Next Article in Journal
Antitubercular, Cytotoxicity, and Computational Target Validation of Dihydroquinazolinone Derivatives
Previous Article in Journal
Antifungal, Antioxidant and Antibiofilm Activities of Essential Oils of Cymbopogon spp.
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antibiotics
Volume 11
Issue 6
10.3390/antibiotics11060828
antibiotics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Companion Animals as Potential Reservoirs of Antibiotic Resistant Diarrheagenic Escherichia coli in Shandong, China

by
Lulu Cui
1,†,
Xiaonan Zhao
2,†,
Ruibo Li
1,
Yu Han
1,
Guijuan Hao
1,
Guisheng Wang
3,* and
Shuhong Sun
1,*
1
Shandong Provincial Key Laboratory of Animal Biotechnology and Disease Control and Prevention, College of Animal Science and Veterinary Medicine, Shandong Agricultural University, Tai’an 271018, China
2
Institute of Animal Science and Veterinary Medicine, Shandong Academy of Agricultural Sciences, Jinan 250100, China
3
Shandong Animal Disease Prevention and Control Center, Jinan 250100, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Antibiotics 2022, 11(6), 828; https://doi.org/10.3390/antibiotics11060828
Submission received: 8 May 2022 / Revised: 12 June 2022 / Accepted: 15 June 2022 / Published: 20 June 2022
(This article belongs to the Section Antibiotics Use and Antimicrobial Stewardship)
Browse Figures
Versions Notes

Abstract

:
Antibiotic resistance genes of Escherichia coli (E. coli) from companion animals were still poorly understood. Here, we investigated the extended-spectrum β-lactamases (ESBLs) resistance genes of E. coli from companion animals in Shandong, China. A total of 79 isolates (80.6%) were recovered from 98 healthy or diarrheal companion animals in 2021, among which ESBLs-producing isolates accounted for 43.0% (34/79), and more than half of ESBL E. coli (ESBL-EC) strains (n = 19) were isolated from healthy companion animals. Diarrheagenic E. coli isolates (45.6%, n = 36) were represented by enterotoxigenic (ETEC) (32.9%), enteropathogenic (EPEC) (10.1%) and enteroinvasive (EIEC) (2.6%), 20 isolates of which were from healthy pets. Among tested antibiotics, resistance to tetracycline (64.6%) was the most commonly observed, followed by doxycycline (59.5%) and ampicillin (53.2%). Notably, all isolates were susceptible to meropenem. The multidrug-resistant (MDR) rate was 49.4%, 20 isolates of which were ESBLs producers; moreover, 23.4%, 16.4% of ESBL-EC strains were resistant to 5 or more, 7 or more antibiotics, respectively. Among the 5 β-lactamase resistance genes, the most frequent gene was blaCTX-M (60.76%), followed by blaSHV (40.51%). The plasmid-mediated quinolone resistance (PMQR) gene aac(6’)-Ib-cr was detected in 35 isolates. Additionally, ESBL-associated genes (i.e., blaCTX-M, blaSHV) were found in 76.5% ESBL-EC strains, with six isolates carrying blaCTX-M and blaSHV. The marker gene of high-pathogenicity island gene irp2 (encoding iron capture systems) was the most frequency virulence gene. Our results showed that ESBL-EC were widespread in healthy or diarrhea companion animals, especially healthy pets, which may be a potential reservoir of antibiotic resistance, therefore, enhancing a risk to public and animal health.

1. Introduction

Escherichia coli (E. coli), a member of the Enterobacteriaceae family, widely distributes in healthy humans and animals [1]. Most E. coli strains colonize harmlessly in the intestines and rarely cause disease in healthy individuals; however, some pathogenic E. coli strains may lead to diarrhea in both humans and companion animals [2,3]. According to the virulence characteristics and clinical symptoms of diarrheagenic Escherichia coli (DEC), they have been further divided into five categories [4]: enteroinvasive (EIEC), enterotoxigenic (ETEC), enteropathogenic (EPEC), enterohemorrhagic (Shiga toxin-producing) (STEC), and enteroaggregative (EAEC). EPEC and ETEC strains have been reported from healthy or diarrhea companion animals [2,5,6]. EIEC are studied mainly in human infections [7,8], but studies in companion animals are limited.
The emergence of antimicrobial resistance in bacteria is an ongoing severe public health problem and results in 700,000 deaths annually [9]. Antibiotic misuse has led to the increasing emergence of multidrug-resistant (MDR) and pan-resistant strains in humans, companion animals, water and food animals [10]. Companion animals are kept for company, entertainment, or compassion for humans. In China, 55.03 million dogs and 44.12 million cats were kept in cities in 2019. The close contact between companion animals and humans enhances the risk of bacterial and even antimicrobial-resistant bacterial transmission across animals or humans by horizontal transfer and clonal spread [11]. Previous studies have shown that antimicrobial-resistant E. coli are frequently isolated from dogs and cats [12,13].
The Gram-negative bacterium E. coli is a common member of the microbiota of the lower intestine of mammals and, to a lesser extent, birds. E. coli is also considered to be the most important reservoir of resistance genes that may be accountable for treatment failures in both human and veterinary medicine [14,15]. In addition, most antibiotic classes used to treat colibacillosis are shared between veterinary medicine and human medicine in the community, regardless of whether these are first-generation antibiotics or critically important antibiotics [16]. Over the past two decades, there has been a significant number of infections caused by E. coli carrying extended-spectrum β-lactamases (ESBLs) [17]. ESBLs are becoming more common because this phenotype is being selected for by the use of and exposure to β-lactams [18]. Infection with ESBL E. coli (ESBL-EC) is increasingly associated with overt infections in humans and companion animals worldwide [19,20]. ESBL-EC has been identified in the faeces of healthy cats and dogs in a number of studies [21,22].
Virulence factors are usually expressed proteins encoded by genes located in the chromosome or in plasmids. Morato et al. [23] showed that Escherichia coli of companion animals is an important source of zoonotic infection. Therefore, further investigations are needed regarding the distribution of virulence genes of E. coli isolates from companion animals and their capacity as reservoirs of antimicrobial resistance genes.
Currently, national monitoring programs solely focus on the prevalence of bacteria in food animals, while there is little investigation of the risk of antibiotic resistance switching between humans and companion animals [24]. The prevalence of ESBL-EC in companion animals has been brought to the attention of the scientific community [25,26]; thus, this study aims to estimate antimicrobial resistance in E. coli from companion animals in Shandong, China.

2. Results

2.1. Isolation and Serologic Characterization of E. coli Strains

We isolated 79 E. coli strains, including 36 (45.6%, 36/79) isolates from apparently healthy companion animals. The E. coli isolation rate was 80.6% (79/98). Among these 79 E. coli strains, 36 isolates could be serotyped. Furthermore, 36 isolates (45.6%) were found to be DEC in the investigated collection of 79 isolates (Figure 1). Among DEC, ETEC: 26 isolates were found to be the most predominant, and the predominant serotype is O6:K15; followed by EPEC: eight isolates, respectively O125:K70, O128:K67, O114:K90 and O142:K86; EIEC: 2 isolates (Table 1).

2.2. Resistance Profiles of E. coli Strains

The results of the antimicrobial susceptibility analysis of 79 E. coli isolates are presented in Figure 2. Resistance to TET (64.6%) was the most commonly observed resistance in the E. coli isolates. High rates of resistance were also noted for DOX (59.5%) and AM (52.6%). In contrast, all isolates were susceptible to MEM, and a low level of resistance was found for FEP (2.5%). ESBL-EC isolates showed higher levels of resistance to CRO (13.9% vs. 8.9%), CEX (27.8% vs. 21.5%), AM (29.1% vs. 26.1%), ENR (15.2% vs. 8.8%) and SXT (19% vs. 16.4%) than non-ESBL producers. In addition, 49.4% (39/79) of E. coli isolates were MDR. Among DEC isolates, higher frequency of MDR strains was detected in ESBL-EC (25%) compared to non-ESBL producing trains (19.4%). On the other hand, resistance to three or more antimicrobial classes was identified in 53.8% and 47.2% of the strains isolated from diarrheic or no-diarrheic companion animals, respectively (Table S1). Noteably, among DEC isolates, all ESBL-EC were observed higher resistance against β-lactames (61.5%), followed by tetracyclines (92.3%) and penicillins (76.9%) (Table 2).

2.3. Detection of Antimicrobial Resistance Genes

All the E. coli isolates were analyzed for antimicrobial resistance genes, and the results are shown in Figure 3. Three β-lactamase genes were detected among the isolates, and blaCTX-M (60.8%) was the most commonly isolated β-lactamase gene, followed by blaSHV (40.5%) and blaOXA (2.5%). Five quinolone resistance genes were detected among the isolates, and aac (6’)-Ib-cr (44.30%) was the most commonly isolated quinolone resistance gene, followed by oqxA (40.5%), qnrS (19.0%), qnrA (11.9%), and qnrB (7.6%). Only one aminoglycoside resistance gene, aaC4 (25.3%) was detected. In addition, we did not detect any tetracycline resistance genes in this study; moreover, blaCTX-M was the most prevalent ESBL genotype, and 56.2% (27/48) of blaCTX-M positive strains were isolated from healthy companion animals. On the other hand, PMQR genes were found in 79.4% (27/34) ESBL-EC, with 20 isolates harboring β-lactamase genes and PMQR genes (Table S1).

2.4. Concordance of Genotypic-Phenotypic Antimicrobial Resistance

The concordance of genotypic and phenotypic resistance is summarized in Table 3. We explored the correlation of genotypic-phenotypic antimicrobial resistance of the isolates. Interestingly, a comparatively stronger correlation was found between ceftriaxone and blaCTX-M among the strains (p  = 0.010). Additionally, a significant correlation was also observed between phenotypic cephalexin resistance and blaOXA gene among isolates (p  =  0.007). On the other hand, no statistically significant difference was observed between gentamicin phenotype and aaC4 resistance gene among strains (p >  0.05). On the other hand, all 61 tetracyclines resistant isolates did not harbor tetA and tetB genes encoding tetracycline resistance.

2.5. Distribution of Virulence Genes in E. coli Isolates

The identification of 16 virulence genes in E. coli strains is presented in Figure 4. One or more virulence genes were detected in 93.7% E. coli strains. The most prevalent virulence gene was irp2 (87.3%), the marker gene of high-pathogenicity island, followed by eaeA (intimin) (35.4%), EAST1 (enterotoxins) (6.3%) and F17 (adhesin) (2.5%). For 34 ESBL-EC isolates, the most prevalent virulence genes were irp2 (85.3%) and eaeA (35.3%). In addition, among DEC isolates, the most frequent virulence genes we observed were irp2 (91.7%) and eaeA (38.9%) is summarized in Table 2. Genes coding for hlyA, Stx1, Stx2, K88, K99, 987p, LT, STa, bfpA, F18, F41 and CS31A were not detected in any strain. Of these 79 strains, 4 isolates (5.1%) simultaneously carried 3 virulence genes with 2 of them being ESBL-EC, 22 isolates (27.8%) harbored 2 virulence genes, and 5 isolates 5 strains do not carry any of the 11 virulence genes; it is noted that 97.9% (47/48) of isolates from healthy companion animals carried at least one or more virulence genes.

3. Discussion

The relationship between companion animals and humans has become increasingly close in recent decades, leading to a high risk of zoonotic transmission of bacteria between pets and humans [27,28,29]. In this study, companion animals were evaluated as a potential source in the transmission of pathogenic bacteria.
Specifically, a total of 79 E. coli isolates were confirmed from 98 companion animals (80.6%). Companion animals have been reported as a pivotal transmission reservoir for DEC [30,31]. The findings showed that 36 of 79 strains belonged to DEC, and ETEC was found to be mostly associated with diarrhea companion animals. In previous study, Zahraei et al. [32] found EPEC isolates from 113 non-diarrheic and diarrheic animals. Similar findings were also observed in our study (Table 1), implying that, whether healthy or diarrheic, companion animals may act as a potential reservoir of EPEC. Compared to old animals, young companion animals are usually more susceptible to ETEC and EPEC infection [4]; however, 52.8% (19/36) of pets investigated in our study were older than 12 months. Accordingly, determining the virulence factor, and antibacterial resistance and evaluating the risk of potential transmission to people of companion animals E. coli strains are very crucial.
There is concern that antimicrobial resistance in E. coli harbored by companion animals can be transmitted from one host to another even by low bacterial numbers [33,34]. Previous studies point out that the close relationship of humans and their companion animals provide opportunities for sharing strains [35,36]. In this study, most of the isolates were resistant to TET (64.6%), DOX (59.5%) and AM (53.2%), which was similar to reports of E. coli isolates from other studies [37]. In contrast, other recent studies of E. coli isolates from dogs and cats reported resistance to a wide range of antibiotics, including quinolones and extended-spectrum beta-lactamases [38,39]; these high resistance rates are due to the wide use of antibiotics in companion animals. In addition, all the isolates were susceptible to MEM, and the restricted use of carbapenems may be a factor affecting the associated high antimicrobial sensitivity. Carbapenems should be administered only in cases of multidrug-resistant bacterial infection; their restricted use is probably a factor influencing the associated high antimicrobial sensitivity [40,41]. In the current study, the overall MDR frequency of 49.4% was similar to that in studies from the United States (52.0%) and Poland (66.8%) [42,43]. In contrast, the result in this study was much higher than that (28.0%) from healthy dogs from Canada [44]. The high MDR rates observed in the current study indicated that currently available antimicrobial treatment options for E. coli infections in companion animals are limited, and it is highly recommended that measures should be taken to control the potential risk from companion animals, such as reducing and standardizing antibiotic usage in clinics.
ESBLs are mainly associated with E. coli, which often show resistance to multiple antibiotics [45]. In this study, we found that 43.0% (34/79) of E. coli isolates from companion animals produced ESBLs; this result is significantly higher than that reported in Brazil, in which the prevalence of ESBL-EC in companion animals was 8.1% [46]. Most ESBL-EC strains (n = 20, 20/34) exhibited the MDR phenotype; this finding may be mirroring the result of irrational use of these antibiotics in veterinary clinics that eventually might cause high selection pressure of resistant bacteria. In Japan, the percentage of ESBL-EC in companion animals was 21.3%, and most of the isolates were sampled from urinary tract infections [47], and it is a common clinical diagnosis that urinary tract infection due to E. coli strains. In Europe and the United States, the proportions of ESBL carriers in companion animals varied according to the country and the sampling, but remained under 5% [25,48,49]. Data on the prevalence of ESBL-EC in different studies were difficult to compare based on differences in regions, sample types, and animal health status.
As reported previously, blaCTX-M genes are the most frequent ESBL-encoding genes identified in both humans and animals [50,51]. In this study, the prevalence of blaCTX-M was 60.8%, which was much higher than that in other studies in which the prevalence of blaCTX-M among bacteria derived from pets in different countries (including China) ranged from 10 to 21% [38,52,53]. Furthermore, higher resistance to quinolone antibiotics was observed in ESBL-EC strains, which may be because plasmids containing blaCTX-M often carry genes that confer resistance to other antibiotic families [54]. Therefore, the risk of zoonotic transmission of ESBL-EC is likely to be high, and the E. coli isolates from companion animals are reservoirs of ESBLs. In addition, we did not find blaTEM in this study, which was different from the E. coli from food-producing animals in which blaTEM was the most commonly identified β-lactamase gene [55].
PMQR is a threat to veterinary clinical therapy. To date, at least three types of quinolone resistance determinants, including the qnr family (qnrA, qnrB, qnrS, qnrC, aac (6’)-Ib-cr and qnrD), and quinolone efflux pumps (oqxA), have been extensively reported [56]. In this study, we found a high prevalence of aac (6′)-Ib-cr among the E. coli isolates, and similar findings have been confirmed among the E. coli isolates from companion animals in Australia [57]. In addition, we detected the qnrS gene, which was the most prevalent PMQR gene among ESBL-producing Enterobacter spp. isolates from humans in China [58] but was not previously detected among isolates from companion animals in Australia [57]; these findings may suggest that the qnrS gene is locally spread among companion animals and humans in China.
In our study, 84.4% of non-ESBL producers carried at least 1 or more β-lactamase genes. In addition, 18 isolates of non-ESBL producers were resistant to cephalosporin antibiotics. The difference in phenotypic-genotypic cephalosporin resistance, a likely molecular mechanism was the presence of other AmpC β-lactamase genes. tetA and tetB genes were not detected in not detected in all tetracyclines resistance isolates, possibly because strains contain some other resistance genes, or involve other resistance mechanisms [59].
The high-pathogenetic island marker gene, irp2 mediates the iron-uptake system of highly pathogenic strains and was associated with E. coli virulence [60]. Several reports showed that irp2 was detected in pathogenic E. coli strains from humans [61,62], we observed a very high frequency of irp2 gene (87.3%). Additionally, eaeA (intimin) observed in DEC were found to be more pathogenic in humans and are involved in zoonotic transmission [63], a similar result was found in our study. Therefore, our study indicates that strains harbored irp2 may bring a risk for human and companion animals health. On the other hand, easA gene was mainly detected from diarrhea companion animals (Table S1), this finding showed that easA positive strains may are associated with animal diarrhea mechanism.

4. Materials and Methods

4.1. Sampling Size Determination

The required sample size was determined based on a confidence interval (CI) of 95%, an E. coli expected prevalence of 50% and an accepted error of 10%, giving a value of N will be 98 samples in this study according to a previous report [64].
N = Z2αp(1 − p)/L2,
where N = number of samples, Zα = (1 − α/2) percentile of a standard normal, p = prevalence, L = margin error of 5%.

4.2. Bacterial Isolates

Rectal and oronasal swabs were collected from 65 dogs and 33 cats attended in different veterinary clinics in the city of Tai’an, Shandong during a 3-month period (January to March 2021). Specimens were refrigerated until processing. The health status and age of the companion animals are shown in Table S1. Ethical approval was not required for the study because the sampling process did not harm the animals.
The swab samples were tested for the presence of E. coli as previously described [65]. The swab samples were streaked onto MacConkey (Hope, Qingdao, China) agar plates and incubated overnight at 37 °C. After overnight incubation, the phenotypic characteristics of E. coli were selected, and isolates were subcultured onto MacConkey agar plates. The subcultured colonies were confirmed as E. coli by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) with a Vitek-MS (bioMerieux, Marcy-Etoile, France). Isolates were inoculated into 5 mL of lysogeny broth (LB) and incubated at 37 °C with shaking for 18 h. A 1 mL aliquot of this suspension was combined with 0.5 mL of sterile glycerol and stored at −80 °C. Additionally, Escherichia coli ATCC 25,922 was kept in the Laboratory of Veterinary Public Health, Shandong Agricultural University.

4.3. Determination of Serotypes, and Genomic DNA Extraction

According to the manufacturer’s instructions (Tianrun, Ningbo, China), using polyvalent and monovalent agglutination sera to serotype. Briefly, commercially available antisera were blended with a E. coli suspension on a slide, and then the serotype was determined in one minute.
The isolates were cultivated on 2 mL of LB and incubated at 37 °C with shaking for 10 h. Genomic DNA was extracted by using the Genomic DNA Purification Kit (Tiangen, Beijing, China), and DNA templates were stored at −20 °C until use.

4.4. Antimicrobial Susceptibility Testing and Detection of ESBL-EC

All E. coli isolates were subjected to antimicrobial susceptibility testing by the broth diffusion method according to the Clinical and Laboratory Standards Institute (CLSI) [66]. The 11 antibiotics tested were ampicillin (AM, 10 μg), amoxicillin (AMX, 10 μg), trimethoprim-sulfamethoxazole (SXT, 25 μg), tetracycline (TET, 30 μg), gentamicin (GM, 10 μg), meropenem (MEM, 10 μg), enrofloxacin (ENR, 15 μg), ceftriaxone (CRO, 30 μg), doxycycline (DOX, 30 μg), cephalexin (CEX, 30 μg) and cefepime (FEP, 30 μg). E. coli isolates resistant to more than three classes of antimicrobials were defined as MDR isolates [67]. In addition, the phenotypic evaluation of the ESBL-producing isolates was confirmed by double-disk synergy test according to the guidelines of the CLSI. E. coli ATCC 25,922 was used as a quality control strain.

4.5. Detection of Resistance Genes

PCR screening was applied for β-lactamase-encoding genes (blaSHV, blaOXA, blaCTX-M, blaTEM, and blaPSE), other genes associated with resistance to aminoglycosides (aaC1, aaC2, aaC3, and aaC4), plasmid-mediated quinolone resistance genes (qnrA, qnrB, qnrC, qnrD, qnrS, oqxA, aac (6′)-Ib-cr), tetracyclines (tetA and tetB). All the primers and annealing temperatures were based on slight modifications of those from previously described procedures [68,69,70,71]. Primer sequences and annealing temperature were summarized in Appendix A Table A1. PCR products were separated and visualized on 1.5% agarose gels using ethidium bromide staining. Furthermore, all PCR amplicons were sequenced to confirm gene identity.

4.6. Detection of Virulence Genes

The 16 virulence genes encoding adhesin (K88, K99, F17, F18, F41, 987p, CS31A), bundle-forming pilus (bfpA), shiga toxins (Stx1, Stx2), α-haemolysin (hlyA), enterotoxins (LT, Sta, EAST1), yersiniatbactin biosynthesis (irp2), and intimin (eaeA) of E. coli were detected with the primers in Appendix A Table A2 and reaction system previously studies [72,73,74,75].

4.7. Statistical Analysis

The statistical analyses were performed using SPSS software version 21.0 (IBM Corp., Armonk, NY, USA), employing the chi-square test. A p value of < 0.05 was considered to be statistically significant.

5. Conclusions

Overall, our results highlight the seriousness of the antibiotic resistance problem among E. coli isolates from whether healthy or diarrhea companion animals in Shandong, China, which may provide a significant reference for pet clinical veterinarians, public health agencies and other researchers. Our findings also emphasize that the presence of ESBL-producing E. coli among companion animals needs further continued surveillance. Therefore, it is necessary to establish national standards for the rational use of antibiotics in companion animals.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/antibiotics11060828/s1, Table S1: Characteristics of the E. coli collected from companion animals.

Author Contributions

Conceptualization, S.S.; funding acquisition, G.W. and S.S.; methodology, L.C., R.L. and Y.H.; project administration, X.Z., G.W. and S.S.; writing—original draft, L.C. and X.Z.; writing—review & editing, L.C. and G.H. All authors have read and agreed to the published version of the manuscript.

Funding

Key Research and Development Program of Shandong Province, China (2022CXGC010606) and Shandong Province Modern Agricultural Industry Technology System Special Economic Animal Industry Innovation Team Project (SDAIT-21-05).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

Appendix A

Table
Table A1. Primers used for resistance genes.
Table A1. Primers used for resistance genes.
Target GenesSequence (5′ → 3′)Product Size (bp)Reference
β-Lactamases
blaTEMF: ATAAAATTCTTGAAGACGAAA643[69]
R: GACAGTTACCAATGCTTAATC
blaSHVF: TTATCTCCCTGTTAGCCACC860[69]
R: GATTTGCTGATTTCGCTCGG
blaPSEF: TAGGTGTTTCCGTTCTTG150[70]
R: TCATTTCGCTCTTCCATT
blaOXAF TCAACTTTCAAGATCGCA591[69]
R: GTGTGTTTAGAATGGTGA
blaCTX-MF: CGCTTTGCGATGTGCAG550[69]
R: ACCGCGATATCGTTGGT
quinolones
qnrAF: ATTTCTCACGCCAGGATTTG519[69]
R: GATCGGCAAAGGTCAGGTCA
qnrBF: GATCGTGAAAGCCAGAAAGG513[69]
R: ACGATGCCTGGTAGTTGTCC
qnrCF: GGTTGTACATTTATTGAATC666[71]
R: TCCACTTTACGAGGTTCT
qnrDF: AGATCAATTTACGGGGAATA984[71]
R: AACAAGCTGAAGCGCCTG
qnrSF: ACGACATTCGTCAACTGCAA417[69]
R: TAAATTGGCACCCTGTAGGC
qqxAF: GATCAGTCAGTGGGATAGTTT670[71]
R: TACTCGGCGTTAACTGATTA
Aac(6’)-Ib-crF: TTGCGATGCTCTATGAGTGGCTA482[69]
R: CTCGAATGCCTGGCGTGTTT
aminoglycosides
aaC1F: ACCTACTCCCAACATCAGCC528[72]
R: ATATAGATCTCACTACGCGC
aaC2F: ACTGTGATGGGATACGCGTC482[72]
R: CTCCGTCAGCGTTTCAGCTA
aaC3F: CACAAGAACGTGGTCCGCTA185[72]
R: AACAGGTAAGCATCCGCATC
aaC4F: CTTCAGGATGGCAAGTTGGT286[72]
R: TCATCTCGTTCTCCGCTCAT
tetracyclines
tetAF: GCGCCTTTCCTTTGGGTTCT211[72]
R: CCACCCGTTCCACGTTGTTA
tetBF: CATTAATAGGCGCATCGCTG391[72]
R: TGAAGGTCATCGATAGCAGG
R: AAGCAGACTTGACCTGA
Table
Table A2. Characterization of virulence gene primers used in PCR reactions.
Table A2. Characterization of virulence gene primers used in PCR reactions.
Virulence FactorsSequence (5′-3′)Amplicon Size (bp)Reference
K88F: GATGAAAAAGACTCTGATTGCA841[73]
R: GATTGCTACGTTCAGCGGAGCG
K99F: CTGAAAAAAACACTGCTAGCTATT543[73]
R: CATATAAGTGACTAAGAAGGATGC
F17F: GCAGAAAATTCAATTTATCCTTGG537[74]
R: CTGATAAGCGATGGTGTAATTAAC
F18F: ATGAAAAGACTAGTGTTTATTTCTT520[73]
R: TTACTTGTAAGTAACCGCGTAAGCC
F41F: GATGAAAAAGACTCTGATTGCA682[73]
R: TCTGAGGTCATCCCAATTGTGG
987pF: GTTACTGCCAGTCTATGCCAAGTG463[73]
R: TCGGTGTACCTGCTGAACGAATAG
CS31AF: GGGCGCTCTCTCCTTCAAC402[74]
R: CGCCCTAATTGCTGGCGAC
bfpAF: GGTCTGTCTTTGATTGAATC485[75]
R: TTTACATGCAGTTGCCGCTT
Stx1F: ATTCGCTGAATGTCATTCGCT664[73]
R: ACGCTTCCCAGAATTGCATTA
Stx2F: GAATGAAGAAGATGTTTATAGCGG281[73]
R: GGTTATGCCTCAGTCATTATTAA
hlyAF: GCATCATCAAGCGTACGTTCC533[73]
R: AATGAGCCAAGCTGGTTAAGCT
LTF: CCGAATTCTGTTATATATGTC696[75]
R: GGCGACAGATTATACCGTGC
StaF: GGGTTGGCAATTTTTATTTCTGTA183[73]
R: ATTACAACAAAGTTCACAGCAGTA
EAST1F: ATGCCATCAACACAGTATATC117[73]
R: TCAGGTCGCGAGTGACGG
irp2F: AAGGATTCGCTGTTACCGGAC287[73]
R: TCGTCGGGCAGCGTTTCTTCT
eaeAF: CATTGATCAGGATTTTTCTGGT510[75]

References

  1. Gomes, T.A.; Elias, W.P.; Scaletsky, I.C.; Guth, B.E.; Rodrigues, J.F.; Piazza, R.M.; Ferreira, L.C.; Martinez, M.B. Diarrheagenic Escherichia coli. Braz. J. Microbiol. 2016, 47 (Suppl. 1), 3–30. [Google Scholar] [CrossRef] [Green Version]
  2. Puno-Sarmiento, J.; Medeiros, L.; Chiconi, C.; Martins, F.; Pelayo, J.; Rocha, S.; Blanco, J.; Blanco, M.; Zanutto, M.; Kobayashi, R.; et al. Detection of Diarrheagenic Escherichia coli Strains Isolated from Dogs and Cats in Brazil. Vet. Microbiol. 2013, 166, 676–680. [Google Scholar] [CrossRef]
  3. Prah, I.; Ayibieke, A.; Mahazu, S.; Sassa, C.T.; Hayashi, T.; Yamaoka, S.; Suzuki, T.; Iwanaga, S.; Ablordey, A.; Saito, R. Emergence of Oxacillinase-181 Carbapenemase-Producing Diarrheagenic Escherichia coli in Ghana. Emerg. Microbes Infect. 2021, 10, 865–873. [Google Scholar] [CrossRef] [PubMed]
  4. Beutin, L. Escherichia coli as A Pathogen in Dogs and Cats. Vet. Res. 1999, 30, 285–298. [Google Scholar] [PubMed]
  5. Krause, G.; Zimmermann, S.; Beutin, L. Investigation of Domestic Animals and Pets as A Reservoir for Intimin- (eae) Gene Positive Escherichia coli Types. Vet. Microbiol. 2005, 106, 87–95. [Google Scholar] [CrossRef]
  6. Vega-Manriquez, X.D.; Ubiarco-Lopez, A.; Verdugo-Rodriguez, A.; Hernandez-Chinas, U.; Navarro-Ocana, A.; Ahumada-Cota, R.E.; Ramirez-Badillo, D.; Hernandez-Diaz de Leon, N.; Eslava, C.A. Pet Dogs Potential Transmitters of Pathogenic Escherichia coli with Resistance to Antimicrobials. Arch. Microbiol. 2020, 202, 1173–1179. [Google Scholar] [CrossRef] [PubMed]
  7. Escher, M.; Scavia, G.; Morabito, S.; Tozzoli, R.; Maugliani, A.; Cantoni, S.; Fracchia, S.; Bettati, A.; Casa, R.; Gesu, G.P.; et al. A Severe Foodborne Outbreak of Diarrhoea Linked to A Canteen in Italy Caused by Enteroinvasive Escherichia coli, An Uncommon Agent. Epidemiol. Infect. 2014, 142, 2559–2566. [Google Scholar] [CrossRef]
  8. Newitt, S.; MacGregor, V.; Robbins, V.; Bayliss, L.; Chattaway, M.A.; Dallman, T.; Ready, D.; Aird, H.; Puleston, R.; Hawker, J. Two Linked Enteroinvasive Escherichia coli Outbreaks, Nottingham, UK, June 2014. Emerg. Infect. Dis. 2016, 22, 1178–1184. [Google Scholar] [CrossRef] [Green Version]
  9. Laxminarayan, R.; Duse, A.; Wattal, C.; Zaidi, A.K.M.; Wertheim, H.F.L.; Sumpradit, N.; Vlieghe, E.; Hara, G.L.; Gould, I.M.; Goossens, H.; et al. Antibiotic Resistance—The Need for Global Solutions. Lancet Infect. Dis. 2013, 13, 1057–1098. [Google Scholar] [CrossRef] [Green Version]
  10. Anderson, M.; Clift, C.; Kai, S.; Sagan, A.; Mossialos, E. Averting the AMR Crisis. What are the Avenues for Policy Action for Countries in Europe? European Observatory on Health Systems and Policies: Copenhagen, Denmark, 2019. [Google Scholar]
  11. Hong, J.S.; Song, W.; Park, H.M.; Oh, J.Y.; Chae, J.C.; Jeong, S.; Jeong, S.H. Molecular Characterization of Fecal Extended-Spectrum Beta-Lactamase- and AmpC Beta-Lactamase-Producing Escherichia coli from Healthy Companion Animals and Cohabiting Humans in South Korea. Front. Microbiol. 2020, 11, 674. [Google Scholar] [CrossRef] [Green Version]
  12. Kock, R.; Daniels-Haardt, I.; Becker, K.; Mellmann, A.; Friedrich, A.W.; Mevius, D.; Schwarz, S.; Jurke, A. Carbapenem-Resistant Enterobacteriaceae in Wildlife, Food-Producing, and Companion Animals: A Systematic Review. Clin. Microbiol. Infect. 2018, 24, 1241–1250. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Lei, L.; Wang, Y.; He, J.; Cai, C.; Liu, Q.; Yang, D.; Zou, Z.; Shi, L.; Jia, J.; Wang, Y.; et al. Prevalence and Risk Analysis of Mobile Colistin Resistance and Extended-Spectrum Beta-Lactamase Genes Carriage in Pet Dogs and Their Owners: A Population Based Cross-Sectional Study. Emerg. Microbes Infect. 2021, 10, 242–251. [Google Scholar] [CrossRef] [PubMed]
  14. Gordon, D.M.; Cowling, A. The Distribution and Genetic Structure of Escherichia coli in Australian Vertebrates: Host and Geographic Effects. Microbiology 2003, 149, 3575–3586. [Google Scholar] [CrossRef] [Green Version]
  15. Poirel, L.; Madec, J.Y.; Lupo, A.; Schink, A.K.; Kieffer, N.; Nordmann, P.; Schwarz, S. Antimicrobial Resistance in Escherichia coli. Microbiol. Spectrum 2018, 6, 14. [Google Scholar] [CrossRef] [Green Version]
  16. WHO Organisation. WHO Advisory Group on Integrated Surveillance of Antimicrobial Resistance (AGISAR). In Proceedings of the Report of The 7th Meeting, Raleigh, NC, USA, 17–20 October 2016; WHO: Geneva, Switzerland, 2018. [Google Scholar]
  17. Logan, L.K.; Weinstein, R.A. The Epidemiology of Carbapenem-Resistant Enterobacteriaceae: The Impact and Evolution of a Global Menace. J. Infect. Dis. 2017, 215, S28–S36. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  18. Skov, R.L.; Hammerum, A.M.; Larsen, J.; Aarestrup, F.M.; Lester, C.H.; Skytte, T.; Mordhorst, H.; Olsen, S.S.; Andersen, V.D.; Hansen, F. Characterization of Extended-Spectrum Beta-Lactamase (ESBL)-Producing Escherichia coli Obtained from Danish Pigs, Pig Farmers and Their Families from Farms with High or No Consumption of Third- or Fourth-Generation Cephalosporins. J. Antimicrob. Chemother. 2014, 69, 2650–2657. [Google Scholar]
  19. Wedley, A.L.; Dawson, S.; Maddox, T.W.; Coyne, K.P.; Pinchbeck, G.L.; Clegg, P.; Nuttall, T.; Kirchner, M.; Williams, N.J. Carriage of Antimicrobial Resistant Escherichia coli in Dogs: Prevalence, Associated Risk Factors and Molecular Characteristics. Vet. Microbiol. 2017, 199, 23–30. [Google Scholar] [CrossRef] [Green Version]
  20. Adams, R.J.; Kim, S.S.; Mollenkopf, D.F.; Mathys, D.A.; Schuenemann, G.M.; Daniels, J.B.; Wittum, T.E. Antimicrobial-Resistant Enterobacteriaceae Recovered from Companion Animal and Livestock Environments. Zoonoses Public Health 2018, 65, 519–527. [Google Scholar] [CrossRef]
  21. Ho, P.L.; Chow, K.H.; Lai, E.L.; Lo, W.U.; Yeung, M.K.; Chan, J.; Chan, P.Y.; Yuen, K.Y. Extensive Dissemination of CTX-M-Producing Escherichia coli with Multidrug Resistance to ‘Critically Important’ Antibiotics among Food Animals in Hong Kong, 2008–2010. J. Antimicrob. Chemother. 2011, 66, 765–768. [Google Scholar] [CrossRef] [Green Version]
  22. Rubin, J.E.; Pitout, J.D. Extended-Spectrum Beta-Lactamase, Carbapenemase and AmpC Producing Enterobacteriaceae in Companion Animals. Vet. Microbiol. 2014, 170, 10–18. [Google Scholar] [CrossRef]
  23. Morato, E.P.; Leomil, L.; Beutin, L.; Krause, G.; Moura, R.A.; Pestana de Castro, A.F. Domestic Cats Constitute a Natural Reservoir of Human Enteropathogenic Escherichia coli Types. Zoonoses Public Health 2009, 56, 229–237. [Google Scholar] [CrossRef] [PubMed]
  24. Guerra, B.; Fischer, J.; Helmuth, R. An Emerging Public Health Problem: Acquired Carbapenemase-Producing Microorganisms are Present in Food-Producing Animals, Their Environment, Companion Animals and Wild Birds. Vet. Microbiol. 2014, 171, 290–297. [Google Scholar] [CrossRef] [PubMed]
  25. Huber, H.; Zweifel, C.; Wittenbrink, M.M.; Stephan, R. ESBL-Producing Uropathogenic Escherichia coli Isolated from Dogs and Cats in Switzerland. Vet. Microbiol. 2013, 162, 992–996. [Google Scholar] [CrossRef] [PubMed]
  26. So, J.H.; Kim, J.; Bae, I.K.; Jeong, S.H.; Kim, S.H.; Lim, S.K.; Park, Y.H.; Lee, K. Dissemination of Multidrug-Resistant Escherichia coli in Korean Veterinary Hospitals. Diagn. Microbiol. Infect. Dis. 2012, 73, 195–199. [Google Scholar] [CrossRef]
  27. Edney, A.T. Companion Animals and Human Health. Vet. Rec. 1992, 130, 285–287. [Google Scholar] [CrossRef] [PubMed]
  28. Silva, J.M.D.; Menezes, J.; Marques, C.; Pomba, C.F. Companion Animals-an Overlooked and Misdiagnosed Reservoir of Carbapenem Resistance. Antibiotics 2022, 11, 533. [Google Scholar] [CrossRef]
  29. Gronthal, T.; Osterblad, M.; Eklund, M.; Jalava, J.; Nykasenoja, S.; Pekkanen, K.; Rantala, M. Sharing More than Friendship-Transmission of NDM-5 ST167 and CTX-M-9 ST69 Escherichia coli between Dogs and Humans in a Family, Finland, 2015. Eurosurveill 2018, 23, 1700497. [Google Scholar] [CrossRef]
  30. Arais, L.R.; Barbosa, A.V.; Andrade, J.R.C.; Gomes, T.A.T.; Asensi, M.D.; Aires, C.A.M.; Cerqueira, A.M.F. Zoonotic Potential of a typical Enteropathogenic Escherichia coli (aEPEC) Isolated from Puppies with Diarrhoea in Brazil. Vet. Microbiol. 2018, 227, 45–51. [Google Scholar] [CrossRef]
  31. Askari, A.; Ghanbarpour, R.; Akhtardanesh, B.; Aflatoonian, M.R.; Sharifi, H.; Jajarmi, M.; Molaei, R. Detection of Zoonotic Diarrheagenic Pathotypes of Escherichia coli in Healthy Household Dogs. Iran. J. Microbiol. 2020, 12, 522–530. [Google Scholar] [CrossRef]
  32. Zahraei Salehi, T.; Askari Badouei, M.; Mehdizadeh Gohari, I. Molecular Detection and Antibacterial Susceptibility of Enteropathogenic Escherichia coli (EPEC) and Shigatoxigenic Escherichia coli (STEC) Strains Isolated from Healthy and Diarrhoeic Dogs. Comp. Clin. Path. 2010, 20, 585–589. [Google Scholar] [CrossRef]
  33. Reygaert, W.C. An Overview of the Antimicrobial Resistance Mechanisms of Bacteria. AIMS Microbiol. 2018, 4, 482–501. [Google Scholar] [CrossRef] [PubMed]
  34. Beceiro, A.; Tomas, M.; Bou, G. Antimicrobial Resistance and Virulence: A Successful or Deleterious Association in the Bacterial World? Clin. Microbiol. Rev. 2013, 26, 185–230. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Guardabassi, L.; Schwarz, S.; Lloyd, D.H. Pet Animals as Reservoirs of Antimicrobial-Resistant Bacteria. J. Antimicrob. Chemoth. 2004, 54, 321–332. [Google Scholar] [CrossRef]
  36. Costa, D.; Poeta, P.; Saenz, Y.; Coelho, A.C.; Matos, M.; Vinue, L.; Rodrigues, J.; Torres, C. Prevalence of Antimicrobial Resistance and Resistance Genes in Faecal Escherichia coli Isolates Recovered from Healthy Pets. Vet. Microbiol. 2008, 127, 97–105. [Google Scholar] [CrossRef] [PubMed]
  37. Marchetti, L.; Buldain, D.; Gortari Castillo, L.; Buchamer, A.; Chirino-Trejo, M.; Mestorino, N. Pet and Stray Dogs as Reservoirs of Antimicrobial-Resistant Escherichia coli. Int. J. Microbiol. 2021, 2021, 6664557. [Google Scholar] [CrossRef]
  38. Zogg, A.L.; Zurfluh, K.; Schmitt, S.; Nuesch-Inderbinen, M.; Stephan, R. Antimicrobial Resistance, Multilocus Sequence Types and Virulence Profiles of ESBL Producing and Non-ESBL Producing Uropathogenic Escherichia coli Isolated from Cats and Dogs in Switzerland. Vet. Microbiol. 2018, 216, 79–84. [Google Scholar] [CrossRef] [Green Version]
  39. Saputra, S.; Jordan, D.; Mitchell, T.; Wong, H.S.; Abraham, R.J.; Kidsley, A.; Turnidge, J.; Trott, D.J.; Abraham, S. Antimicrobial Resistance in Clinical Escherichia coli Isolated From Companion Animals in Australia. Vet. Microbiol. 2017, 211, 43–50. [Google Scholar] [CrossRef] [Green Version]
  40. Weese, J.S.; Blondeau, J.; Boothe, D.; Guardabassi, L.G.; Gumley, N.; Papich, M.; Jessen, L.R.; Lappin, M.; Rankin, S.; Westropp, J.L.; et al. International Society for Companion Animal Infectious Diseases (ISCAID) Guidelines for the Diagnosis and Management of Bacterial Urinary Tract Infections in Dogs and Cats. Vet. J. 2019, 247, 8–25. [Google Scholar] [CrossRef]
  41. Weese, J.S.; Blondeau, J.M.; Boothe, D.; Breitschwerdt, E.B.; Guardabassi, L.; Hillier, A.; Lloyd, D.H.; Papich, M.G.; Rankin, S.C.; Turnidge, J.D.; et al. Antimicrobial Use Guidelines for Treatment of Urinary Tract Disease in Dogs and Cats: Antimicrobial Guidelines Working Group of the International Society for Companion Animal Infectious Diseases. Vet. Med. Int. 2011, 2011, 263768. [Google Scholar] [CrossRef] [Green Version]
  42. Rzewuska, M.; Czopowicz, M.; Kizerwetter-Swida, M.; Chrobak, D.; Blaszczak, B.; Binek, M. Multidrug Resistance in Escherichia coli Strains Isolated from Infections in Dogs and Cats in Poland (2007–2013). Sci. World J. 2015, 2015, 408205. [Google Scholar] [CrossRef] [Green Version]
  43. Thungrat, K.; Price, S.B.; Carpenter, D.M.; Boothe, D.M. Antimicrobial Susceptibility Patterns of Clinical Escherichia coli Isolates from Dogs and Cats in the United States: January 2008 through January 2013. Vet. Microbiol. 2015, 179, 287–295. [Google Scholar] [CrossRef] [PubMed]
  44. Murphy, C.; Reid-Smith, R.J.; Prescott, J.F.; Bonnett, B.N.; Mcewen, S.A. Occurrence of Antimicrobial Resistant Bacteria in Healthy Dogs and Cats Presented to Private Veterinary Hospitals in Southern Ontario: A Preliminary Study. Can. Vet. J. 2009, 50, 1047. [Google Scholar] [PubMed]
  45. Surgers, L.; Boyd, A.; Girard, P.M.; Arlet, G.; Decré, D. Biofilm Formation by ESBL-Producing Strains of Escherichia coli and Klebsiella pneumoniae. Int. J. Med. Microbiol. 2018, 309, 13–18. [Google Scholar] [CrossRef]
  46. Melo, L.C.; Oresco, C.; Leigue, L.; Netto, H.M.; Melville, P.A.; Benites, N.R.; Saras, E.; Haenni, M.; Lincopan, N.; Madec, J.Y. Prevalence and Molecular Features of ESBL/pAmpC-Producing Enterobacteriaceae in Healthy and Diseased Companion Animals in Brazil. Vet. Microbiol. 2018, 221, 59–66. [Google Scholar] [CrossRef] [PubMed]
  47. Maeyama, Y.; Taniguchi, Y.; Hayashi, W.; Ohsaki, Y.; Osaka, S.; Koide, S.; Tamai, K.; Nagano, Y.; Arakawa, Y.; Nagano, N. Prevalence of ESBL/AmpC Genes and Specific Clones among the Third-Generation Cephalosporin-Resistant Enterobacteriaceae from Canine and Feline Clinical Specimens in Japan. Vet. Microbiol. 2018, 216, 183–189. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  48. Bogaerts, P.; Huang, T.D.; Bouchahrouf, W.; Bauraing, C.; Berhin, C.; El Garch, F.; Glupczynski, Y.; ComPath Study, G. Characterization of ESBL- and AmpC-Producing Enterobacteriaceae from Diseased Companion Animals in Europe. Microb. Drug Resist 2015, 21, 643–650. [Google Scholar] [CrossRef] [PubMed]
  49. Shaheen, B.W.; Nayak, R.; Foley, S.L.; Kweon, O.; Deck, J.; Park, M.; Rafii, F.; Boothe, D.M. Molecular Characterization of Resistance to Extended-Spectrum Cephalosporins in Clinical Escherichia coli Isolates from Companion Animals in the United States. Antimicrob. Agents Chemother. 2011, 55, 5666–5675. [Google Scholar] [CrossRef] [Green Version]
  50. Abraham, S.; Jordan, D.; Wong, H.S.; Johnson, J.R.; Toleman, M.A.; Wakeham, D.L.; Gordon, D.M.; Turnidge, J.D.; Mollinger, J.L.; Gibson, J.S.; et al. First Detection of Extended-Spectrum Cephalosporin- and Fluoroquinolone-Resistant Escherichia coli in Australian Food-Producing Animals. J.Glob. Antimicrob. Resist. 2015, 3, 273–277. [Google Scholar] [CrossRef]
  51. Sidjabat, H.E.; Seah, K.Y.; Coleman, L.; Sartor, A.; Derrington, P.; Heney, C.; Faoagali, J.; Nimmo, G.R.; Paterson, D.L. Expansive Spread of IncI1 Plasmids Carrying blaCMY-2 amongst Escherichia coli. Int. J. Antimicrob. Agents 2014, 44, 203–208. [Google Scholar] [CrossRef]
  52. Abbas, G.; Khan, I.; Mohsin, M.; Sajjad Ur, R.; Younas, T.; Ali, S. High Rates of CTX-M Group-1 Extended-Spectrum Beta-Lactamases Producing Escherichia coli from Pets and Their Owners in Faisalabad, Pakistan. Infect. Drug Resist. 2019, 12, 571–578. [Google Scholar] [CrossRef] [Green Version]
  53. Liu, X.; Liu, H.; Li, Y.; Hao, C. High Prevalence of Beta-Lactamase and Plasmid-Mediated Quinolone Resistance Genes in Extended-Spectrum Cephalosporin-Resistant Escherichia coli from Dogs in Shanxi, China. Front. Microbiol. 2016, 7, 1843. [Google Scholar] [CrossRef] [Green Version]
  54. Rocha-Gracia, R.C.; Cortes-Cortes, G.; Lozano-Zarain, P.; Bello, F.; Martinez-Laguna, Y.; Torres, C. Faecal Escherichia coli Isolates from Healthy Dogs Harbour CTX-M-15 and CMY-2 Beta-Lactamases. Vet. J. 2015, 203, 315–319. [Google Scholar] [CrossRef] [PubMed]
  55. Igbinosa, I.H. Prevalence and Detection of Antibiotic-Resistant Determinant in Salmonella Isolated from Food-Producing Animals. Trop. Anim. Health Prod. 2015, 47, 37–43. [Google Scholar] [CrossRef] [PubMed]
  56. Wang, Y.; He, T.; Han, J.; Wang, J.; Foley, S.L.; Yang, G.; Wan, S.; Shen, J.; Wu, C. Prevalence of ESBLs and PMQR Genes in Fecal Escherichia coli Isolated from the Non-Human Primates in Six Zoos in China. Vet. Microbiol. 2012, 159, 53–59. [Google Scholar] [CrossRef] [PubMed]
  57. Gibson, J.S.; Cobbold, R.N.; Heisig, P.; Sidjabat, H.E.; Kyaw-Tanner, M.T.; Trott, D.J. Identification of qnr and aac(6’)-1b-cr Plasmid-Mediated Fluoroquinolone Resistance Determinants in Multidrug-Resistant Enterobacter spp. Isolated from Extraintestinal Infections in Companion Animals. Vet. Microbiol. 2010, 143, 329–336. [Google Scholar] [CrossRef]
  58. Wang, J.; Zhi, C.P.; Chen, X.J.; Guo, Z.W.; Liu, W.L.; Luo, J.; Huang, X.Y.; Zeng, L.; Huang, J.W.; Xia, Y.B.; et al. Characterization of oqxAB in Escherichia coli Isolates from Animals, Retail Meat, and Human Patients in Guangzhou, China. Front. Microbiol. 2017, 8, 1982. [Google Scholar] [CrossRef] [Green Version]
  59. Elmi, S.Y.K.; Ashour, M.S.; Alsewy, F.Z.; Abd El Moez Azzam, N.F. Phenotypic and Genotypic Detection of Extended Spectrum Beta-Lactamases among Escherichia coli and Klebsiella pneumoniae Isolates from Type 2 Diabetic Patients with Urinary Tract Infections. Afr. Health Sci. 2021, 21, 497–504. [Google Scholar] [CrossRef]
  60. Carniel, E. The Yersinia High-Pathogenicity Island: An Iron-Uptake Island. Microbes Infect. 2001, 3, 561–569. [Google Scholar] [CrossRef]
  61. Cespedes, S.; Saitz, W.; Del Canto, F.; De la Fuente, M.; Quera, R.; Hermoso, M.; Munoz, R.; Ginard, D.; Khorrami, S.; Giron, J.; et al. Genetic Diversity and Virulence Determinants of Escherichia coli Strains Isolated from Patients with Crohn’s Disease in Spain and Chile. Front. Microbiol. 2017, 8, 639. [Google Scholar] [CrossRef]
  62. Schubert, S.; Cuenca, S.; Fischer, D.; Heesemann, J. High-Pathogenicity Island of Yersinia Pestis in Enterobacteriaceae Isolated from Blood Cultures and Urine Samples: Prevalence and Functional Expression. J. Infect. Dis. 2000, 182, 1268–1271. [Google Scholar] [CrossRef] [Green Version]
  63. Tiwari, R.; Sharma, M.C.; Singh, B.P. Buffalo Calf Health Care in Commercial Dairy Farms: A Field Study in Uttar Pradesh (India). Livest. Res. Rural. Dev. 2007, 19, 8. [Google Scholar]
  64. Persoons, D.; Bollaerts, K.; Smet, A.; Herman, L.; Heyndrickx, M.; Martel, A.; Butaye, P.; Catry, B.; Haesebrouck, F.; Dewulf, J. The Importance of Sample Size in the Determination of a Flock-Level Antimicrobial Resistance Profile for Escherichia coli in Broilers. Microb. Drug Resist. 2011, 17, 513–519. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  65. Bourne, J.A.; Chong, W.L.; Gordon, D.M. Genetic Structure, Antimicrobial Resistance and Frequency of Human Associated Escherichia coli Sequence Types among Faecal Isolates from Healthy Dogs and Cats Living in Canberra, Australia. PLoS ONE 2019, 14, e0212867. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  66. CLSI. Performance Standards for Antimicrobial Susceptibility Testing: Twenty-second Informational Supplement; CLSI Document M100-S22; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2016. [Google Scholar]
  67. Magiorakos, A.P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-Resistant, Extensively Drug-Resistant and Pandrug-Resistant Bacteria: An International Expert Proposal for Interim Standard Definitions for Acquired Resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  68. Ahmed, A.M.; Motoi, Y.; Sato, M.; Maruyama, A.; Watanabe, H.; Fukumoto, Y.; Shimamoto, T. Zoo Animals as Reservoirs of Gram-Negative Bacteria Harboring Integrons and Antimicrobial Resistance Genes. Appl. Environ. Microbiol. 2007, 73, 6686–6690. [Google Scholar] [CrossRef] [Green Version]
  69. Bert, F.; Branger, C.; Lambert-Zechovsky, N. Identification of PSE and OXA Beta-Lactamase Genes in Pseudomonas Aeruginosa Using PCR-restriction Fragment Length Polymorphism. J. Antimicrob. Chemother. 2002, 50, 11–18. [Google Scholar] [CrossRef]
  70. Liao, X.P.; Xia, J.; Yang, L.; Li, L.; Sun, J.; Liu, Y.H.; Jiang, H.X. Characterization of CTX-M-14-Producing Escherichia coli from Food-Producing Animals. Front. Microbiol. 2015, 6, 1136. [Google Scholar] [CrossRef] [Green Version]
  71. Saenz, Y.; Brinas, L.; Dominguez, E.; Ruiz, J.; Zarazaga, M.; Vila, J.; Torres, C. Mechanisms of Resistance in Multiple-Antibiotic-resistant Escherichia coli Strains of Human, Animal, and Food Origins. Antimicrob. Agents Chemother. 2004, 48, 3996–4001. [Google Scholar] [CrossRef] [Green Version]
  72. Li, S.; Wang, L.; Zhou, Y.; Miao, Z. Prevalence and Characterization of Virulence Genes in Escherichia coli Isolated from Piglets Suffering Post-Weaning Diarrhoea in Shandong Province, China. Vet. Med. Sci. 2020, 6, 69–75. [Google Scholar] [CrossRef] [Green Version]
  73. Fernandes, J.B.; Zanardo, L.G.; Galvao, N.N.; Carvalho, I.A.; Nero, L.A.; Moreira, M.A. Escherichia coli from Clinical Mastitis: Serotypes and Virulence Factors. J. Vet. Diagn. Invest 2011, 23, 1146–1152. [Google Scholar] [CrossRef] [Green Version]
  74. Gioia-Di Chiacchio, R.M.; Cunha, M.P.V.; de Sa, L.R.M.; Davies, Y.M.; Pereira, C.B.P.; Martins, F.H.; Munhoz, D.D.; Abe, C.M.; Franzolin, M.R.; Dos Santos, L.F.; et al. Novel Hybrid of Typical Enteropathogenic Escherichia coli and Shiga-Toxin-Producing E. coli (tEPEC/STEC) Emerging From Pet Birds. Front. Microbiol. 2018, 9, 2975. [Google Scholar] [CrossRef] [PubMed]
  75. Picco, N.Y.; Alustiza, F.E.; Bellingeri, R.V.; Grosso, M.C.; Motta, C.E.; Larriestra, A.J.; Vissio, C.; Tiranti, K.I.; Terzolo, H.R.; Moreira, A.R.; et al. Molecular Screening of Pathogenic Escherichia coli Strains Isolated from Dairy Neonatal Calves in Cordoba Province, Argentina. Rev. Argent Microbiol. 2015, 47, 95–102. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Antibiotics 11 00828 g001 550
Figure 1. The serotypes (EIEC, EPEC, ETEC and No identified) proportion of E. coli isolates from companion animals.
Figure 1. The serotypes (EIEC, EPEC, ETEC and No identified) proportion of E. coli isolates from companion animals.
Antibiotics 11 00828 g001
Antibiotics 11 00828 g002 550
Figure 2. Antimicrobial resistance of ESBL producers and non-ESBL producers.
Figure 2. Antimicrobial resistance of ESBL producers and non-ESBL producers.
Antibiotics 11 00828 g002
Antibiotics 11 00828 g003 550
Figure 3. Prevalence of genotypic drug resistance. Resistant genes belonging to the same class of resistant phenotypes are shown in the same color.
Figure 3. Prevalence of genotypic drug resistance. Resistant genes belonging to the same class of resistant phenotypes are shown in the same color.
Antibiotics 11 00828 g003
Antibiotics 11 00828 g004 550
Figure 4. Distribution of virulence genes in E. coli strains.
Figure 4. Distribution of virulence genes in E. coli strains.
Antibiotics 11 00828 g004
Table
Table 1. Serotypes of DEC E. coli isolated from healthy and diarrhea companion animals.
Table 1. Serotypes of DEC E. coli isolated from healthy and diarrhea companion animals.
Clinical StatusETEC (n = 26)EPEC (n = 8)EIEC (n = 2)
healthyO6:K15(4), O78:K80(2), O25:K19(3), O8:K40(2), O9:K9(1), O20:K17(1), O7:K1(1)O114:K90(1), O128:K67(1), O125:K70(2),O29:K?(1), O124:K7(1)
diarrheaO6:K15(4), O78:K80(2), O25:K19(2), O8:K40(3), O15:K?(1)O114:K90(2), O128:K67(1), O142:K86(1)-
Table
Table 2. Six antibiotic classes resistance of ESBL-EC and non-ESBL producers among DEC isolates.
Table 2. Six antibiotic classes resistance of ESBL-EC and non-ESBL producers among DEC isolates.
Antibiotic ClassesNumber (%) of Resistant Isolates
ESBL (+)ESBL (−)
(n = 13)(n = 23)
β-lactames8 (61.5)10 (43.5)
Tetracyclines12 (92.3)17 (73.9)
Quinolones4 (3.1)2 (8.7)
Penicillins10 (76.9)12 (52.2)
Aminoglycosides4 (30.8)8 (34.8)
Carbapenems00
Table
Table 3. Correlation matrix between resistance phenotype and genotype.
Table 3. Correlation matrix between resistance phenotype and genotype.
Antibiotics Resistance PhenotypeCharacteristics of Strainsp Value 5
n-Pr 1Resistance Genesn-Gp 2P+/G− 3P−/G+ 4
CRO18blaCTX-M481310.010 *
blaSHV3211250.166
blaOXA2110.260
CEX39blaCTX-M483120.128
blaSHV3225180.738
blaOXA2020.007 **
FEP2blaCTX-M480460.496
blaSHV321311.000
blaOXA2111.000
GM22aaC42013110.889
19qnrA9540.786
qnrB6240.067
ENRqnrS15730.665
oqxA329220.446
aac (6′)-Ib-cr358240.325
1 n-Pr: number of strains expressing phenotypic antimicrobial resistance to the indicated antimicrobials. 2 n-Gp: number of strains harboring the indicated antimicrobial resistance genes. 3 P+/G−: number of phenotypic resistance strains (P+) with no resistance gene (G−) for the antimicrobial identified. 4 P−/G+: number of phenotypic susceptible strains (P−) with resistance genes (G+) for antimicrobials. 5 p value: * p < 0.05; ** p < 0.01.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Cui, L.; Zhao, X.; Li, R.; Han, Y.; Hao, G.; Wang, G.; Sun, S. Companion Animals as Potential Reservoirs of Antibiotic Resistant Diarrheagenic Escherichia coli in Shandong, China. Antibiotics 2022, 11, 828. https://doi.org/10.3390/antibiotics11060828

AMA Style

Cui L, Zhao X, Li R, Han Y, Hao G, Wang G, Sun S. Companion Animals as Potential Reservoirs of Antibiotic Resistant Diarrheagenic Escherichia coli in Shandong, China. Antibiotics. 2022; 11(6):828. https://doi.org/10.3390/antibiotics11060828

Chicago/Turabian Style

Cui, Lulu, Xiaonan Zhao, Ruibo Li, Yu Han, Guijuan Hao, Guisheng Wang, and Shuhong Sun. 2022. "Companion Animals as Potential Reservoirs of Antibiotic Resistant Diarrheagenic Escherichia coli in Shandong, China" Antibiotics 11, no. 6: 828. https://doi.org/10.3390/antibiotics11060828

APA Style

Cui, L., Zhao, X., Li, R., Han, Y., Hao, G., Wang, G., & Sun, S. (2022). Companion Animals as Potential Reservoirs of Antibiotic Resistant Diarrheagenic Escherichia coli in Shandong, China. Antibiotics, 11(6), 828. https://doi.org/10.3390/antibiotics11060828

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop