by heterogeneous biochemical or nutritional characteristics and breach of species boundaries due to homologous recombination and lateral gene transfer events [12]. Consequently, understanding the phylogeny and interrelationships within the Pantoea genus has proven difficult relying solely on the 16S rRNA gene and other single-gene or limited multi-gene approaches.
Unknown plant isolates are usually assigned to the genus Pantoea following phenotypic tests such as colony color and Gram-staining but stringent molecular methods are needed for unambiguous taxonomic identification. Brady et al. [13,14] used fluorescent amplified fragment length polymorphism (FAFLP) and multilocus sequence analysis (MLSA) for molecular identification of the genus Pantoea at the species level, and suggested the existence of ten potential novel Pantoea species and the possible inclusion of Pectobacterium cypripedii in the genus Pantoea. Several methods, such as the enzyme-linked immunosorbent assay (ELISA) [15], PCR primers specific for virulence genes [8], TaqMan® primers for the cpsD gene (syn. wceL, for biosynthesis of the exopolysaccharide (EPS) stewartan) [16], genomic fingerprinting using 10-mer ‘miniprimers’ [17], and the 16S rRNA gene PCR-coupled ligase chain reaction (LCR) assay utilizing isotopic primers [18] have been used for species-level identification of P. stewartii. Molecular distinction of P. stewartii from other related species was achieved using matrix-assisted laser desorption ionization–time-of-flight mass spectrometry (MALDI–TOF MS) analysis and specific diagnosis using both conventional and quantitative PCR [19]. Nonetheless, these methods were inadequate for differentiation between P. stewartii subsp. stewartii and subsp. indologenes. P. stewartii subsp. indologenes [20] is nonpathogenic on maize but causes leaf spots on foxtail millet (Setaria italica) and pearl millet (Pennisetum americanum), rot of pineapple (Ananas comosus), and center rot of onion (Allium cepa) [21]. Gehring et al. [22] used a stepdown PCR method to distinguish between the two P. stewartii subsp. based on the conserved single-nucleotide polymorphisms (SNPs) in the housekeeping genes encoding recombinase A (recA) and UDP-glucose 4-epimerase (galE) and subtyping using MALDI–TOF MS protein fingerprints.
Precise taxonomic identification of the two P. stewartii subsp. and related strains remains time-consuming to date. Diagnostic assays include plant pathogenicity assays, gram staining (KOH test), the motility test, the Hugh-Leifson oxidation/fermentation test, the indole test with Kovacs reagent, esculin hydrolysis, and sequencing analyses. Furthermore, large-scale confirmatory PCR assays are cost-prohibitive due to instrumentation and require the use of nucleic acid extraction procedures marred by coextraction of host plant-derived inhibitors. The accuracy of PCR data from field samples may also be compromised if the host has mixed infections or if the target organism is present in low titers leading to false negative results.
Recombinase polymerase amplification (RPA) is an isothermal DNA amplification and detection technology [23]. Lately, RPA has positioned itself as a promising, cost-effective, highly sensitive and selective isothermal amplification technique capable of rapidly amplifying as low as 1–10 DNA target copies from minimally processed samples at constant (near)ambient temperatures (37–42 °C). In contrast to other routinely used molecular diagnostic tools, RPA remains highly affordable and amenable to point-of-care testing of clinical samples and on-site field testing [24]. Current commercial RPA kits use the Sau DNA polymerase from Staphylococcus aureus having the strand-displacement activity necessary for primer extension. Creatine kinase catalyzes phosphocreatine to creatine (Lohmann reaction) to generate ATP for the RPA reaction. The Escherichia coli RecA recombinase binds single-stranded oligonucleotide primers and probes in the presence of ATP and a high-molecular-weight macromolecular crowding agent polyethylene glycol to initiate the RPA process. The nucleoprotein filament interrogates the double-stranded DNA (dsDNA) target and invades the dsDNA at the cognate site. Primer hybridization results in the formation of the D-loop where the locally separated complementary DNA strand is stabilized using single-strand DNA binding (SSB) proteins to prevent the ejection of the inserted primer by branch migration. Cyclic iterations of primer hybridization, recombinase disassembly, and strand-displacing Sau DNA polymerase activity substitute for the heat denaturation step of the conventional PCR, resulting in the exponential amplification reaction. Commercial RPA kit configurations (TwistDx) enable DNA or RNA amplification, and RPA end-point products can be detected using agarose gel electrophoresis [23], TwistAmp™ exo probes (TwistDx, Cambridge, UK) [25,26], or lateral flow dipstick assays (MileniaBiotec, Giessen, Germany) [27,28,29,30].
RPA-based molecular toolkits have been developed for several agronomically important phytopathogens including DNA [31,32] and RNA [30,33,34] viruses, nematodes [35], bacterial [26,36,37], and fungal [27,29,38,39] species. To date, field diagnosis of rice leaf blight pathogen P. ananatis—using an integrated RPA-lateral flow dipstick assay [40]—remains the only diagnostic tool for characterizing any Pantoea species in a non-laboratory setting. The objectives of the current research were two-fold: (a) design and validate PCR primers for precise molecular identification and differentiation of P. stewartii subsp. stewartii from subsp. indologenes and other related bacteria colonizing corn, and (b) develop a portable, rapid, and sensitive molecular toolkit for point-of-need testing of Stewart’s wilt pathogen in the field and in quarantine clinics.

2. Materials and Methods

2.1. Isolation and Storage of Bacterial Strains

In total, twenty-six bacterial strains were used in this study (Table 1), including five P. stewartii subsp. Stewartii, four P. stewartii subsp. Indologenes, and seventeen other bacteria from closely related genera found in the niche. Some of these bacterial strains were previously isolated from naturally infected plant material and were curated in our lab repository. A few strains were isolated from the plant material intercepted at the quarantine diagnostic laboratory at Guangzhou Customs (Guangdong Province, Guangzhou, Tianhe District, China). All bacterial strains were cataloged and cryopreserved following confirmation using 16S sequencing. All the strains were grown at 28 °C in Nutrient Broth (NB) containing 1 g yeast extract, 3 g beef extract, 5 g polypeptone, and 10 g sucrose L−1 medium. To obtain pure cultures, 10 μL of bacterial suspension was streaked on NB supplemented with 15 g L−1 agar (NA) for isolation of single-cell colonies.

2.2. Validation of Primers for the Detection of P. stewartii subsp. stewartii

Twelve novel pairs of primers were designed for the identification of P. stewartii subsp. stewartii. All the primer/probe sequences used for the regular genomic PCR and RPA assays are summarized in Table 2. Specificity of these primers and probes was evaluated in silico using the NCBI GenBank BLASTn tool [41]. Bacterial cultures were grown in NB at 28 °C and 200 rpm for 16 h and harvested at mid-log phase for extraction of genomic DNA. Naturally and artificially infected plants were scored for disease and symptomatic lesions were excised using sterile scalpel blades. Genomic DNA from pure bacterial cultures and infected plant material was extracted using the TIANamp Bacteria DNA Kit (Tiangen Biotech Co. Ltd., Beijing, China) following the manufacturer’s protocol. Two microliters of DNA template (app. 100 ng) was used for PCR reaction containing 12.5 μL of 2× Taq Plus DNA Polymerase Master Mix (Tiangen), 1 μL of primers (up/down, 10 μM) and 9.5 μL of nuclease-free water. The thermocycling protocol was as follows: initial denaturation at 95 °C for 5 min; 35× cycles of denaturation at 95 °C for 30 s; primer annealing at 60 °C for 30 s; extension at 72 °C for 1 min; followed by final extension at 72 °C for 10 min. The amplification products were resolved using agarose gel electrophoresis and their fidelity was verified using Sanger sequencing.

2.3. Inoculation of Maize Leaves and Seeds with P. stewartii subsp. stewartii

P. stewartii subsp. stewartii strain ATCC 29277 was grown in NB at 28 °C and 200 rpm for 16 h. Bacteria in the exponential growth phase were harvested via centrifugation, washed two times, and re-suspended in sterile water to an Abs.600 = 0.3 (app. 1 × 108 CFU mL−1). The third new leaves of 15-day-old corn seedlings were needle-inoculated and scored for lesion development [42]. Bacterial genomic DNA was extracted seven days post-inoculation (dpi) from the infected leaf material. Likewise, maize seeds were imbibed with bacterial suspension (200 μL per seed) for six hours. Seeds were allowed to dry at room temperature and stored at 4 °C until further use. Five infected seeds were rehydrated in 800 μL sterile water for four hours and macerated for DNA extraction for RPA analysis. Serial dilutions of P. stewartii subsp. stewartii cultures (1 × 108 to 1 × 102 CFU mL−1 were used for inoculation of leaf and seed tissue for validating RPA assay sensitivity for bacterial titer detection.

2.4. RPA Primer/Exo Probe Design and Assay

RPA primers (Figure 1) were designed to be 30–35 nucleotides long without long runs of any one particular nucleotide or a large number of small repeats, 30–70% guanine–cytosine (GC) content, and yielding 80–400 bp amplicons [24]. Likewise, the exo probe (Figure 1) was designed manually to have the following characteristics when possible: 30–70% guanine–cytosine (GC) content, avoiding runs of more than four identical nucleotides and secondary structures with a melting temperature (Tm) between 37 and 42 °C. The exo probe is a long oligonucleotide (46–52 bases) with 30 and 15 nucleotides placed at 5′ and 3′, respectively, to an internal base analog tetrahydrofuran (THF). THF is located between a fluorophore 5(6)-carboxyfluorescein (FAM) and a quencher (e.g., Black Hole Quencher 1 or Black Hole Quencher 2) with a blocked 3′ end (such as 3′ phosphate group or dideoxy nucleotide). All the primers and probes were purchased from Beijing Genomics Institute (BGI Group, Shenzhen, China).
RPA reactions were performed in 50  μL volume using the DNA Isothermal Rapid Amplification Kit from Amplification Future (Changzhou) Biotechnology Co., Ltd., Changzhou, China. Two microliters of RPA primers (forward and reverse; 10  μM), 0.6  μL of exo probe (10  μM), and 11.4 μL of nuclease-free H2O were mixed with 29.4  μL of rehydration buffer A to make the master mix. The master mix was distributed into 0.2 mL reaction tubes containing the lyophilized RPA enzyme powder. Next, 2  μL of template DNA was pipetted into the reaction tubes. The internal and blank control templates were treated in parallel. Finally, 2.5 μL of 280  mM magnesium acetate (Buffer B) was added to each tube. The reactions were gently mixed and centrifuged briefly. The tubes were immediately placed in a portable isothermal nucleic acid detection system (Isothermal Fluorescence Detector WL-16-III; Amplification Future, Changzhou, China). The fluorescence signal was collected via the FAM channel every 30 s for 20 min (end-point reading) at 37 °C in real-time which increased markedly with successful amplification. For the RPA assay, using artificially infected leaf or seed material, 13.4 μL of DNA extract was used in the reaction mix.

2.5. RPA/Lateral Flow Dipstick (LFD) Assay for On-Site Detection of P. stewartii subsp. stewartii

LFD assay probes were marked by FAM at the 5′ end and THF as the E. coli endonuclease IV (nfo) target in the middle with a blocked 3′ end. The RPA reaction components were mixed as detailed above and incubated at 39 °C in a water bath for 10 min. Alternatively, in the field, app. four cm2 leaf tissues with lesions were coarsely macerated by hand in a plastic bag containing 1 mL of sterile water. Ten microliters of crude extract was mixed with the RPA reaction and the tubes were incubated in closed palm at body temperature. A total of 50 μL of RPA product was applied to the receptacle of a portable lateral flow device (Amplification Future, Changzhou, China) containing two different detection lines coupled with one positive control line to enable specific detection of FAM-labeled amplicons visible to the unaided eye within 10 min.

3. Results

3.1. Validation of Unique Primer Sets for Detection of P. stewartii subsp. stewartii

Twelve novel and unique primer sets for specific detection of the genus P. stewartii subsp. stewartii strain DC283 (reference strain, GeneBank acc. no. GCA_000248395.2) were designed (Table 2) for partial amplification of genes encoding the methyl-accepting chemotaxis protein (DSJ_RS03345), UDP-glucose 4-epimerase (UGE; EC:5.1.3.2) (gale; DSJ_RS16255), glutamine:fructose-6-phosphate aminotransferase (GFAT; EC:2.6.1.16) (DSJ_RS02230), DNA-directed RNA polymerase subunit beta (rpoB; DSJ_RS01980), and the intergenic spacer region between capsular polysaccharide genes cpsA (DSJ_RS16295) and cpsB (DSJ_RS16315). These genomic regions were identified through comparative genomic analyses and in silico validation for query coverage and % identity. Initial specificity tests were performed with endpoint PCR (Figure 2, Table 3). However, only the primer pair CLL001F/R targeted against the cpsA/cpsB intergenic spacer region yielded specific and unambiguous amplification products for all the tested P. stewartii subsp. stewartii strains (LX-2-8.19, ATCC 8199, ATCC 8200, ATCC 29227, ATCC 29228, and DC283) without any false positive or negative amplification data (Figure 2A). The end-point PCR assay was evaluated using twenty-six bacterial strains, representing five P. stewartii subsp. stewartii, four P. stewartii subsp. indologenes and seventeen other related bacteria isolated from the same niche. Similar amplification results were obtained for pure bacterial cultures and naturally or artificially infected host tissues. The remaining 11 primer sets amplified genomic DNA from other related bacterial strains precluding their utility for specific identification of P. stewartii subsp. stewartii. For example, the primer set MDC283galE/DC283galEc showed amplification for all the tested strains of P. stewartii subsp. stewartii as well as for P. stewartii subsp. indologenes strains ATCC 35396 and 4270-6, P. stewartii strains 4270-4 and 1082-3, P. cypripedii strain ICMP 1591, and P. ananatis strain DSM 30070 (Figure 2B).

3.2. Optimization of Simplex RPA Assay for Detection of P. stewartii subsp. stewartii

PCR-validated specific primers and an exo probe (CL001-PIexo) (Table 2) designed against the cpsA/cpsB intergenic spacer region were further evaluated for optimization of a simplex RPA assay for the detection of P. stewartii subsp. stewartii. To this end, genomic DNA isolated from the cultured P. stewartii subsp. stewartii strain DC283 was used as the positive control and sterile water as the negative control. To determine the optimal reaction temperature of the RPA assay, the reactions were performed at various temperatures between 37 and 42 °C for 20 min, and the amplicons were monitored using a portable fluorescence detector. The optimum RPA reaction temperature was found to be 37 °C. Higher incubation temperatures had no discernible effect on the amplification reaction. The DNA extracted from sequence-verified P. stewartii subsp. stewartii strain LX-2-8.19 routinely gave positive amplification curves [threshold time, TT(F) =13–17 min]. In a representative experiment, the TT(F) values for P. stewartii subsp. stewartii strains ATCC 8199, ATCC 8200, ATCC 29227, and ATCC 29228 were found to be 16.0, 10.8, 13.4, and 10.5 min, respectively. Under similar assay conditions, the P. stewartii subsp. stewartii RPA assay—the exo probe and primer set—amplified only the DNA extracted from the five strains of subsp. stewartii but not that from four P. stewartii subsp. indologenes strains or any other related bacterial species tested (Figure 3A–C).
The sensitivity of the RPA assay was evaluated using serially diluted template DNA of strain ATCC 29277 (5, 0.5, and 0.05 ng μL−1; 0.05, 0.005, and 0.0005 pg μL−1). Adequate amplification was observed at 37 °C within 20 min in a reaction containing as low as 0.0005 pg μL−1 target DNA [TT(F) value = 25.8 min] (Figure 3D). Symptomatic corn leaves from various locations in the field at Sanya (Hainan Province, South China) were collected for genomic DNA extraction and verified using end-point PCR amplification and sequencing. RPA amplification for P. stewartii subsp. stewartii strain LX-2 DNA was observed in a field population of naturally infected maize seedlings. The RPA assay was also able to detect P. stewartii subsp. stewartii ATCC 29277 in the leaves of artificially infected maize seedlings [TT(F) value = 19–30 min] (Figure 3E) as well as in the mature and desiccated maize kernels [TT(F) value = 18–26 min]. The detection sensitivity of the RPA assay in desiccated seeds was determined to be 1 × 102 CFU mL−1 (roughly equivalent to two bacterial cells) [TT(F) value = 26.1 min] (Figure 3F). Mock (sterile water)-inoculated leaves and seeds were used as negative controls in these experiments.

3.3. RPA/LFD Assay for Point-of-Need Detection of P. stewartii subsp. stewartii

Detection sensitivity of the P. stewartii subsp. Stewartii-specific RPA primers and probe (CL001-PII) (Table 2) were optimized using serially diluted genomic DNA of strain ATCC 29277. A detection limit of 0.0005 pg μL−1 target DNA [TT(F) value = 25.8 min, Figure 3D] was readily discernible using the integrated RPA/LFD assay (Figure 4A). The RPA/LFD assay was further optimized using the DNA extracted from artificially inoculated maize seedlings. The DNA that was extracted from artificially inoculated maize leaf lesions scored positive using the RPA/LFD assay for detection of P. stewartii subsp. stewartii strain ATCC 29277. Maize seeds were also artificially inoculated with a serially diluted pure culture of P. stewartii subsp. stewartii strain ATCC 29277 (1 × 108 to 1 × 102 CFU mL−1) and used for DNA extraction. Similar to the results obtained in the portable DNA fluorescence detection device, the RPA/LFD assay was able to detect the bacterial DNA at an inoculum density of 1 × 102 CFU mL−1 (Figure 4B).
The robustness of the RPA/LFD assay was evaluated for minimal sample processing and in-field applicability. The reactions were carried out using crude sap from the infected plants and incubated in the palm of a closed hand without employing additional equipment. DNA extracts from symptomatic corn leaves collected from the field that were previously confirmed positive for P. stewartii subsp. stewartii infection also tested positive in the RPA/LFD assay (Figure 4C). Likewise, the RPA probe/primer assay also amplified DNA in the crude plant extracts on the LFD device (Figure 4C). Neither positive results nor cross-amplification were observed when mock-inoculated tissues were tested. These results confirmed that the RPA/LFD assay can specifically detect the P. stewartii subsp. stewartii directly from infected plant material without DNA purification or any specialized equipment.

4. Discussion

First introduced in 2006 [23], RPA has lately become the molecular diagnostic tool of choice for rapid (results within 5–20 min), simple (requiring minimally processed test material, few and easy hands-on steps), specific (single-target copy number and single-nucleotide polymorphisms detection) and cost-effective (approximately 4.3 USD per test) identification of pathogens [24]. RPA-based diagnostic tools for several economically important phytopathogens have been developed in recent years [26,27,28,29,30,31,32,33,34,35,36,37,38,39,40]. However, production and mass availability of affordably priced RPA assays that carry the possibility of multiple detections through the analysis of a single sample remains the single most formidable challenge for phytopathogen diagnostics at the consumer level [43]. A ‘sample-in-answer-out’ device purifies and digitalizes SARS-CoV-2 RNA for reverse-transcriptase (RT) RPA-based pathogen detection in a fully automated manner [44]. Such technology integrating paper- or chip-based portable microfluidic devices and RPA workflow can be appropriately modified for detecting mixed infections in point-of-care and point-of-need testing. Likewise, CRISPR/Cas in combination with integrated RPA/LFD devices (Bio-SCAN; biotin-coupled specific CRISPR-based assay for nucleic acid detection) provide a highly convenient and amenable technology for the detection of specific alleles in breeding lines, transgenic events, and rapid detection of fungal and bacterial pathogens [45].
Species belonging to the genus Pantoea are ubiquitous across several ecological niches, making rapid identification of Pantoea at the species or infraspecies level extremely difficult. First reported on Long Island in New York State in 1897, Stewart’s wilt of corn has lately emerged in several other parts of the world including Canada, Mexico, Austria, Argentina, Bolivia, Italy, Poland, Romania, Russia, China, Korea, Malaysia, Thailand, and Vietnam [46]. Additionally, P. stewartii subsp. stewartii introductions in native environments—through contaminated seed or alternative non-host plant material—cannot be ruled out, making surveillance certification and phytosanitary restrictions an essential clause for international trading. Timely disease management requires rapid and accurate identification of the disease-causing pathogen and subsequent roguing of the infected plant material from the field, thereby limiting the spread of disease. A low-cost and robust identification is also paramount for plant product health testing facilities, especially in a resource-limited setup such as the quarantine regulation ports. In this study, we report a reliable, specific, and sensitive RPA assay for the detection of the plant-pathogenic genus Pantoea stewartii subsp. stewartii currently regulated in more than 100 countries [47]. Although nonpathogenic on corn, P. stewartii subsp. indologenes may occasionally be present on corn seeds of tropical or subtropical origin as part of the resident bacterial population [22], thus warranting facile taxonomic discrimination between the two subspecies. To the best of our knowledge, the RPA assay described here provides the first molecular diagnostic tool for rapid, sensitive, and highly specific subspecies-level detection of P. stewartii subsp. Stewartii discriminating it from the subsp. Indologenes. Currently, unambiguous identification of the two Pantoea stewartii subsp. Remains time-consuming and expensive, relying on step-down PCR-based SNP profiles and MALDI–TOF MS protein fingerprints [22].
Pathogenicity of P. stewartii subsp. stewartii is associated with the biosynthesis of stewartan EPS, which causes xylem occlusion, vascular streaking, bacterial oozing, and the characteristic wilting of sweet corn. The tripartite stewartan biosynthetic system consists of the 12-gene wceI cluster, wceII, and wceIII genes [48]. RPA primers and probes were designed from the intergenic spacer region present between the cpsA and cpsB genes of the wceI operon (Figure 1). The cpsA and cpsB genes encode a glycosyltransferase WceG and a periplasmic protein Wza, respectively, that are involved in the biosynthesis and export of EPS. Alignment of the intergenic sequence between the cpsA and cpsB genes of P. stewartii subsp. stewartii (strain DC283, GeneBank acc. no. GCA_000248395.2) and P. stewartii subsp. indologenes (strain LMG2632, GenBank Acc. No. JPKO01000031) revealed a 182-base-pair deletion in P. stewartii subsp. indologenes strain LMG2632 [47].
The RPA assay reported here provides the first proof-of-concept for molecular detection and diagnosis based on the amplification of a unique genomic region differentiating the pathogenic and quarantine agent P. stewartii subsp. stewartii from nonpathogenic subsp. indologenes. P. stewartii subsp. stewartii can be detected in real-time using a portable isothermal nucleic acid detection system or a lateral flow dipstick. The integrated RPA/LFD assay is also amenable to minimal sample processing and performs well with high sensitivity using crude extracts from infected plants and incubated in a closed hand under field conditions. Current efforts in the lab are directed towards optimizing a multiplex assay using a cocktail of primer/probes for taxonomic differentiation of various species of Pantoea complex posing significant agricultural concern. The applicability of such assays for in-field diagnosis and in resource-limited quarantine laboratories cannot be over-emphasized.

Author Contributions

Concept: W.Z. and H.W.; methodology and investigation: L.C. and Q.T.; data analysis: L.C., Q.T., Q.M., X.B., P.X., J.L., W.Z. and H.W.; supervision and funding support: W.Z.; writing and editing: L.C., W.Z. and H.W. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the National Key Research and Development Program grant (2021YFC2600602) and the project of Sanya Yazhou Bay Science and Technology City (SKJC-2022-PTDX-016) to WZ.

Institutional Review Board Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Suparyono; Pataky, J.K. Effect of disease onset and severity of Stewart’s and Goss’ wilt on sweet corn. Phytopathology 1986, 76, 1079. [Google Scholar]
  2. Kuhar, T.P.; Stivers-Young, L.J.; Hoffmann, M.P.; Taylor, A.G. Control of corn flea beetle and Stewart’s wilt in sweet corn with imidacloprid and thiamethoxam seed treatments. Crop Prot. 2002, 21, 25–31. [Google Scholar] [CrossRef]
  3. Suparyono; Pataky, J.K. Influence of host resistance and growth stage at the time of inoculation on Stewart’s wilt and Goss’ wilt development and sweet corn hybrid yield. Plant Dis. 1989, 73, 339–345. [Google Scholar] [CrossRef]
  4. Cui, D.; Huang, M.-T.; Hu, C.-Y.; Su, J.-B.; Lin, L.-H.; Javed, T.; Deng, Z.-H.; Gao, S.-J. First report of Pantoea stewartii subsp. stewartii causing bacterial leaf wilt of sugarcane in China. Plant Dis. 2021, 105, 1190. [Google Scholar] [CrossRef]
  5. Ibrahim, R.; Ismail, S.I.; Ina-Salwany, M.Y.; Zulperi, D. Biology, diagnostics, pathogenomics and mitigation strategies of jackfruit-bronzing bacterium Pantoea stewartii subspecies stewartii: What do we know so far about this culprit? Horticulturae 2022, 8, 702. [Google Scholar] [CrossRef]
  6. Choi, O.; Kim, J. Pantoea stewartii causing Stewart’s wilt on Dracaena sanderiana in Korea. J. Phytopathol. 2013, 161, 578–581. [Google Scholar] [CrossRef]
  7. Jeger, M.; Bragard, C.; Candresse, T.; Chatzivassiliou, E.; Dehnen-Schmutz, K.; Gilioli, G.; Grégoire, J.C.; Jaques Miret, J.A.; MacLeod, A.; Navajas-Navarro, M. EFSA Panel on Plant Health (EFSA PLH Panel): Pest categorization of Pantoea stewartii subsp. stewartii. EFSA J. 2018, 16, e05356. [Google Scholar] [PubMed]
  8. Coplin, D.L.; Majerczak, D.R.; Zhang, Y.; Kim, W.S.; Jock, S.; Geider, K. Identification of Pantoea stewartii subsp. stewartii by PCR and strain differentiation by PFGE. Plant Dis. 2002, 86, 304–311. [Google Scholar] [CrossRef]
  9. Bicudo, E.L.; Macedo, V.O.; Carrara, M.A.; Castro, F.F.; Rage, I.R. Nosocomial outbreak of Pantoea agglomerans in a pediatric urgent care center. Braz. J. Infect. Dis. 2007, 11, 281–284. [Google Scholar] [CrossRef] [PubMed]
  10. Delétoile, A.; Decré, D.; Courant, S.; Passet, V.; Audo, J.; Grimont, P.; Arlet, G.; Brisse, S. Phylogeny and identification of Pantoea species and typing of Pantoea agglomerans strains by multilocus gene sequencing. J. Clin. Microbiol. 2009, 47, 300–310. [Google Scholar] [CrossRef]
  11. Adeolu, M.; Alnajar, S.; Naushad, S.; Gupta, R.S. Genome-based phylogeny and taxonomy of the ‘Enterobacteriales’: Proposal for Enterobacterales ord. nov. divided into the families Enterobacteriaceae, Erwiniaceae fam. nov., Pectobacteriaceae fam. nov., Yersiniaceae fam. nov., Hafniaceae fam. nov., Morganellaceae fam. nov., and Budviciaceae fam. nov. Int. J. Syst. Evol. Microbiol. 2016, 66, 5575–5599. [Google Scholar]
  12. Walterson, A.M.; Stavrinides, J. Pantoea: Insights into a highly versatile and diverse genus within the Enterobacteriaceae. FEMS Microbiol. Rev. 2015, 39, 968–984. [Google Scholar] [CrossRef]
  13. Brady, C.; Venter, S.; Cleenwerck, I.; Vancanneyt, M.; Swings, J.; Coutinho, T. A FAFLP system for the improved identification of plant-pathogenic and plant-associated species of the genus Pantoea. Syst. Appl. Microbiol. 2007, 30, 413–417. [Google Scholar] [CrossRef]
  14. Brady, C.; Cleenwerck, I.; Venter, S.; Vancanneyt, M.; Swings, J.; Coutinho, T. Phylogeny and identification of Pantoea species associated with plants, humans and the natural environment based on multilocus sequence analysis (MLSA). Syst. Appl. Microbiol. 2008, 31, 447–460. [Google Scholar] [CrossRef] [PubMed]
  15. Lamka, G.L. Development of an immunosorbent assay for seed-borne Erwinia stewartii in corn seed. Phytopathology 1990, 81, 839–846. [Google Scholar] [CrossRef]
  16. Tambong, J.T.; Mwange, K.N.; Bergeron, M.; Ding, T.; Mandy, F.; Reid, L.M.; Zhu, X. Rapid detection and identification of the bacterium Pantoea stewartii in maize by TaqMan® real-time PCR assay targeting the cpsD gene. J. Appl. Microbiol. 2008, 104, 1525–1537. [Google Scholar] [CrossRef]
  17. Xu, R.; Chen, Q.; Robleh Djama, Z.; Tambong, J.T. Miniprimer PCR assay targeting multiple genes: A new rapid and reliable tool for genotyping Pantoea stewartii subsp. stewartii. Lett. Appl. Microbiol. 2010, 50, 216–222. [Google Scholar] [CrossRef]
  18. Wilson, W.J.; Wiedmann, M.; Dillard, H.R.; Batt, C.A. Identification of Erwinia stewartii by a ligase chain reaction assay. Appl. Environ. Microbiol. 1994, 60, 278–284. [Google Scholar] [CrossRef]
  19. Wensing, A.; Zimmermann, S.; Geider, K. Identification of the corn pathogen Pantoea stewartii by mass spectrometry of whole-cell extracts and its detection with novel PCR primers. Appl. Environ. Microbiol. 2010, 76, 6248–6256. [Google Scholar] [CrossRef] [PubMed]
  20. Mergaert, J.; Verdonck, L.; Kersters, K. Transfer of Erwinia ananas (synonym Erwinia uredovora) and Erwinia stewartii to the genus Pantoea emend. as Pantoea ananas (Serrano 1928) comb. nov. and Pantoea stewartii (Smith 1898) comb. nov., respectively, and description of Pantoea stewartii subsp. indologenes subsp. nov. Int. J. Syst. Bacteriol. 1993, 43, 162–173. [Google Scholar]
  21. Stumpf, S.; Kvitko, B.; Gitatitis, R.; Dutta, B. Isolation and characterization of novel Pantoea stewartii subsp. indologenes strains exhibiting center rot in onion. Plant Dis. 2018, 102, 727–733. [Google Scholar] [CrossRef] [PubMed]
  22. Gehring, I.; Wensing, A.; Gernold, M.; Wiedemann, W.; Coplin, D.L.; Geider, K. Molecular differentiation of Pantoea stewartii subsp. indologenes from subspecies stewartii and identification of new isolates from maize seeds. J. Appl. Microbiol. 2014, 116, 1553–1562. [Google Scholar] [CrossRef]
  23. Piepenburg, O.; Williams, C.H.; Stemple, D.L.; Armes, N.A. DNA detection using recombination proteins. PLoS Biol. 2006, 4, e204. [Google Scholar] [CrossRef] [PubMed]
  24. Daher, R.K.; Stewart, G.; Boissinot, M.; Bergeron, M.G. Recombinase polymerase amplification for diagnostic applications. Clin. Chem. 2016, 62, 947–958. [Google Scholar] [CrossRef] [PubMed]
  25. Babu, B.; Ochoa-Corona, F.M.; Paret, M.L. Recombinase polymerase amplification applied to plant virus detection and potential implications. Anal. Biochem. 2018, 546, 72–77. [Google Scholar] [CrossRef] [PubMed]
  26. Strayer-Scherer, A.; Jones, J.B.; Paret, M.L. Recombinase polymerase amplification assay for field detection of tomato bacterial spot pathogens. Phytopathology 2019, 109, 690–700. [Google Scholar] [CrossRef] [PubMed]
  27. Dai, T.; Hu, T.; Yang, X.; Shen, D.; Jiao, B.; Tian, W.; Xu, Y. A recombinase polymerase amplification-lateral flow dipstick assay for rapid detection of the quarantine citrus pathogen in China, Phytophthora hibernalis. PeerJ 2019, 7, e8083. [Google Scholar] [CrossRef]
  28. Hu, S.; Yan, C.; Yu, H.; Zhang, Y.; Zhang, C.-Q. Establishment of the recombinase polymerase amplification-lateral flow dipstick (RPA/LFD) detection technique for Fusarium oxysporum. Plant Dis. 2023. online ahead of print. [Google Scholar] [CrossRef]
  29. Ju, Y.; Li, C.; Shen, P.; Wan, N.; Han, W.; Pan, Y. Rapid and visual detection of Verticillium dahliae using recombinase polymerase amplification combined with lateral flow dipstick. Crop Prot. 2020, 136, 105226. [Google Scholar] [CrossRef]
  30. Lee, H.J.; Cho, I.S.; Ju, H.J.; Jeong, R.D. Rapid and visual detection of tomato spotted wilt virus using recombinase polymerase amplification combined with lateral flow strips. Mol. Cell. Probes 2021, 57, 101727. [Google Scholar] [CrossRef] [PubMed]
  31. Kalischuk, M.; Hendricks, K.; Hochmuth, R.; Freeman, J.; Roberts, P.D.; Paret, M. A portable recombinase polymerase amplification assay for the rapid detection of cucurbit leaf crumple virus in watermelon leaves and fruits. J. Plant Pathol. 2022, 104, 215–224. [Google Scholar] [CrossRef]
  32. Wang, T.M.; Yang, J.T. Visual DNA diagnosis of tomato yellow leaf curl virus with integrated recombinase polymerase amplification and a gold-nanoparticle probe. Sci. Rep. 2019, 9, 15146. [Google Scholar] [CrossRef] [PubMed]
  33. Jiao, Y.; Jiang, J.; An, M.; Xia, Z.; Wu, Y. Recombinase polymerase amplification assay for rapid detection of maize chlorotic mottle virus in maize. Arch. Virol. 2019, 164, 2581–2584. [Google Scholar] [CrossRef] [PubMed]
  34. Sharma, S.K.; Pathaw, N.; Wangkhem, B.; Jackson, K.S.; Devi, K.S.; Roy, S.S.; Singh, A.R.; Singh, R.; Banerjee, A.; Kumar, S.; et al. Simple template-based reverse transcription-recombinase polymerase amplification assay for routine diagnosis of citrus tristeza virus. Lett. Appl. Microbiol. 2023, 76, ovac060. [Google Scholar]
  35. Ju, Y.; Lin, Y.; Yang, G.; Wu, H.; Pan, Y. Development of recombinase polymerase amplification assay for rapid detection of Meloidogyne incognita, M. javanica, M. arenaria, and M. enterolobii. Eur. J. Plant Pathol. 2019, 155, 1155–1163. [Google Scholar] [CrossRef]
  36. Boluk, G.; Dobhal, S.; Crockford, A.B.; Melzer, M.; Alvarez, A.M.; Arif, M. Genome-informed recombinase polymerase amplification assay coupled with a lateral flow device for in-field detection of Dickeya species. Plant Dis. 2020, 104, 2217–2224. [Google Scholar] [CrossRef] [PubMed]
  37. Larrea-Sarmiento, A.; Stack, J.P.; Alvarez, A.M.; Arif, M. Multiplex recombinase polymerase amplification assay developed using unique genomic regions for rapid on-site detection of genus Clavibacter and C. nebraskensis. Sci. Rep. 2021, 11, 12017. [Google Scholar] [CrossRef] [PubMed]
  38. McCoy, A.G.; Miles, T.D.; Bilodeau, G.J.; Woods, P.; Blomquist, C.; Martin, F.N.; Chilvers, M.I. Validation of a preformulated, field deployable, recombinase polymerase amplification assay for Phytophthora species. Plants 2020, 9, 466. [Google Scholar] [CrossRef] [PubMed]
  39. Yu, J.; Shen, D.; Dai, T.; Lu, X.; Xu, H.; Dou, D. Rapid and equipment-free detection of Phytophthora capsici using lateral flow strip-based recombinase polymerase amplification assay. Lett. Appl. Microbiol. 2019, 69, 64–70. [Google Scholar] [CrossRef] [PubMed]
  40. Aiying, W.; Ju, L.; Cilin, W.; Yuxuan, H.; Baojun, Y.; Jian, T.; Shuhua, L. Establishment and application of the Recombinase-Aided Amplification-Lateral Flow Dipstick detection method for Pantoea ananatis on rice. Australas. Plant Pathol. 2023, 52, 283–291. [Google Scholar] [CrossRef] [PubMed]
  41. Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef] [PubMed]
  42. Bartholomew, H.P.; Reynoso, G.; Thomas, B.J.; Mullins, C.M.; Smith, C.; Gentzel, I.N.; Giese, L.A.; Mackey, D.; Stevens, A.M. 2022. The transcription factor Lrp of Pantoea stewartii subsp. stewartii controls capsule production, motility, and virulence important for in planta growth. Front. Microbiol. 2022, 12, 806504. [Google Scholar] [CrossRef] [PubMed]
  43. Ovesná, J.; Kaminiaris, M.D.; Tsiropoulos, Z.; Collier, R.; Kelly, A.; De Mey, J.; Pollet, S. Applicability of smart tools in vegetable disease diagnostics. Agronomy 2023, 13, 1211. [Google Scholar] [CrossRef]
  44. Seder, I.; Coronel-Tellez, R.; Helalat, S.H.; Sun, Y. Fully integrated sample-in-answer-out platform for viral detection using digital reverse transcription recombinase polymerase amplification (dRT-RPA). Biosens. Bioelectron. 2023, 237, 115487. [Google Scholar] [CrossRef]
  45. Sánchez, E.; Ali, Z.; Islam, T.; Mahfouz, M. A CRISPR-based lateral flow assay for plant genotyping and pathogen diagnostics. Plant Biotechnol. J. 2022, 20, 2418–2429. [Google Scholar] [CrossRef] [PubMed]
  46. CABI. Pantoea stewartii (bacterial wilt of maize). In Crop Protection Compendium; CAB International: Wallingford, UK, 2018; Available online: https://www.cabi.org/cpc/ (accessed on 28 August 2023).
  47. Pal, N.; Block, C.C.; Gardner, C.A. A real-time PCR differentiating Pantoea stewartii subsp. stewartii from P. stewartii subsp. indologenes in corn deed. Plant Dis. 2019, 103, 1474–1486. [Google Scholar] [CrossRef] [PubMed]
  48. Roper, M.C. Pantoea stewartii subsp. stewartii: Lessons learned from a xylem-dwelling pathogen of sweet corn. Mol. Plant Pathol. 2011, 12, 628–637. [Google Scholar] [CrossRef] [PubMed]
Agriculture 13 01982 g001
Figure 1. Simplex RPA assay designed to specifically detect Pantoea stewartii subsp. stewartii. The primers CLL011-F/R and the exo probe CLL001-PIexo amplify the 256 bp intergenic spacer region between stewartan (EPS) biosynthesis genes cpsA (DSJ_RS16295) and cpsB (DSJ_RS16315) in RPA reaction. Probe CLL001-PII is used for detection of amplified products in an integrated RPA/LFD assay. THF, tetrahydrofuran residue; FAM, 5(6)-carboxyfluorescein; BHQ-1, Black Hole Quencher 1.
Figure 1. Simplex RPA assay designed to specifically detect Pantoea stewartii subsp. stewartii. The primers CLL011-F/R and the exo probe CLL001-PIexo amplify the 256 bp intergenic spacer region between stewartan (EPS) biosynthesis genes cpsA (DSJ_RS16295) and cpsB (DSJ_RS16315) in RPA reaction. Probe CLL001-PII is used for detection of amplified products in an integrated RPA/LFD assay. THF, tetrahydrofuran residue; FAM, 5(6)-carboxyfluorescein; BHQ-1, Black Hole Quencher 1.
Agriculture 13 01982 g001
Agriculture 13 01982 g002
Figure 2. Validation of primer specificity in an end-point PCR assay for the detection of Pantoea stewartii subsp. stewartii: (A,B) Representative gels showing PCR amplification products using primer pairs CLL01-F/R (256 bp) and MDC283galE/DC283galEc (268 bp). The bacterial strains used are P. stewartii subsp. stewartii (PSS) strains DC283, LX-2-8.19, ATCC 8199, ATCC 8200, ATCC 29227, and ATCC 29228, P. stewartii subsp. indologenes (PSI) strains ATCC 35396 and 4270-6, P. stewartii (PS) strain 4270-4 and 1082-3, P. agglomerans (PAG) strain 1848-Lin, P. ananatis (PAN) strain DSM 30070, P. cypripedii (PCY) strain ICMP 1591, Acidovorax avenae subsp. avenae (AVV) strain ATCC 19307, Burkholderia andropogonis (BAN) strain ATCC 23,060, B. cepacia (BCE) strain LMG 1222, Clavibacter michiganensis subsp. nebraskensis (CMN) strain NCPPB 2578, Dickeya chrysanthemi (DCH) strain ICMP 10850, Pseudomonas syringae pv. syringae (PSP) strain LMG 5083. Note that the primer pair CL001-F/R amplifies the intergenic spacer region between cpsA and cpsB specifically for all the tested strains of P. stewartii subsp. stewartii.
Figure 2. Validation of primer specificity in an end-point PCR assay for the detection of Pantoea stewartii subsp. stewartii: (A,B) Representative gels showing PCR amplification products using primer pairs CLL01-F/R (256 bp) and MDC283galE/DC283galEc (268 bp). The bacterial strains used are P. stewartii subsp. stewartii (PSS) strains DC283, LX-2-8.19, ATCC 8199, ATCC 8200, ATCC 29227, and ATCC 29228, P. stewartii subsp. indologenes (PSI) strains ATCC 35396 and 4270-6, P. stewartii (PS) strain 4270-4 and 1082-3, P. agglomerans (PAG) strain 1848-Lin, P. ananatis (PAN) strain DSM 30070, P. cypripedii (PCY) strain ICMP 1591, Acidovorax avenae subsp. avenae (AVV) strain ATCC 19307, Burkholderia andropogonis (BAN) strain ATCC 23,060, B. cepacia (BCE) strain LMG 1222, Clavibacter michiganensis subsp. nebraskensis (CMN) strain NCPPB 2578, Dickeya chrysanthemi (DCH) strain ICMP 10850, Pseudomonas syringae pv. syringae (PSP) strain LMG 5083. Note that the primer pair CL001-F/R amplifies the intergenic spacer region between cpsA and cpsB specifically for all the tested strains of P. stewartii subsp. stewartii.
Agriculture 13 01982 g002
Agriculture 13 01982 g003
Figure 3. Simplex RPA assay for the detection of Pantoea stewartii subsp. stewartii. Amplification curves for RPA reactions incubated at 37 °C displayed using a portable isothermal nucleic acid detection system. Primer pair (CL001-F/R) and exo probe (CL001-PIexo) for amplification of cpsA and cpsB intergenic spacer region were used: (A) Amplification curves were observed for P. stewartii subsp. stewartii (PSS) strains ATCC 8199, ATCC 8200, ATCC 29227, and ATCC 29228. DNA extracted from P. stewartii subsp. indologenes (PSI) strains ATCC 35396 and 4270-6, and P. stewartii (PS) strains 4270-4 and 1082-3 did not yield any amplification; (B,C) DNA extracted from P. agglomerans (PAG) strain 1848-Lin, P. ananatis (PAN) strain DSM 30070, P. cypripedii (PCY) strain ICMP 1591, Acidovorax avenae subsp. avenae (AVV) strain ATCC 19307, Burkholderia andropogonis (BAN) strain ATCC 23060, B. cepacia (BCE) strain LMG 1222, B. gladioli (BGL) strain NCPPB 1888, Clavibacter michiganensis subsp. nebraskensis (CMN) strain NCPPB 2578, Dickeya chrysanthemi (DCH) strain ICMP 10850, Pseudomonas syringae pv. syringae (PSP) strain LMG 5083, Xanthomonas albilineans (XAL) strain ICMP 196, X. axonopodis pv. vasculorum (XAV) strain ATCC 13091 did not yield amplification curves. PSS strain LX-2-8.19 represents the positive control; (D–F) DNA amplification curves for PSS strain ATCC 29227 using serially diluted genomic DNA (D), artificially inoculated maize seedlings (E), and desiccated seeds (F), respectively. Genomic DNA extracted from pure culture of PSS strain ATCC 29227 was used as the positive control, and sterile water as the negative control. Maize seeds were imbibed in serially diluted bacterial cultures and their crude extracts were assayed for bacterial infection.
Figure 3. Simplex RPA assay for the detection of Pantoea stewartii subsp. stewartii. Amplification curves for RPA reactions incubated at 37 °C displayed using a portable isothermal nucleic acid detection system. Primer pair (CL001-F/R) and exo probe (CL001-PIexo) for amplification of cpsA and cpsB intergenic spacer region were used: (A) Amplification curves were observed for P. stewartii subsp. stewartii (PSS) strains ATCC 8199, ATCC 8200, ATCC 29227, and ATCC 29228. DNA extracted from P. stewartii subsp. indologenes (PSI) strains ATCC 35396 and 4270-6, and P. stewartii (PS) strains 4270-4 and 1082-3 did not yield any amplification; (B,C) DNA extracted from P. agglomerans (PAG) strain 1848-Lin, P. ananatis (PAN) strain DSM 30070, P. cypripedii (PCY) strain ICMP 1591, Acidovorax avenae subsp. avenae (AVV) strain ATCC 19307, Burkholderia andropogonis (BAN) strain ATCC 23060, B. cepacia (BCE) strain LMG 1222, B. gladioli (BGL) strain NCPPB 1888, Clavibacter michiganensis subsp. nebraskensis (CMN) strain NCPPB 2578, Dickeya chrysanthemi (DCH) strain ICMP 10850, Pseudomonas syringae pv. syringae (PSP) strain LMG 5083, Xanthomonas albilineans (XAL) strain ICMP 196, X. axonopodis pv. vasculorum (XAV) strain ATCC 13091 did not yield amplification curves. PSS strain LX-2-8.19 represents the positive control; (D–F) DNA amplification curves for PSS strain ATCC 29227 using serially diluted genomic DNA (D), artificially inoculated maize seedlings (E), and desiccated seeds (F), respectively. Genomic DNA extracted from pure culture of PSS strain ATCC 29227 was used as the positive control, and sterile water as the negative control. Maize seeds were imbibed in serially diluted bacterial cultures and their crude extracts were assayed for bacterial infection.
Agriculture 13 01982 g003
Agriculture 13 01982 g004
Figure 4. Simplex RPA/LFD assay for the detection of Pantoea stewartii subsp. stewartii. Primer pair (CL001-F/R) and probe (CL001-PII) were used for the amplification of cpsA and cpsB intergenic spacer region. LFD Nucleic Acid Detector allows the detection of FAM-labeled P. stewartii subsp. stewartii amplicons: (A) Serially diluted genomic DNA of P. stewartii subsp. stewartii strain ATCC 29227 was used as template for the RPA reaction; (B) RPA template DNA was extracted from maize seeds that were artificially infected using a serially diluted pure culture of P. stewartii subsp. stewartii strain ATCC 29227; (C) In-field RPA/LFD assay showing DNA amplification from template DNA extracted from field samples (leaf #1 and #2) or from crude leaf extracts (leaf #3 and #4). The RPA reactions were incubated at 37 °C in a water bath (A,B) and in a closed hand at body temperature (C). NTC, no template control.
Figure 4. Simplex RPA/LFD assay for the detection of Pantoea stewartii subsp. stewartii. Primer pair (CL001-F/R) and probe (CL001-PII) were used for the amplification of cpsA and cpsB intergenic spacer region. LFD Nucleic Acid Detector allows the detection of FAM-labeled P. stewartii subsp. stewartii amplicons: (A) Serially diluted genomic DNA of P. stewartii subsp. stewartii strain ATCC 29227 was used as template for the RPA reaction; (B) RPA template DNA was extracted from maize seeds that were artificially infected using a serially diluted pure culture of P. stewartii subsp. stewartii strain ATCC 29227; (C) In-field RPA/LFD assay showing DNA amplification from template DNA extracted from field samples (leaf #1 and #2) or from crude leaf extracts (leaf #3 and #4). The RPA reactions were incubated at 37 °C in a water bath (A,B) and in a closed hand at body temperature (C). NTC, no template control.
Agriculture 13 01982 g004
Table 1. Bacterial strains used in this study.
Table 1. Bacterial strains used in this study.
Bacterial Species/StrainRepository aType Strain GenBank Acc. No. (Genome Size)
Pantoea stewartii subsp. stewartii
LX-2-8.19 Field isolate, Sanya, ChinaDC283 (GCA_000248395.2, 5 Mb)
ATCC 8199ATCC
ATCC 29227ATCC
ATCC 8200ATCC
ATCC 29228ATCC
Pantoea stewartii subsp. indologenes
ATCC 35396ATCCLMG 2632 (GCA_000757405.2, 4.7 Mb)
4270-6 Guangzhou Customs, China
Pantoea stewartii
4270-4 Guangzhou Customs, China ZJ-FGZX1 (GCA_011044475.1, 5 Mb)
1082-3 Guangzhou Customs, China
Pantoea agglomerans 1848-Lin Guangzhou Customs, China ZJU23 (GCA_021559955.1, 5.1 Mb)
Pantoea ananatis DSM 30070 DSMZLMG 5342 (GCA_000283875.1, 4.9 Mb)
Pantoea cypripedii ICMP 1591 ICMPLMG 2657 (GCA_002095535.1, 6.6 Mb)
Acidovorax avenae subsp. avenae ATCC 19307ATCCAA81_1 (GCA_003029685.1, 5.8 Mb)
Burkholderia andropogonis ATCC 23060ATCCBa3549 (GCA_000566705.1, 6.2 Mb)
Burkholderia cepacia LMG 1222LMGBC16 (CA_009586235.1, 3.4 Mb)
Burkholderia gladioli NCPPB 1888 NCPPB BBB-01 (GCA_016698705.1, 8.2 Mb)
Clavibacter michiganensis subsp. nebraskensis NCPPB 2578 NCPPB61-1 (GCA_009739635.2, 3.1 Mb)
Dickeya chrysanthemi ICMP 10850ICMPEch1591 (GCA_000023565.1, 4.8 Mb)
Pectobacterium atrosepticum NCPPB 549 NCPPBJG10-08 (GCA_000696465.1, 5.0 Mb)
Pectobacterium carotovorum subsp. carotovorum 2412-1 Field isolate, Sanya, ChinaPCCS1 (GCA_015277635.1, 4.9 Mb)
Pseudomonas fluorescens LX-2 Field isolate, Sanya, China2P24 (GCA_002865505.1, 6.6 Mb)
Pseudomonas fuscovaginae NCPPB 3734 NCPPBCB98818 (GCA_000280575.1, 6.5 Mb)
Pseudomonas syringae pv. panici 2357-1Field isolate, Sanya, ChinaLMG 2367 (GCA_000282735.1, 6 Mb)
Pseudomonas syringae pv. syringae LMG 5083 LMG B48 (GCA_030035225.1, 6.1 Mb)
Xanthomonas albilineans ICMP196 ICMPXa-FJ1 (GCA_009931595.1, 3.8 Mb)
Xanthomonas axonopodis pv. vasculorum ATCC13901ATCCNCPPB 796 (GCA_013177355.1, 4.9 Mb)
a ATCC, American Type Culture Collection, Manassas, VA, USA; DSMZ, Deutsche Sammlung von Mikroorganismen und Zellkulturen, Braunschweig, Germany; ICMP, International Collection of Microorganisms from Plants, Aukland, New Zealand; LMG, Collection Laboratorium voor Microbiologie Universiteit Gent, Gent, Belgium; NCPPB, National Collection of Plant Pathogenic Bacteria, York, UK.
Table 2. Primers and probe sets used for the detection of Pantoea stewartii subsp. stewartii.
Table 2. Primers and probe sets used for the detection of Pantoea stewartii subsp. stewartii.
Primer/ProbeSequence (5′ → 3′)Amplicon (bp)Gene (GenBank Acc. No.)
AB inter F1TGGATTTTATGCTGTGGTACTATGAAAACGGT150methyl-accepting chemotaxis protein (mcp, DSJ_RS03345)
AB inter R1TTGAATAATAGGTAATCATTCTGTTTTGTCTGC
AB inter F2AAATGGATTTTATGCTGTGGTACTATGAAAAC150
AB inter R2AATAATAGGTAATCATTCTGTTTTGTCTGCACT
GalE F1GAATTCATTATCCGTGATTTTGCCAAAG304UDP-glucose 4-epimerase (gale, DSJ_RS16255)
GalE R1CTTTATAACCTTCAATTTTGTCCAGATGATC
GalE F2GATGGTCGAATTCATTATCCGTGATTTTG311
GalE R2TATAACCTTCAATTTTGTCCAGATGATCCAG
MDC283galECGACCTGTTTGCCTCTCACT268
DC283galEcCATCAGCTTGGAGGTGCCA
DC283galEAATATTACGAAAATAACGTTGC182
DC283galEcCATCAGCTTGGAGGTGCCA
p-g-FGGGATTCACGCGTTTCATTTATTTGATCTTGC165glutamine:fructose-6-phosphate amino transferase (gfat, DSJ_RS02230)
p-g-RTCATGCAAATATCCTCAGTCAACTCGCCAAAA
Pss F1TATTGATCGTATCCTCATTGTTGCTT189
Pss RGCGCTCTGGCTATATTGGGTTATTACGGCAC
Pss F2GCTGCAGGTTATTGATCGTATCCTCATTG195
Pss RGCGCTCTGGCTATATTGGGTTATTACGGCAC
EGaseUPGGCGGCGGTGAAAGAGTT453DNA-directed RNA polymerase subunit beta (rpoB, DSJ_RS01980)
EGaseNPGATGCACCGACGGAAACAA
cpsAB2313FAGAAAACGCTGATGCCAGAC375Intergenic spacer region between stewartan (EPS) biosynthesis genes cpsA (DSJ_RS16295) and cpsB (DSJ_RS16315)
cpsRACTATCCTGACTCAGGCACT
CLL001-FGGTAGAAAACGCTGATGCCAGACAGAACACCGTC256
CLL001-RAAGTAAACTATCCTGACTCAGGCACTGAACATG
CL001-PIexoGTACCACAGCATAAAATCCATTTATTCAACAAATC
[FAM-dT][THF]CA[BHQ1-dT] AAAAAAGCGGTACGGC [C3Spacer]
CL001-PIIFAM-TACCACAGCATAAAATCCATTTATTCAACAAATC [THF]CAAAAAAAGCGGTACGGC [C3Spacer]
Table 3. Amplification specificity of primers designed for the detection of Pantoea stewartii subsp. stewartii.
Table 3. Amplification specificity of primers designed for the detection of Pantoea stewartii subsp. stewartii.
Bacterial StrainsPrimer Pairs
AB Inter F1/R1AB Inter F2/R2GalE F1/R1GalE F2/R2MDC283galE
/DC283galEc		DC283galE
/DC283galEc		p-g-F/RPss F1/RPss F2/REGaseUP/NPcpsAB2313F
/cpsR		CL001-F/R
Pantoea stewartii subsp. stewartii LX-2-8.19
P. stewartii subsp. stewartii ATCC 8199
P. stewartii subsp. stewartii ATCC 8200
P. stewartii subsp. stewartii ATCC 29227
P. stewartii subsp. stewartii ATCC 29228
P. stewartii subsp. indologenes ATCC 35396
P. stewartii subsp. indologenes 4270-6
P. stewartii 4270-4
P. stewartii 1082-2
P. agglomerans 1848-Lin
P. ananatis DSM 30070
P. cypripedii ICMP 1591
Acidovorax avenae subsp. avenae ATCC 19307
Burkholderia andropogonis ATCC 23060
Burkholderia cepacia LMG 122
Burkholderia gladioli NCPPB1888
Clavibacter michiganensis subsp. nebraskensis NCPPB2578
Dickeya chrysanthemi ICMP10850
Pectobacterium atrosepticum NCPPB 549
Pectobacterium carotovorum subsp. carotovorum 2412-1
Pseudomonas fluorescens LX-2
Pseudomonas fuscovaginae NCPPB 3734
Pseudomonas syringae pv. panici 2357-1
Pseudomonas syringae pv. syringae LMG 5083
Xanthomonas albilineans ICMP196
Xanthomonas axonopodis pv. vasculorum ATCC 13901
Gray box, expected amplification product; White box, no amplification; Black box, ambiguous results.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Cai, L.; Tian, Q.; Meng, Q.; Bao, X.; Xu, P.; Liu, J.; Zhao, W.; Wang, H. Recombinase Polymerase Amplification Assay for Rapid Field Diagnosis of Stewart’s Wilt of Corn Pathogen Pantoea stewartii subsp. stewartii. Agriculture 2023, 13, 1982. https://doi.org/10.3390/agriculture13101982

AMA Style

Cai L, Tian Q, Meng Q, Bao X, Xu P, Liu J, Zhao W, Wang H. Recombinase Polymerase Amplification Assay for Rapid Field Diagnosis of Stewart’s Wilt of Corn Pathogen Pantoea stewartii subsp. stewartii. Agriculture. 2023; 13(10):1982. https://doi.org/10.3390/agriculture13101982

Chicago/Turabian Style

Cai, Lulu, Qian Tian, Qingqing Meng, Xiaoyang Bao, Peidong Xu, Ji Liu, Wenjun Zhao, and Hui Wang. 2023. "Recombinase Polymerase Amplification Assay for Rapid Field Diagnosis of Stewart’s Wilt of Corn Pathogen Pantoea stewartii subsp. stewartii" Agriculture 13, no. 10: 1982. https://doi.org/10.3390/agriculture13101982

APA Style

Cai, L., Tian, Q., Meng, Q., Bao, X., Xu, P., Liu, J., Zhao, W., & Wang, H. (2023). Recombinase Polymerase Amplification Assay for Rapid Field Diagnosis of Stewart’s Wilt of Corn Pathogen Pantoea stewartii subsp. stewartii. Agriculture, 13(10), 1982. https://doi.org/10.3390/agriculture13101982

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop