Next Article in Journal
A Large Benchmark Dataset for Individual Sheep Face Recognition
Next Article in Special Issue
Effect of Using Ensilaged Corn Wet Distillers’ Grains Plus Solubles (WDGS) as a Partial Replacement for Concentrated Feed for Wet Lot Fed Fatteners during Fattening on Growth Performance, Carcass Characteristics and Pork Quality
Previous Article in Journal
A Meta-Analysis Approach to Estimate the Effect of Cover Crops on the Grain Yield of Succeeding Cereal Crops within European Cropping Systems
Previous Article in Special Issue
Effectiveness of Information Acquisition via the Internet in Standardizing the Use of Antimicrobials by Hog Farmers: Insights from China
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of the Dietary Replacement of Soybean Oil with Rubber Seed Oil on the Growth Performance, Carcass Trait, and Status of Lipid Metabolism in Pekin Ducks

Key Laboratory of Feed Biotechnology of Ministry of Agriculture, Institute of Feed Research, Chinese Academy of Agricultural Sciences, Beijing 100081, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Agriculture 2023, 13(9), 1717; https://doi.org/10.3390/agriculture13091717
Submission received: 3 August 2023 / Revised: 26 August 2023 / Accepted: 28 August 2023 / Published: 30 August 2023
(This article belongs to the Special Issue Animal Nutrition and Productions: Series II)

Abstract

:
The objective of this study is to determine the effects of the dietary replacement of soybean oil (SO) with rubber seed oil (RSO) on the growth performance, carcass trait, and lipid metabolism in Pekin ducks. A total of 160 1-day-old Pekin ducks were randomly allocated to four experimental treatments and fed diets with different ratios of SO to RSO as follows: 3:0 (control), 2:1, 1:2, and 0:3. Dietary RSO supplementation had no effect on their growth performance; however, it significantly decreased the yield of abdominal fat (p < 0.05). As the dietary RSO increased, the plasma TG, CHO, LDL-C, and HDL-C contents of ducks decreased (p < 0.05). Additionally, the contents of total fat, triglycerides, and cholesterol in the liver and breast reduced in the ducks fed RSO diets (p < 0.05). Liver n-3 PUFA levels linearly increased (p < 0.05), while the n-6/n-3 PUFA ratios reduced with increasing RSO levels (p < 0.05). Moreover, dietary RSO supplementation resulted in decreased gene expressions of FABP1, ME1, SREBP1c, FASN, DGAT2, and HMGCR (p < 0.05), while there was an increased expression of the ABCA1 gene (p < 0.05) in the liver of the ducks. In conclusion, dietary RSO supplementation reduced fat deposition and enhanced n-3 PUFA levels without affecting the growth performance of Pekin ducks.

1. Introduction

In China, the shortage of feed ingredients has become an urgent problem, especially the scarcity of soybean resources, resulting in an inadequate supply of energy feeds. Consequently, this has become an important factor limiting livestock development [1]. Therefore, there is an urgent search for alternative resources to relieve the pressure of feed shortages. China is the largest producer and consumer of ducks in the world, and the duck industry has become an important part of the national economy. The characteristics of roughage tolerance and disease resistance in ducks make them ideal for consuming unconventional feed.
Rubber trees are widely distributed in tropical and subtropical areas, and their seeds are often discarded and not effectively exploited. Rubber seed oil (RSO) contains 26% unsaturated fatty acids and 57% polyunsaturated fatty acids (PUFAs), with the ratio of n-6/n-3 PUFAs being close to 2:1, and it is rich in flavonoid and phenolic compounds [2]. RSO has been used as a biofuel in previous studies; however, its potential as a functional plant oil for feed has been ignored [3]. In recent years, there have been some studies that showed that RSO as a feed lipid source was added to animal diets. For example, dietary RSO supplementation increased the content of n-3 PUFAs and had no negative effect on milk production in cows [4]. In our previous study, dietary RSO added to the feed of laying hens increased the DHA content and decreased the cholesterol content in eggs [5]. In addition, we also found that RSO exhibited anti-inflammatory and antioxidant properties, and it could alleviate the LPS-induced inflammatory response of RAW 267.4 macrophages [2], which were verified in laying hens [6]. Thus, we speculate that RSO has the potential to be an alternative resource to soybean oil for feeding ducks.
Recently, the increasing consumer demands for good food quality, driven by improved living standards, have led to the rising popularity of functional foods, such as those abundant in n-3 PUFAs. Studies have demonstrated that n-3 PUFAs can prevent cardiovascular diseases, such as hypertension and hyperlipidemia [7], promote nervous system development [8], and improve anti-inflammatory and antioxidant responses [9,10]. DHA, especially, plays a vital role in maintaining normal brain development and function [11]. In modern dietary structures, the intake of n-3 PUFAs by humans is limited [12]. The traditional way of obtaining n-3 PUFAs is mainly through the consumption of fish oil; however, it is limited because of its low yield and high price [5]. Previous studies showed that adding n-3 PUFA-enriched resources to animal diets resulted in an increase in n-3 PUFA content in animal products, such as linseed oil [13] and microalgae [14,15]. Since n-3 PUFA-enriched feed ingredients are scarce and expensive, searching for more suitable resources has become a hot topic. RSO contains more than 20% of n-3 PUFAs, which can not only be used as an energy feed but also as a potential resource for the production of n-3 PUFA foods. Therefore, our study evaluates the effects of the dietary replacement of soybean oil with RSO on the growth performance, carcass trait, and lipid metabolism status of Pekin ducks.

2. Materials and Methods

The Animal Ethics Committee of the Institute of Feed Research of Chinese Academy of Agricultural Sciences approved all the procedures for this experiment (FRI-CAAS-20220706). Crude RSO in this experiment was obtained from rubber seeds by cold pressing.

2.1. Animals, Diet, and Management

A total of 160 1-day-old Pekin ducks were randomly allocated into 4 groups, each including 4 replicates with 10 Pekin ducks per replicate. No significant difference in the initial weight was observed among the groups (p > 0.05) and all replicates were equally distributed in different spatial directions. The four experimental diets with different ratios of soybean oil (SO) to RSO were as follow: 3:0 (control), 2:1, 1:2, and 0:3. The experimental diets were formulated according to the NRC (1994) recommendations for starter (1 to 21 days) and grower ducks (22 to 42 days). The nutrient levels and fatty acid compositions of the experimental diets are shown in Table 1 and Table 2. The ducks were housed in single-layer cages with 10 birds per cage (170 cm × 70 cm × 50 cm) and were allowed to eat and drink freely. The temperature was kept at 32 °C from 1 to 7 days of age, and then gradually reduced to 25 °C at 21 days of age, after which it was kept constant and ambient humidity was maintained between 60% to 65%. Natural and artificial light were used in the duck house to provide 24 h of continuous light.

2.2. Data Collection and Sample Preparation

At 1, 21, and 42 days of age, after overnight fasting, the ducks were weighed in each replicate and the average body weight (BW) was calculated. The average daily feed intake (ADFI), average daily weight gain (ADG), and feed/gain (F/G) at 1 to 21, 22 to 42, and 1 to 42 days of age were corrected for mortality. At 42 days of age, two ducks from each replicate were randomly selected and blood was collected from a wing vein into heparin sodium-containing tubes, centrifuged at 3500 rpm for 10 min, then kept at −20 °C for further analysis. Thereafter, these ducks were euthanized by CO2 inhalation; then, the breast muscle, thigh muscle, abdominal fat, heart, liver, pancreas, spleen, thymus, and bursa were removed and weighed to calculate the carcass traits and relative organ weight (%, organ weight as a percentage of body weight). Subsequently, liver and breast samples were collected and frozen in liquid nitrogen, and then stored at −80 °C for further analysis.

2.3. Plasma Biochemical Parameters

The plasma biochemical parameters were determined with an automatic biochemical analyzer (Hitachi 7080, Tokyo, Japan), including total protein (TP), albumin (ALB), globulin (GLB), triglyceride (TG), total cholesterol (CHO), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), aspartate aminotransferase (AST), and alanine transaminase (ALT).

2.4. Liver and Breast Chemical Compositions

The dry matter of liver and breast samples was calculated by freeze-drying; then, the freeze-dried samples were added to chloroform–methanol (2:1, v/v) for total fat extraction [16]. About 1 g of tissue was homogenized in 9 mL of saline on ice, then the mixture was centrifuged at 3500 rpm for 10 min at 4 °C, and we extracted the supernatant for biochemical parameter analysis; the TG and CHO contents of the liver and breast were determined with commercial kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) the and results were expressed as mmol per mg total protein.

2.5. Liver Fatty Acid Profile

We used gas chromatography–mass spectrometry (GC-MS) to determine the liver fatty acid profile [5]. In brief, GC-MS was performed using Agilent 7890/5975C (Agilent, CA, USA) to detect the hepatic fatty acid profile. The sample was injected into the Agilent DB-WAX (30 m × 0.25 mm × 0.25 μm) column at a flow rate of 1.0 mL/min, and the carrier gas was helium. This was programmed for an initial temperature of 50 °C (3 min) to 220 °C (5 min) with a 10 °C/min increase. The standard curves were based on fatty acid standards from Sigma (St. Louis, MO, USA). The results are shown as the percentage (%) of each fatty acid in the total fatty acid.

2.6. Liver Gene Expression

Total RNA from the liver samples was extracted by an RNAiso Plus kit (Takara, Dalian, China), according to the manufacturer’s instructions, and the purity and concentration of the total RNA were determined by NanoDrop ND-2000 (Thermo Scientific, Madison, MA, USA) with an OD260/280 ratio of 1.8–2.0. The first strand cDNA was synthesized using equal amounts of total RNA and a Reverse Transcription cDNA Kit, and then stored at −80 °C for further analysis. The real-time PCR was performed in a CFX96™ Real-Time System (Bio-Rad, Hercules, CA, USA) using an SYBR Green Quantitative PCR kit, and the cycling conditions referred to previous reports [17]; the relative expression results of the target gene mRNA were calculated by the 2−ΔΔCt method [18]. The primer sequences for target and reference genes are shown in Table 3.

2.7. Statistical Analysis

The data were analyzed by one-way ANOVA and Duncan’s test using SAS9.4 software (SAS Institute Inc., Cary, NC, USA), and the results are expressed as means and SEM. The probability level of p < 0.05 for the multiple comparison results was considered to be statistically significant.

3. Results

3.1. Growth Performance and Carcass Traits

The growth performances (BW, ADFI, ADG, and F/G) of ducks were unaffected by the partial or complete substitution of SO with RSO (p > 0.05; Table 4). Compared to the control group, the abdominal fat percentage decreased in the 0:3 groups (p < 0.05; Table 5).

3.2. Plasma Biochemical Parameters

Compared to the control group, dietary supplementation with RSO decreased ALT activity and the contents of TG, CHO, HDL-C, and LDL-C in the plasma (p < 0.05; Table 6). However, there were no significant differences for TP, ALB, GLB, and AST levels (p > 0.05; Table 6).

3.3. Liver and Breast Chemical Composition

In this experiment, we found that RSO supplementation significantly decreased (p < 0.05; Table 7) the total fat level and CHO content in the liver and breast, and TG content decreased in the 0:3 group (p < 0.05; Table 7).

3.4. Liver Fatty Acid Profile

Compared with the control group, dietary RSO supplementation significantly increased n-3 PUFA levels (p < 0.05), especially a-linolenic (ALA), eicosapentaenoic acid (EPA), docosapentaenoic acid (DPA), and docosahexaenoic (DHA) contents, whereas it decreased n-6 PUFA levels and the n-6/n-3 PUFA ratio in the liver (p < 0.05). No statistical differences among the groups were found in C14:0, C16:0, C16:1, C18:0, C18:1, C20:2 N6, C20:3 N6, arachidonic acid (AA), saturated fatty acid (SFA), monounsaturated fatty acid (MUFA), and polyunsaturated fatty acid (PUFA) levels (p > 0.05; Table 8).

3.5. Liver Gene Expression

Figure 1 presents the mRNA expression of genes in the liver. The results show that RSO supplementation significantly decreases the expressions of liver ME1, FASN, DGAT2, HMGCR, and apoA-I genes (p < 0.05), while it increases ABCA1 mRNA expression (p < 0.05). Meanwhile, the mRNA expressions of FABP1 and SREBP1c genes decreased in the 1:2 and 0:3 groups.

4. Discussion

The shortage of conventional feed resources is a serious problem that China’s livestock farming is facing; therefore, searching for alternative resources has become an important research direction [1]. Some studies show that RSO as a non-conventional feed oil can be used for livestock and poultry, such as dairy cows [4] and laying hens [5,6]. Therefore, we attempted to evaluate the feasibility of the dietary replacement of soybean oil with RSO to feed Pekin ducks. In this study, dietary RSO supplementation had no negative effect on the growth performance of ducks. Carcass traits were considered to be the key indexes for evaluating animal performance. From the results of the carcass traits of Pekin ducks, it was observed that there were no significant differences in breast and thigh yields among the groups. However, abdominal fat percentage exhibited a significant decrease in the 0:3 group. Several studies also demonstrated similar results. Feeding broilers with high n-3 PUFA plant oils, such as linseed oil, led to a reduction in abdominal fat deposition and a decrease in abdominal fat weight [13,19]. For the experimental diets, as the level of RSO increased, the level of n-3 PUFA in the diet gradually increased. Thus, we speculated that the reduction in abdominal fat percentage may have been due to n-3 PUFA in RSO.
High triglyceride and high cholesterol contents in plasma are potentially dangerous to human health and are major risk factors for cardiovascular disease [9,20]. The effect of n-3 PUFA on blood lipid levels has been extensively studied in human clinical practice [20], and the hypolipidemic effect of n-3 PUFA has also been observed in broilers [14,19] and ducks [21,22]. In this study, TG and CHO contents in plasma were gradually decreased in the RSO group. Similar results were observed in the liver and breast. Dietary RSO supplementation significantly reduced the total fat, TG, and CHO contents. Li et al. [22] also reported a similar phenomenon where an increase in dietary n-3 PUFA levels led to a decrease in plasma TG and CHO contents, as well as reduced total fat in the liver and breast of ducks. Superfluous cholesterol at the intracellular level can be transferred to apolipoproteins by transporter proteins to form HDL-C, which is subsequently transported to the liver for metabolism [23]. However, the level of LDL-C in the blood is positively correlated with cardiovascular disease, and its increase is believed to increase the risk of atherosclerosis [21,24]. Ibrahim et al. [19] found that increasing n-3 PUFA levels in diets increased the HDL-C content in broiler plasma and decreased the LDL-C content. However, Huo et al. [25] reported that there were no obvious effects on the contents of HDL-C and LDL in the serum of broilers with increasing n-3 PUFA levels in their diets. In this study, dietary RSO supplementation reduced the LDL-C content in plasma; however, it also reduced the HDL-C content. Some reports also observed that increasing n-3 PUFA levels in the diets decreased the HDL-C content of plasma in ducks [21,22]. HDL-C works to transport cholesterol from the outside of the tissue and cells to the liver for further metabolism [26]. As shown in Table 6 and Table 7, dietary RSO supplementation significantly reduces total cholesterol in the plasma, breast, and liver; thus, we speculated that HDL-C reduction was associated with total cholesterol reduction. The levels of AST and ALT in the liver are crucial for maintaining normal metabolism levels, and high AST and ALT activities in the plasma indicate liver injury [27]. Previous studies found that RSO was also rich in flavonoids and phenols in addition to n-3 PUFAs, which can all help alleviate the inflammatory response of RAW 267.4 macrophages induced by LPS [2], and a decrease in AST activity in plasma was observed in the LPS-induced inflammatory response of laying hens [6]. In this experiment, the dietary supplementation of RSO reduced ALT activity in the plasma, suggesting that RSO may alleviate liver injury induced by the vigorous metabolism of ducks, leading to oxidative stress and inflammatory reactions.
Normally, the fatty acid profile of animals is influenced by the type of fatty acid in their diets [28]. Li et al. [22] found that the n-3 PUFA level and n-6/n-3 PUFA ratio were significantly correlated with the dietary n-6/n-3 PUFA ratio in the liver of ducks. Wen et al. [5] revealed that dietary RSO supplementation promoted the deposition of n-3 PUFAs in eggs and reduced the n-6/n-3 PUFA ratio. In this experiment, as RSO supplementation increased, dietary n-3 PUFA level (mainly ALA) increased and the n-6/n-3 PUFA ratio decreased in the liver (Table 8). Similarly, the level of n-3 PUFAs in liver significantly increased, while the n-6 PUFA level and n-6/n-3 PUFA ratio significantly decreased in the RSO groups, which was consistent with the previous reports. Animals can convert ALA to n-3 long-chain PUFAs (EPA and DHA) in vivo with the involvement of fatty acid desaturases and elongases, and this conversion is closely related to the ALA substrate concentration [29,30]. In this study, liver EPA, DPA, and DHA contents gradually increased with increasing dietary RSO supplementation. Overall, the results show that RSO is an effective plant oil to change the fatty acid profile, and dietary RSO supplementation can increase n-3 PUFA levels, such as ALA, EPA, DPA, and DHA, in Pekin ducks.
In the present study, we found that dietary RSO supplementation reduced triglyceride and cholesterol levels in the liver, plasma, and breast, whereas lipid synthesis and metabolism primarily occurred in the liver, from which lipids were transported to tissues and cells via the blood; therefore, we examined the expression of lipid metabolism genes in the liver. FABP1 is specifically expressed in the liver to transfer fatty acids to the endoplasmic reticulum to synthesize triglycerides [31]. ME1 encodes a cytosolic enzyme to produce NADPH for fatty acid biosynthesis, and its reduced expression inhibited NADPH production, thereby reducing fatty acid production [32]. SREBP1c is a crucial postprandial lipogenic transcription factor that regulates fatty acid synthesis and is increased in the liver of obese animals [33]. FASN is a key enzyme in fat synthesis, regulates the Novo synthesis of palmitic acid, and is the basis of long-chain fatty acid synthesis [34]. DGAT2 is a rate-limiting enzyme that catalyzes the process of diacylglycerols transforming into triglycerides [35]. As shown in Figure 1, we can observe that the gene expressions of FABP1, ME1, SREPB1c, FASN, and DGAT2 decrease with increasing dietary RSO levels. Therefore, we speculated that the low TG levels in the RSO group may have occurred due to reduced fatty acid synthesis in the liver. HMGCR is a rate-limiting enzyme in the endogenous cholesterol synthesis pathway of acetyl-CoA in the liver [36]. HDL-C is deemed to promote reverse cholesterol transport, which removes excess cholesterol from the cells outside the liver to transport it to the liver for metabolism [26]. ABCA1 is a crucial regulator of cholesterol export to lipid-free apolipoprotein A-I resulting in the formation of nascent HDL-C, and also shows positive effects on immunity and inflammatory responses [37]. In this study, we found that HMGCR expression decreased, while ABCA1 increased as a dietary RSO level. However, apoA-I relative expression decreased with the addition of dietary RSO. The expression of these genes indicated that dietary RSO reduced cholesterol synthesis in the liver and promoted reverse cholesterol transport to the liver. The possible reason for the reduction in apoA-I expression can be attributed to a decrease in extracellular cholesterol levels in the liver, thereby reducing the requirement for additional apoA-I to facilitate cholesterol transfer. In brief, the data indicate that dietary RSO supplementation reduces triglyceride and cholesterol levels in ducks by reducing liver lipid synthesis and improving reverse cholesterol transport to the liver, finally reducing abdominal fat deposits. In this study, we did not consider the differences in the energy values and metabolizable energy between SO and RSO in the ducks. However, the metabolizable energy of plant seed oil for poultry was stable range in 35.02~36.83 MJ/kg according to CHINESE FEED DATABASE. Therefore, we speculated that the metabolizable energy of RSO and SO with similar. Further research is required to determine the optimal replacement of RSO and the lipid-lowering pathway of RSO in ducks.

5. Conclusions

In conclusion, the dietary replacement of soybean oil with RSO had no negative effect on the ducks’ growth performance; however, it reduced triglyceride and cholesterol levels by decreasing liver lipid synthesis and improving reverse cholesterol transport, and reduced the abdominal fat percentage. Meanwhile, dietary RSO could also enrich n-3 PUFAs in the Pekin ducks. These results contribute to a better understanding of the application of RSO in duck feed, as well as its value as n-3 PUFA-enriched feed ingredient.

Author Contributions

Z.Z. and Y.G. performed the experimental work and created the experimental design, data analysis, and writing—original draft. Z.Z., Y.G., L.Z., J.L. and Z.W. (Zhanyue Wu) performed the feeding experiment on ducks and determined the main experiments. Y.W., J.C. and Z.W. (Zhiguo Wen) performed, reviewed, and edited the manuscript. Z.W. (Zhiguo Wen) had primary responsibility for the final content. All authors have read and agreed to the published version of the manuscript.

Funding

This work was funded by the National Key R&D Program of China (2022YFD1301800), the China Agriculture Research System of MOF and MARA (CARS-42-10), and the Science and Technology Innovation Project of Chinese Academy of Agricultural Sciences (CAAS-ASTIP-2023-IFR-13).

Institutional Review Board Statement

The experimental procedures were approved by the Animal Management Committee from the Institute of Feed Research of Chinese Academy of Agricultural Sciences (FRI-CAAS-20220820).

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Bai, Z.; Ma, W.; Ma, L.; Velthof, G.L.; Wei, Z.; Havlik, P.; Oenema, O.; FLee, M.R.F.; Zhang, F. China’s livestock transition: Driving forces, impacts, and consequences. Sci. Adv. 2018, 4, 8534. [Google Scholar] [CrossRef]
  2. Liu, J.; Zhao, L.; Cai, H.; Zhao, Z.; Wu, Y.; Wen, Z.; Yang, P. Antioxidant and Anti-Inflammatory Properties of Rubber Seed Oil in Lipopolysaccharide-Induced RAW 267.4 Macrophages. Nutrients 2022, 14, 1349. [Google Scholar] [CrossRef]
  3. Ahmad, J.; Yusup, S.; Bokhari, A.; Kamil, R.N.M. Study of fuel properties of rubber seed oil based biodiesel. Energy Convers. Manag. 2014, 78, 266–275. [Google Scholar] [CrossRef]
  4. Pi, Y.; Gao, S.T.; Ma, L.; Zhu, Y.X.; Wang, J.Q.; Zhang, J.M.; Xu, J.C.; Bu, D.P. Effectiveness of rubber seed oil and flaxseed oil to enhance the alpha-linolenic acid content in milk from dairy cows. J. Dairy. Sci. 2016, 99, 5719–5730. [Google Scholar] [CrossRef]
  5. Wen, Z.; Wu, Y.; Qi, Z.; Li, X.; Li, F.; Wu, X.; Yang, P. Rubber seed oil supplementation enriches n-3 polyunsaturated fatty acids and reduces cholesterol contents of egg yolks in laying hens. Food Chem. 2019, 301, 125198. [Google Scholar] [CrossRef]
  6. Liu, J.; Zhao, L.; Zhao, Z.; Wu, Y.; Cao, J.; Cai, H.; Yang, P.; Wen, Z. Rubber (Hevea brasiliensis) seed oil supplementation attenuates immunological stress and inflammatory response in lipopolysaccharide-challenged laying hens. Poult. Sci. 2022, 101, 102040. [Google Scholar] [CrossRef]
  7. Watanabe, Y.; Tatsuno, I. Prevention of Cardiovascular Events with Omega-3 Polyunsaturated Fatty Acids and the Mechanism Involved. J. Atheroscler. Thromb. 2020, 27, 183–198. [Google Scholar] [CrossRef] [PubMed]
  8. Yu, J.Z.; Wang, J.; Sheridan, S.D.; Perlis, R.H.; Rasenick, M.M. N-3 polyunsaturated fatty acids promote astrocyte differentiation and neurotrophin production independent of cAMP in patient-derived neural stem cells. Mol. Psychiatry 2021, 26, 4605–4615. [Google Scholar] [CrossRef]
  9. Tortosa-Caparros, E.; Navas-Carrillo, D.; Marin, F.; Orenes-Pinero, E. Anti-inflammatory effects of omega 3 and omega 6 polyunsaturated fatty acids in cardiovascular disease and metabolic syndrome. Crit. Rev. Food Sci. Nutr. 2017, 57, 3421–3429. [Google Scholar] [CrossRef] [PubMed]
  10. Abrescia, P.; Treppiccione, L.; Rossi, M.; Bergamo, P. Modulatory role of dietary polyunsaturated fatty acids in Nrf2-mediated redox homeostasis. Prog. Lipid Res. 2020, 80, 101066. [Google Scholar] [CrossRef] [PubMed]
  11. Zhang, T.T.; Xu, J.; Wang, Y.M.; Xue, C.H. Health benefits of dietary marine DHA/EPA-enriched glycerophospholipids. Prog. Lipid Res. 2019, 75, 100997. [Google Scholar] [CrossRef]
  12. Kutzner, L.; Esselun, C.; Franke, N.; Schoenfeld, K.; Eckert, G.P.; Schebb, N.H. Effect of dietary EPA and DHA on murine blood and liver fatty acid profile and liver oxylipin pattern depending on high and low dietary n6-PUFA. Food Funct. 2020, 11, 9177–9191. [Google Scholar] [CrossRef] [PubMed]
  13. Kalakuntla, S.; Nagireddy, N.K.; Panda, A.K.; Jatoth, N.; Thirunahari, R.; Vangoor, R.R. Effect of dietary incorporation of n-3 polyunsaturated fatty acids rich oil sources on fatty acid profile, keeping quality and sensory attributes of broiler chicken meat. Anim. Nutr. 2017, 3, 386–391. [Google Scholar] [CrossRef] [PubMed]
  14. Long, S.F.; Kang, S.; Wang, Q.Q.; Xu, Y.T.; Pan, L.; Hu, J.X.; Li, M.; Piao, X.S. Dietary supplementation with DHA-rich microalgae improves performance, serum composition, carcass trait, antioxidant status, and fatty acid profile of broilers. Poult. Sci. 2018, 97, 1881–1890. [Google Scholar] [CrossRef] [PubMed]
  15. Wu, Y.B.; Li, L.; Wen, Z.G.; Yan, H.J.; Yang, P.L.; Tang, J.; Xie, M.; Hou, S.S. Dual functions of eicosapentaenoic acid-rich microalgae: Enrichment of yolk with n-3 polyunsaturated fatty acids and partial replacement for soybean meal in diet of laying hens. Poult. Sci. 2019, 98, 350–357. [Google Scholar] [CrossRef]
  16. Folch, J.; Lees, M.; Stanley, G.H.S. A Simple Method for the Isolation and Purification of Total Lipides from Animal Tissues. J. Biol. Chem. 1957, 226, 497–509. [Google Scholar] [CrossRef]
  17. Wu, Y.; Tang, J.; Wen, Z.; Zhang, B.; Cao, J.; Zhao, L.; Guo, Z.; Xie, M.; Zhou, Z.; Hou, S. Dietary methionine deficiency stunts growth and increases fat deposition via suppression of fatty acids transportation and hepatic catabolism in Pekin ducks. J. Anim. Sci. Biotechnol. 2022, 13, 61. [Google Scholar] [CrossRef]
  18. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  19. Ibrahim, D.; El-Sayed, R.; Khater, S.I.; Said, E.N.; El-Mandrawy, S.A.M. Changing dietary n-6:n-3 ratio using different oil sources affects performance, behavior, cytokines mRNA expression and meat fatty acid profile of broiler chickens. Anim. Nutr. 2018, 4, 44–51. [Google Scholar] [CrossRef]
  20. Liu, Q.K. Triglyceride-lowering and anti-inflammatory mechanisms of omega-3 polyunsaturated fatty acids for atherosclerotic cardiovascular risk reduction. J. Clin. Lipidol. 2021, 15, 556–568. [Google Scholar] [CrossRef] [PubMed]
  21. Du, X.; Liu, Y.; Lu, L.; Wang, W.; Zeng, T.; Tian, Y.; Xu, X.; Shen, J.; Niu, D.; Lu, Y. Effects of dietary fats on egg quality and lipid parameters in serum and yolks of Shan Partridge Duck. Poult. Sci. 2017, 96, 1184–1190. [Google Scholar] [CrossRef]
  22. Li, M.; Zhai, S.; Xie, Q.; Tian, L.; Li, X.; Zhang, J.; Ye, H.; Zhu, Y.; Yang, L.; Wang, W. Effects of Dietary n-6:n-3 PUFA Ratios on Lipid Levels and Fatty Acid Profile of Cherry Valley Ducks at 15–42 Days of Age. J. Agric. Food Chem. 2017, 65, 9995–10002. [Google Scholar] [CrossRef]
  23. Luo, J.; Yang, H.; Song, B.L. Mechanisms and regulation of cholesterol homeostasis. Nat. Rev. Mol. Cell Biol. 2020, 21, 225–245. [Google Scholar] [CrossRef] [PubMed]
  24. Zhang, L.; Geng, Y.; Xiao, N.; Yin, M.; Mao, L.; Ren, G.; Zhang, C.; Liu, P.; Lu, N.; An, L.; et al. High Dietary n-6/n-3 PUFA Ratio Promotes HDL Cholesterol Level, but does not Suppress Atherogenesis in Apolipoprotein E-Null Mice 1. J. Atheroscler. Thromb. 2009, 75, 100997. [Google Scholar] [CrossRef] [PubMed]
  25. Huo, W.; Li, M.; Wang, J.; Wang, Z.; Huang, Y.; Chen, W. On growth performance, nutrient digestibility, blood T lymphocyte subsets, and cardiac antioxidant status of broilers. Anim. Nutr. 2019, 5, 68–73. [Google Scholar] [CrossRef] [PubMed]
  26. Pizzini, A.; Lunger, L.; Demetz, E.; Hilbe, R.; Weiss, G.; Ebenbichler, C.; Tancevski, I. The Role of Omega-3 Fatty Acids in Reverse Cholesterol Transport: A Review. Nutrients 2017, 9, 1099. [Google Scholar] [CrossRef]
  27. Han, C.; Wei, Y.; Wang, X.; Ba, C.; Shi, W. Protective effect of Salvia miltiorrhiza polysaccharides on liver injury in chickens. Poult. Sci. 2019, 98, 3496–3503. [Google Scholar] [CrossRef]
  28. Cui, X.Y.; Gou, Z.Y.; Abouelezz, K.F.M.; Li, L.; Lin, X.J.; Fan, Q.L.; Wang, Y.B.; Cheng, Z.G.; Ding, F.Y.; Jiang, S.Q. Alterations of the fatty acid composition and lipid metabolome of breast muscle in chickens exposed to dietary mixed edible oils. Animal 2020, 14, 1322–1332. [Google Scholar] [CrossRef]
  29. Brown, L.H.; Mutch, D.M. Mechanisms underlying N3-PUFA regulation of white adipose tissue endocrine function. Curr. Opin. Pharmacol. 2020, 52, 40–46. [Google Scholar] [CrossRef]
  30. Srinivas, V.; Molangiri, A.; Mallepogu, A.; Kona, S.R.; Ibrahim, A.; Duttaroy, A.K.; Basak, S. Maternal n-3 PUFA deficiency alters uterine artery remodeling and placental epigenome in the mice. J. Nutr. Biochem. 2021, 96, 108784. [Google Scholar] [CrossRef]
  31. Martin, G.G.; Landrock, D.; Chung, S.; Dangott, L.J.; Seeger, D.R.; Murphy, E.J.; Golovko, M.Y.; Kier, A.B.; Schroeder, F. Fabp1 gene ablation inhibits high-fat diet-induced increase in brain endocannabinoids. J. Neurochem. 2017, 140, 294–306. [Google Scholar] [CrossRef] [PubMed]
  32. Zhu, Y.; Gu, L.; Lin, X.; Liu, C.; Lu, B.; Cui, K.; Zhou, F.; Zhao, Q.; Prochownik, E.V.; Fan, C.; et al. Dynamic Regulation of ME1 Phosphorylation and Acetylation Affects Lipid Metabolism and Colorectal Tumorigenesis. Mol. Cell 2020, 77, 138–149.e135. [Google Scholar] [CrossRef] [PubMed]
  33. Jang, H.; Lee, G.Y.; Selby, C.P.; Lee, G.; Jeon, Y.G.; Lee, J.H.; Cheng, K.K.; Titchenell, P.; Birnbaum, M.J.; Xu, A.; et al. SREBP1c-CRY1 signalling represses hepatic glucose production by promoting FOXO1 degradation during refeeding. Nat. Commun. 2016, 7, 12180. [Google Scholar] [CrossRef] [PubMed]
  34. Gonzalez-Bohorquez, D.; Gallego Lopez, I.M.; Jaeger, B.N.; Pfammatter, S.; Bowers, M.; Semenkovich, C.F.; Jessberger, S. FASN-dependent de novo lipogenesis is required for brain development. Proc. Natl. Acad. Sci. USA 2022, 119, e2112040119. [Google Scholar] [CrossRef]
  35. Chitraju, C.; Walther, T.C.; Farese, R.V., Jr. The triglyceride synthesis enzymes DGAT1 and DGAT2 have distinct and overlapping functions in adipocytes. J. Lipid Res. 2019, 14, 1322–1332. [Google Scholar] [CrossRef] [PubMed]
  36. Lu, X.Y.; Shi, X.J.; Hu, A.; Wang, J.Q.; Ding, Y.; Jiang, W.; Sun, M.; Zhao, X.; Luo, J.; Qi, W.; et al. Feeding induces cholesterol biosynthesis via the mTORC1-USP20-HMGCR axis. Nature 2020, 588, 479–484. [Google Scholar] [CrossRef]
  37. Gelissen, I.C.; Harris, M.; Rye, K.A.; Quinn, C.; Brown, A.J.; Kockx, M.; Cartland, S.; Packianathan, M.; Kritharides, L.; Jessup, W. ABCA1 and ABCG1 synergize to mediate cholesterol export to apoA-I. Arter. Thromb. Vasc. Biol. 2006, 26, 534–540. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Effects of dietary replacement of soybean oil with rubber seed oil on hepatic lipid metabolism-related genes expression in Pekin ducks. Relative mRNA expressions of FABP1 (A), ME1 (B), SREBP1c (C), FASN (D), DGAT2 (E), HMGCR (F), ABCA1 (G), and apoA-I (H) genes normalized to β-actin, and expressed as a fold change in the control group. Different letters of a–d above bars mean statistically significant differences (p < 0.05) in different groups. Results are presented as means with plus error bars (n = 8).
Figure 1. Effects of dietary replacement of soybean oil with rubber seed oil on hepatic lipid metabolism-related genes expression in Pekin ducks. Relative mRNA expressions of FABP1 (A), ME1 (B), SREBP1c (C), FASN (D), DGAT2 (E), HMGCR (F), ABCA1 (G), and apoA-I (H) genes normalized to β-actin, and expressed as a fold change in the control group. Different letters of a–d above bars mean statistically significant differences (p < 0.05) in different groups. Results are presented as means with plus error bars (n = 8).
Agriculture 13 01717 g001
Table 1. Composition and nutrient levels of experimental diets for Pekin ducks (air-dry basis).
Table 1. Composition and nutrient levels of experimental diets for Pekin ducks (air-dry basis).
ItemsStarter Phase
(1 to 21 d)
Grower Phase
(22 to 42 d)
Ingredients (%)
Corn56.9064.05
Soybean meal33.0028.00
Wheat bran3.00
Oil3.004.00
CaHPO41.701.65
Limestone0.850.80
Salt0.300.30
DL-Methionine0.150.15
L-Lysine0.100.05
Premix 11.001.00
Total100.00100.00
Calculated values
ME (kcal/kg) 229253080
Crude protein (%) 320.2118.10
Calcium (%) 30.930.88
Total phosphorus (%)0.770.72
Available phosphorus (%)0.450.42
Methionine (%)0.450.43
Lysine (%)1.140.95
Methionine + Cysteine (%)0.790.74
Threonine (%)0.750.67
Tryptophan (%)0.230.20
Valine (%)0.920.83
Isoleucine (%)0.810.72
1 Supplied per kilogram of total diet: Cu, 10 mg; Fe, 60 mg; Zn, 60 mg; Mn, 80 mg; Se, 0.3 mg; I, 0.2 mg; choline chloride, 1000 mg; vitamin A, 10,000 IU; vitamin B1, 2 mg; vitamin B2, 10 mg; vitamin B5, 11 mg; vitamin B6, 4 mg; vitamin B12, 0.02 mg; vitamin D3, 3000 IU; vitamin E, 20 IU; vitamin K3, 2 mg; nicotinic acid, 50 mg; folic acid, 1 mg; biotin, 0.2 mg. 2 Values are calculated according to ME of feedstuffs for poultry provided by NRC (1994). 3 The numbers are analyzed values.
Table 2. Fatty acid composition (% of total fatty acids) of experimental diets for Pekin ducks (measured value).
Table 2. Fatty acid composition (% of total fatty acids) of experimental diets for Pekin ducks (measured value).
ItemsStarter Phase (1 to 21 d)Grower Phase (22 to 42 d)
3:02:11:20:33:02:11:20:3
C16:014.3513.8613.3712.6714.0613.6213.1212.43
C18:05.516.086.646.985.356.526.547.47
C18:125.3525.2125.0624.9425.3424.9325.3624.98
C18:2N6(LA)44.6042.5640.3739.1745.2541.5240.0038.04
C18:3N3(ALA)6.459.1912.0314.347.2910.6012.8314.96
SFA21.3621.1421.2020.5420.8521.6220.6620.96
MUFA26,0325.8725.7025.5525.9825.6426.0425.65
PUFA52.6152.9953.1053.9053.1852.7553.2953.39
n-3 PUFA6.799.5012.1914.527.5510.8713.0315.14
n-6 PUFA45.8243.4940.9139.3945.6341.8840.2638.26
n-6/n-36.754.583.352.716.043.853.092.53
LA, linoleic acid; ALA, α-linolenic acid; SFA, saturated fatty acid; MUFA, monounsaturated fatty acid; PUFA, polyunsaturated fatty acid.
Table 3. Primer sequences for real-time PCR.
Table 3. Primer sequences for real-time PCR.
GeneGeneBank Accession No.Primer Sequence (5′-3′)Product Size (bp)
FABP1XM_005023289.5F: AGAGAAAGCCAAGACCGTTG
R: GGTGATGGTGTCTCCGTTGA
103
ME1XM_038177167.1F: ATTTCGGAGGCCAAGAGGAC
R: GCCAGTTTACCAACCGGGAT
177
SREBP1CJQ080310.1F: AGCAGAGCAACCAGAAGCTG
R: AGGGACTTGCTCTTCTGCAC
70
FASNXM_027459847.2F: TCTGCACTGACTTCAAGCGT
R: GTTGCATGACTGGGTCTGGA
153
DGAT2XM_027466264.2F: TTGGGTACCATCCACATGGC
R: CAGGGTAGCAAGGTACGGTC
161
HMGCRXM_027446071.2F: GGCGTAGCAGGACCATTGTA
R: TTGCTCCTCCACCGAGACAT
124
ABCA1XM_038169977.1F: TGAGGACATGCGCTACGTTT
R: TTGCACCCTGATGATTGCCT
172
apoA-IXM_027444321.2F: AGCCCCTCCTGCATAAATAGC
R: CGACTCTCATCTTCGGGCAG
174
β-actinNM_001310421.1F: GGTATCGGCAGCAGTCTTA
R: TTCACAGAGGCGAGTAACTT
158
FABP1 = fatty acid-binding protein 1; ME1 = malic enzyme 1; SREBP1c = sterol regulatory element-binding protein 1c; FASN = fatty acid synthase; DGAT2 = diacylglycerol acyltransferase 2; HMGCR = 3-Hydroxy-3-Methylglutaryl-CoA reductase; ABCA1 = ATP-binding cassette transporter A1; apoA-I = apolipoprotein A-I.
Table 4. Effects of dietary replacement of soybean oil with rubber seed oil on growth performance of Pekin ducks 1.
Table 4. Effects of dietary replacement of soybean oil with rubber seed oil on growth performance of Pekin ducks 1.
ItemsAge (Days)Dietary SO:RSO RatioSEMp-Value
3:02:11:20:3
BW153.7554.0053.5953.530.150.1729
211324.681301.561256.871287.8116.440.0744
422934.152950.622921.772872.2045.280.6535
ADFI1–2184.0083.4879.9582.041.520.2836
22–42169.20169.81174.46170.603.710.7510
1–42126.60126.65127.21126.322.120.9925
ADG1–2159.9459.4157.7758.780.780.0762
22–4276.6478.8579.376.701.900.4960
1–4268.5868.9668.2967.111.080.6557
F/G1–211.391.411.401.400.020.9354
22–422.212.162.212.260.040.4441
1–421.851.831.861880.020.4980
BW = body weight; ADFI = average daily feed intake; ADG = average daily gain; F/G = feed/gain. 1 Values are the means of 4 cages (n = 4).
Table 5. Effects of dietary replacement of soybean oil with rubber seed oil on carcass traits in Pekin ducks 1.
Table 5. Effects of dietary replacement of soybean oil with rubber seed oil on carcass traits in Pekin ducks 1.
ItemsDietary SO:RSO RatioSEMp-Value
3:02:11:20:3
Breast yield (%)13.1513.1412.7912.890.500.9389
Thigh yield (%)8.498.828.538.160.360.6310
Abdominal fat (%)0.63 a0.55 ab0.54 ab0.44 b0.040.0327
Heart (%)0.510.500.540.540.020.3591
Liver (%)2.352.342.372.020.120.1158
Gizzard (%)2.182.212.202.290.090.8693
Spleen (%)0.060.060.080.070.010.0655
Pancreas (%)0.270.280.310.300.010.0840
Bursal (%)0.100.090.100.080.010.6036
Caecum (%)0.270.310.310.230.030.1950
a,b Values within a column with different letter superscripts mean significant differences (p < 0.05). 1 Values are the means of 8 ducks (n = 8).
Table 6. Effects of dietary replacement of soybean oil with rubber seed oil on plasma biochemical parameters in Pekin ducks 1.
Table 6. Effects of dietary replacement of soybean oil with rubber seed oil on plasma biochemical parameters in Pekin ducks 1.
ItemsDietary SO:RSO RatioSEMp-Value
3:02:11:20:3
TP (g/L)29.0527.4328.4528.580.960.6896
ALB (g/L)12.3412.7712.2211.670.590.6182
GLB (g/L)17.1514.6415.8416.490.860.2111
TG (mmol/L)1.17 a0.86 b0.90 b0.75 b0.070.0087
CHO (mmol/L)5.32 a4.18 b4.28 b4.10 b0.290.0189
HDL-C (mmol/L)3.20 a1.90 b2.21 b1.90 b0.12<0.0001
LDL-C (mmol/L)1.75 a1.45 b1.49 b1.40 b0.070.0073
AST (U/L)4.513.683.893.900.540.7054
ALT (U/L)19.80 a12.99 b9.13 c9.08 c0.96<0.0001
TP = total protein; ALB = albumin; GLB = globulin; TG = triglyceride; CHO = cholesterol; HDL-C = high-density lipoprotein cholesterol; LDL-C = low-density lipoprotein cholesterol; AST = aspartate aminotransferase; ALT = alkaline aminotransferase. a–c Values within a column with different letter superscripts mean significant differences (p < 0.05). 1 Values are the means of 8 ducks (n = 8).
Table 7. Effects of dietary replacement of soybean oil with rubber seed oil on liver and breast chemical composition in Pekin ducks 1.
Table 7. Effects of dietary replacement of soybean oil with rubber seed oil on liver and breast chemical composition in Pekin ducks 1.
ItemsDietary SO:RSO RatioSEMp-Value
3:02:11:20:3
Liver
Moisture (%)69.09 c69.94 bc70.58 ab71.74 a0.420.0012
Total fat (%)3.33 a2.52 b2.34 b2.27 b0.200.0149
TG (μmol/g prot)286.54 a268.16 ab219.18 bc191.86 c17.540.0038
CHO (μmol/g prot)62.22 a47.53 b49.17 b40.77 c3.970.0079
Breast
Moisture (%)77.5478.0477.8378.340.320.3464
Total fat (%)1.42 a1.17 b1.22 b1.10 b0.070.0167
TG (μmol/g prot)70.65 a59.10 ab65.89 a46.37 b6.640.0323
CHO (μmol/g prot)55.81 a43.70 b44.03 b37.82 b3.810.0200
TG = triglyceride; CHO = cholesterol. a–c Values within a column with different letter superscripts mean significant differences (p < 0.05). 1 Values are the means of 8 ducks (n = 8).
Table 8. Effects of dietary replacement of soybean oil with rubber seed oil on hepatic fat acid profile in Pekin ducks (%) 1.
Table 8. Effects of dietary replacement of soybean oil with rubber seed oil on hepatic fat acid profile in Pekin ducks (%) 1.
ItemsDietary SO:RSO RatioSEMp-Value
3:02:11:20:3
C14:00.460.370.320.340.070.5159
C16:016.7816.3517.0316.040.840.8425
C16:10.970.980.850.900.190.9505
C18:014.1913.7515.9114.901.230.6380
C18:119.0118.0117.8218.201.720.9626
C18:2 N6(LA)20.35 a17.95 b16.83 bc16.59 c0.340.0010
C18:3 N3(ALA)1.38 c1.96 bc2.25 b3.13 a0.170.0018
C20:2 N61.040.960.980.840.060.1526
C20:3 N61.961.551.841.550.130.1287
C20:4 N6(AA)15.8715.5215.9915.731.590.9970
C20:5 N3(EPA)0.29 c0.45 bc0.67 ab0.83 a0.090.0141
C22:4 N62.65 a1.57 b2.09 ab1.54 b0.210.0373
C22:5 N61.96 a1.19 b1.21 b0.95 b0.180.0229
C22:5 N3(DPA)1.41 b2.09 ab2.47 ab2.97 a0.320.0441
C22:6 N3(DHA)0.98 c1.55 bc1.88 b3.35 a0.230.0005
SFA31.8330.9433.6931.701.860.7609
MUFA20.7519.8619.6120.331.910.9745
PUFA47.4349.2046.7047.961.830.8039
n-3 PUFA4.41 c6.77 b7.45 b10.47 a0.470.0001
n-6 PUFA43.01 a40.79 ab37.89 b37.49 b1.170.0360
n-6/n-39.75 a6.37 b5.28 c3.58 d0.30<0.0001
LA, linoleic acid; ALA, α-linolenic acid; AA, arachidonic acid; EPA, eicosapentaenoic acid; DPA, docosapentaenoic acid; DHA, docosahexaenoic acid; SFA, saturated fatty acid; MUFA, monounsaturated fatty acid; PUFA, polyunsaturated fatty acid; n-6 PUFA = C18:2 N6 + C20:4 N6 + C22:4 N6 + C22:5 N6; n-3PUFA = C18:3 N3 + C22:5 N3 + C22:5 N3 + C22:6 N3. a–d Values within a column with different letter superscripts mean significant differences (p < 0.05). 1 Values are the means of 3 ducks (n = 3).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhao, Z.; Guo, Y.; Zhuang, L.; Wu, Y.; Liu, J.; Cao, J.; Wu, Z.; Wen, Z. Effects of the Dietary Replacement of Soybean Oil with Rubber Seed Oil on the Growth Performance, Carcass Trait, and Status of Lipid Metabolism in Pekin Ducks. Agriculture 2023, 13, 1717. https://doi.org/10.3390/agriculture13091717

AMA Style

Zhao Z, Guo Y, Zhuang L, Wu Y, Liu J, Cao J, Wu Z, Wen Z. Effects of the Dietary Replacement of Soybean Oil with Rubber Seed Oil on the Growth Performance, Carcass Trait, and Status of Lipid Metabolism in Pekin Ducks. Agriculture. 2023; 13(9):1717. https://doi.org/10.3390/agriculture13091717

Chicago/Turabian Style

Zhao, Zitao, Yanhong Guo, Lei Zhuang, Yongbao Wu, Jing Liu, Junting Cao, Zhanyue Wu, and Zhiguo Wen. 2023. "Effects of the Dietary Replacement of Soybean Oil with Rubber Seed Oil on the Growth Performance, Carcass Trait, and Status of Lipid Metabolism in Pekin Ducks" Agriculture 13, no. 9: 1717. https://doi.org/10.3390/agriculture13091717

APA Style

Zhao, Z., Guo, Y., Zhuang, L., Wu, Y., Liu, J., Cao, J., Wu, Z., & Wen, Z. (2023). Effects of the Dietary Replacement of Soybean Oil with Rubber Seed Oil on the Growth Performance, Carcass Trait, and Status of Lipid Metabolism in Pekin Ducks. Agriculture, 13(9), 1717. https://doi.org/10.3390/agriculture13091717

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop