Next Article in Journal
Antibiotics Used for COVID-19 In-Patients from an Infectious Disease Ward
Next Article in Special Issue
Comparison of Broth Microdilution, Disk Diffusion and Strip Test Methods for Cefiderocol Antimicrobial Susceptibility Testing on KPC-Producing Klebsiella pneumoniae
Previous Article in Journal
Determinants of Knowledge, Attitude, and Practices of Veterinary Drug Dispensers toward Antimicrobial Use and Resistance in Main Cities of Malawi: A Concern on Antibiotic Stewardship
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antibiotics
Volume 12
Issue 1
10.3390/antibiotics12010148
antibiotics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Prevalence of Carbapenemase and Extended-Spectrum β-Lactamase Producing Enterobacteriaceae: A Cross-Sectional Study

by
Muhammad Muqaddas Mustafai
1,2,
Mavra Hafeez
3,
Safa Munawar
4,
Sakeenabi Basha
5,
Ali A. Rabaan
6,7,8,
Muhammad A. Halwani
9,
Abdulsalam Alawfi
10,
Amer Alshengeti
10,11,
Mustafa A. Najim
12,
Sara Alwarthan
13,
Meshal K. AlFonaisan
14,
Souad A. Almuthree
15,
Mohammed Garout
16 and
Naveed Ahmed
17,18,*
1
Department of Medical Education, Quaid e Azam Medical College, Bahawalpur 63100, Pakistan
2
Department of Emergency, Tehsil Headquarter Hospital Mailsi, Vehari 61200, Pakistan
3
Department of Medical Education, King Edward Medical University, Lahore 54000, Pakistan
4
Department of Medical Education, Nawaz Sharif Medical College, Gujrat 50700, Pakistan
5
Department of Community Dentistry, Faculty of Dentistry, Taif University, Taif 21944, Saudi Arabia
6
Molecular Diagnostic Laboratory, Johns Hopkins Aramco Healthcare, Dhahran 31311, Saudi Arabia
7
College of Medicine, Alfaisal University, Riyadh 11533, Saudi Arabia
8
Department of Public Health and Nutrition, The University of Haripur, Haripur 22610, Pakistan
9
Department of Medical Microbiology, Faculty of Medicine, Al Baha University, Al Baha 4781, Saudi Arabia
10
Department of Pediatrics, College of Medicine, Taibah University, Al-Madinah 41491, Saudi Arabia
11
Department of Infection Prevention and Control, Prince Mohammad Bin Abdulaziz Hospital, National Guard Health Affairs, Al-Madinah 41491, Saudi Arabia
12
Department of Medical Laboratories Technology, College of Applied Medical Sciences, Taibah University, Madinah 41411, Saudi Arabia
13
Department of Internal Medicine, College of Medicine, Imam Abdulrahman Bin Faisal University, Dammam 34212, Saudi Arabia
14
Basic Medical Sciences, Majmaah University, Majmaah 11952, Saudi Arabia
15
Department of Infectious Disease, King Abdullah Medical City, Makkah 43442, Saudi Arabia
16
Department of Community Medicine and Health Care for Pilgrims, Faculty of Medicine, Umm Al-Qura University, Makkah 21955, Saudi Arabia
17
Department of Microbiology, Faculty of Life Sciences, University of Central Punjab, Lahore 54000, Pakistan
18
Department of Medical Microbiology and Parasitology, School of Medical Sciences, Universiti Sains Malaysia, Kubang Kerian 16150, Malaysia
 
add Show full affiliation list
 
remove Hide full affiliation list
*
Author to whom correspondence should be addressed.
Antibiotics 2023, 12(1), 148; https://doi.org/10.3390/antibiotics12010148
Submission received: 22 November 2022 / Revised: 6 January 2023 / Accepted: 9 January 2023 / Published: 11 January 2023
(This article belongs to the Special Issue Carbapenem-Resistant Enterobacterales: Development of New Antibiotics)
Review Reports Versions Notes

Abstract

:
Enterobacteriaceae have been classified as severely drug resistant bacteria by the World Health Organization due to their extensive production and dissemination of carbapenemases (CPs) and extended-spectrum β-lactamases (ESBL). The current study was conducted with the aim to determine the prevalence of CP- and ESBL-producing Enterobacteriaceae, as well as their antibiotic susceptibility profiles. For this, a hospital-based study was conducted which included 384 participants with bacterial infections. The collection and processing of specimens was conducted per standard microbiological protocol. The samples were inoculated on agar media plates to obtain the bacterial growths, and if they were positive for any bacterial growth, the antibiotic susceptibility testing was performed using disk diffusion method to check their antibiotic susceptibility patterns. The double disc diffusion as well as carbapenem inhibition techniques were used to examine the CP enzymes. Multiplex real-time PCR technique was performed to identify three distinct genetic types of CPs that have been identified in the Enterobacteriaceae (KPC, NDM, and OXA-48). A majority of participants (58.3%) in the current study were living in urban areas. A total of 227 (59.1%) patients were hospitalized. Furthermore, 26.04% of the patients were determined to be suffering from infections with Enterobacteriaceae. Escherichia coli was the most prevalent (9.1%) isolate overall, followed by Klebsiella pneumoniae (8.07%), Acinetobacter baumannii (2.6%), Pseudomonas aeruginosa (3.1%), Enterobacter cloacae (1.3%), Proteus spp. (1.3%), and Morganella spp. (0.5%). The studied patients were suffering from urinary tract infections (48.6%), blood stream infections (32.2%), wounds infection (11.9%), and respiratory infections (7.03%), confirmed with bacterial cultures. The resistance against carbapenems was seen in 31.4% of E. coli isolates, 25.8% in K. pneumoniae, 50% in P. aeruginosa, 25% in A. baumannii, and 20% in E. cloacae isolates. Such high rates of CP- and ESBL-producing Enterobacteriaceae are alarming, suggesting high spread in the study area. It is advised to implement better infection prevention and control strategies and conduct further nationwide screening of the carriers of these pathogens. This might help in reducing the burden of highly resistant bugs.

1. Introduction

Globally, infections caused by Enterobacteriaceae have a significant role in both mortality and morbidity [1]. The administration of antibiotics as part of empirical therapy is considered both the cause of increasing drug resistance and the solution of infections [2]. However, the development of drug resistance to such medicines has evolved into a major health issue globally [3]. The Center for Disease Control and Prevention (CDC), United States of America (USA), believes infections caused by carbapenem-resistant Enterobacteriaceae (CRE) to be an urgent concern to public health because they are being reported more often across the world [4]. The large percentage of Enterobacteriaceae is due to their being naturally occurring inhabitants of a human gastrointestinal (GI) tract, and the illnesses they cause result from being forced out of that environment. They can cause a variety of diseases, such as wound infections, septicemia, and lower respiratory tract infections (LRTIs) [5].
The extended-spectrum β-lactamases (ESBLs) have been seen as a serious threat to public health since the beginning of the century [6]. Carbapenems antibiotics belong to the β-lactam family. ESBLs can hydrolyze the majority of antibiotics belonging to the β-lactam family, except for carbapenems [7]. A recent study discovered that Pakistan has an unacceptably high incidence of ESBLs (over 80%) [8]. Carbapenems are one of the few treatments still available for Enterobacteriaceae that produce ESBLs [9]. However, bacterial infections that produce carbapenemase (CP) and are resistant to carbapenems have been chosen as a result of the excessive use of carbapenems to treat ESBL-positive pathogens [2].
Carbapenem antibiotics are used as a last line of defense against multi-drug resistant (MDR) bacteria [10,11]. The carbapenems are usually considered as last-line drugs, especially for the treatment of critically ill patients or those having a Gram-negative infection which is resistant to the majority of antibiotics [11]. In hospitals throughout Southeast and South Asia, Gram-negative bacteria have high rates for carbapenem resistance [7,9]. In this case, the polymyxins may be chosen for treatment, but there are also some reports which showed polymyxin resistance by a mcr-1 gene, making the problem worsened [12,13]. The rapid rise in the prevalence of resistance to carbapenem among the Enterobacteriaceae is connected with health care, particularly Klebsiella pneumoniae (K. pneumoniae) and Escherichia coli (E. coli) which are significant causes for infection and the antibiotic resistance burden [4,14].
The threat of CRE is mainly due to the emergence and spread of carbapenemase (CPs)-producing bacteria [15,16]. The majority of strains that develop carbapenem resistance have been reported to produce CPs [17,18,19]. A recent study from Punjab, Pakistan, has reported 14.4% CP-producing Enterobacteriaceae [20]. The increased consumption of antibiotics in clinical settings could also increase the selection pressure of antibiotic resistance genes and may lead to high antimicrobial resistance rates [6,21]. However, the growth of carbapenem resistance could also be caused by the consumption of fishery products [22]. There have been several reports of bacteria recovered from fisheries’ products with plasmids carrying genes for carbapenem resistance [23,24,25]. Commercial shrimp were found to include Vibrio alginolyticus carrying the encoding VIM-1 and the encoding NDM-1 genes in a Chinese retail market [22]. In Vietnam, Enterobacteriaceae carrying the VIM-1 and NDM-1,4,5, KPC and OXA-48 have been isolated from fish and other sea animals [25]. In Pakistan, the antimicrobial resistance rates are continuously increasing and leading to significant health threats [2,8]. The current study was conducted with the aims to see the prevalence of CP-, CRE-, and ESBL-producing Enterobacteriaceae both phenotypically and genotypically.

2. Results

2.1. Demographic Charateristics

During the study period, a total of 1206 patients were tested for possible bacterial infections from which 384 patients were found positive for various bacterial infections. Hence, the current study included a total of 384 individuals with bacterial infections. A majority of the patients were male (n = 210, 54.7%) while the remaining 45.2% were female. Participants in the current study varied in age group from 16 to 80 years. In addition, the majority of participants (58.4%) lived in urban areas. A total of 227 (59.1%) patients were hospitalized (Table 1). A total of 100 (26%) patients were found suffering from infections with Enterobacteriaceae. Urban residents had a much greater infection rate than those who lived in rural areas (Table 1).
The prevalence of isolated bacterial isolates is shown in Table 2. E. coli constituted the most prevalent isolate overall, following K. pneumoniae, Acinetobacter baumannii (A. baumannii), Pseudomonas aeruginosa (P. aeruginosa), Enterobacter cloacae, Proteus spp., and then Morganella spp. (Table 2). UTI, blood stream infections, wounds infection, and respiratory infection proportions with culture confirmation were 44%, 23%, 22%, and 11%, respectively.

2.2. Antibiotic Resistance Profiles

Amoxicillin-clavulanic acid, cefotaxime, was the antibiotic to which the majority of the Enterobacteriaceae showed the strongest resistance. Amoxicillin-clavulanic acid resistance among the isolates was found to be quite high, as high as 97.1%, in E. coli., and 100 % in K. pneumoniae. The majority of isolates showed tolerance to cefotaxime in terms of 3rd Generation cephalosporin (Table 3).
The antibiotic susceptibility patterns of ESBL-producing Enterobacteriaceae has been showed in Table 4. All of the ESBL-producing bacteria were completely resistant (100%) to Amoxicillin-clavulanic acid, cefotaxime, and ceftazidime. The P. aeruginosa isolates showed 100% resistance to carbapenems, piperacillin-tazobactam, and cefepime.

2.3. ESBL and Carbapenemase Production Profiles

Table 5 shows that the majority of isolates of Enterobacteriaceae were ESBL-producing. Pseudomonas spp. and K. pneumoniae produced more ESBL. The detected CP producers included E. coli, K. pneumoniae, and E. cloacae. In this study, a total of 28 carbapenem-resistant, Gram-negative isolates were evaluated. Of these, 24 of them, clearly described by PCR, contain the mentioned CP genes.
All of the CR K. pneumoniae isolates were found to generate CP. Blood had a greater level of carbapenem resistance compared to the other samples. In contrast to other samples, blood had a greater frequency of ESBL-producing isolates (Table 5).

2.4. Real-Time Multiplex PCR Analysis

A total of 28 E. coli, 29 K. pneumoniae, 5 P. aeruginosa, 5 A. baumannii, and 4 E. cloacae isolates were tested for CTX, KPC, OXA-48, and NDM genes. The prevalence of these genes in each tested bacterium is shown in Table 6.

3. Discussion

Over the years, an increased rate of ESBL producers have been reported among infected patients in hospital settings [26,27,28]. In this scenario, the therapeutic and clinical consequences of the introduction of ESBL-producing as well as CR Enterobacteriaceae cause a drastic reduction in the treatment options [29]. Only limited options to treat these Gram-negative bacterial infections are available as they are widely resistant to most common antibiotics. The current study was conducted with the aims to see the prevalence of Enterobacteriaceae in terms of CP and ESBL production and their antibiotic susceptibility patterns in an underdeveloped area of Punjab, Pakistan.
From a total of 1206 patients, 384 were found positive for different bacterial infections. From these 384, a total of 100 isolates were belonging to Enterobacteriaceae. Most of the participants of the current study who were infected with Enterobacteriaceae were living in urban areas (65%) as compared to rural areas (35%). This could be connected to changes in the way patients are exposed to antibiotics, which is a key contributor to the development of antibiotic resistance. A similar previous study from Japan used multi drug resistant E. coli as an indicator for establishing antibiotic resistance and its direct impact on public health [30].
In the current study, compared to outpatients, inpatients had a considerably greater proportion (59.1%) of infections. In the current study, 23% of the Enterobacteriaceae were CP-producers. In a systematic assessment from Africa, eight distinct studies found a high prevalence of K. pneumoniae and E. coli that produce CP [31]. The prevalence of Enterobacteriaceae that produce ESBL was 67% in the current study which is consistent with an Iranian study (40.8%) [32] and an Indian study (48.2%) [33]. However, in Ethiopia, the prevalence of ESBL was 28.2% [34]. K. pneumoniae were among the most common producers of ESBLs in our investigation, even greater than that of the Ethiopian study (54.5%) [35] and for Burkina Faso (58%) [36]. The level of ESBL-producing E. coli in this research is comparable to a study conducted in Benin (36.2%) [37].
It is known that Enterobacteriaceae may acquire resistant plasmid from other bacterial species as well. Hence, the presence of a resistance gene poses a greater risk as it can be transmitted to potentially susceptible organisms. In Uganda, there is a lower prevalence of ESBL producers (28.1%) [38]. According to previous studies, there may be a larger colonization of Enterobacteriaceae in health facilities, which then, in turn, promotes the proliferation of ESBL- and CP-producing genes in strains linked to the medical industry [39]. Even if the severity of ESBL and CRE varies, all data revealed an increase in ESBL isolates in emerging economies, which may be related to the extensive utilization of cephalosporins, lax antibiotic use regulation, and empirical treatment. On the other hand, the administration of carbapenems in hospitalized patients, especially in surgical ICU, medical ICU, and other medical wards, is very common, and this might be a contributing factor for increasing carbapenem resistance in such cases [40].
In the current study, the E. coli isolates have shown a high resistance to amoxicillin-clavulanic acid (97.1%), cefotaxime (94.2%), and ceftazidime (91.4%). Contrarily, a study from Ethiopia [41] also showed higher resistance to amoxicillin-clavulanic acid (90.3%), amoxicillin-clavulanic acid (85.7%), and cefotaxime (56.5%). Another study has reported equal rates of ceftazidime (33%) and cefotaxime (31%) resistance [42]. The carbapenem resistance rates in the current study ranged from 20–30% among Enterobacteriaceae, which is relatively lower than that reported in Sindh province of Pakistan, around 59% [43]. Another study from Lahore, Punjab, reported a higher rate of carbapenem resistance in A. baumannii (85.8%) [5].
The results of the current study have shown that there was a difference in the antibiotic susceptibility patterns of ESBL- and non-ESBL-producing organisms. The overall carbapenem resistance was seen in 31.4% of non-ESBL-producing E. coli, while in the case of ESBL-producing E. coli, the carbapenem resistance rate was 39.2%. The non-ESBL-producing K. pneumoniae isolates have shown 25.8% carbapenem resistance while 27.5% resistance to carbapenems was seen in ESBL-producing K. pneumoniae isolates. A similar previous study from Pakistan has reported that the presence of ESBL-producing E. coli was 25.5%, from which around 20% of the isolates were resistant to carbapenems [44]. Another study from Rawalpindi, Pakistan, showed that an overall 19.3% were carbapenem-resistant [45].
A previous study from Rawalpindi, Pakistan, has reported that most of the CP-producing organisms were E. coli (86%) [20]. Another study has reported that CP genes were detected in 61 out of the 72 carbapenem-resistant isolates [45]. Results of the current study has showed that the most CP-producing organism was P. aeruginosa (30%), followed by K. pneumoniae (25.8%), E. coli (25.7%), A. baumannii (16.6%), and E. cloacae (20%). Furthermore, it was found in the current study that the prevalence of all drug-resistant bacteria was higher in urban areas as compared to the rural areas.
It was found in the current study that most of the Enterobacteriaceae were positive for the NDM gene followed by CTX, KPC, and OXA-48. Similar results were seen in another study from Pakistan, in which the most common CP-encoding gene was NDM [20]. Another study from Pakistan reported that the CTX gene was detected in 74.8% of the E. coli isolates [44]. The prevalence of CP and ESBL-producing Enterobacteriaceae are alarmingly increasing in the study area. Thus, improving the infection prevention strategy and further large-scale studies at the national level are recommended in order to prevent another pandemic.

Study Limitations

Because of ethical approval restriction, the data related to the total hospital days of patients, days of antibiotic therapy, and previous history of the antibiotic usage could not be added in the current study.

4. Materials and Methods

4.1. Ethical Approval

Before starting sample and data collection, signed informed consents were obtained from study participants. Study participants were informed about how the study will be conducted and their potential benefits for the community. Participants who did not give full information and/or permission to use their data were eliminated from the study. An ethical approval from the Institutional Research Board was obtained.

4.2. Study Plan and Timeframe

A regional research study was conducted from February 2022 to April 2022, in a secondary care hospital of district Vehari, Punjab, Pakistan. It has more than 1000 medical and non-medical staff members, and it includes 430 beds across medical, surgical, orthopedic, and pediatric wards. An average of 600 patients receive medical care each day.

4.3. Sample Size and Sampling Method

Applying v 3.5.1 of Epi info (publicly available program, http://www.cdc.gov, Accessed on 14 January 2022), the size of the sample was calculated by taking into account a 95% level of confidence, marginal variance (5%), as well as a ratio of 0.5% ESBL. Therefore, a total sampling size of 384 was determined. Until the needed sample size had been reached, patients who had been clinically supposed of having various infections were recruited. Participants in the research who could not provide full data, had an inadequate sample (Sputum/saliva), or provided an inadequate quantity of all samples were excluded.

4.4. Data Collection

One-on-one interviews were conducted with a questionnaire to collect the information on demographic factors along with individuals’ health records. The data related to the residence area of the patients were also collected in order to check whether there is any difference in terms of AMR rates. The residential area was categorized into rural and urban areas. The rural areas were the villages, towns, and small cities which have a few thousand inhabitants and were mostly lacking in amenities of civic and social life including fewer healthcare services while the urban areas were the well-developed cities with comparatively more population and more facilities, especially in terms of healthcare services.

4.5. Collection and Processing of Specimens

All of the samples from study participants were collected by following the standard microbiological techniques to minimize the risk of contamination. The urine samples were collected in tight capped, wide-mouth, sterile containers, while the blood samples (10 mL for adult, 5 mL for infants, and 2 mL for newborns) were collected in BACT/ALERT® culture media, aerobic and anaerobic vials (Biomerieux, Marcy-l’Étoile, France). For the collection of sputum sample, the participants were asked to wash their mouths using water, and then 2 mL of purulent sputum, inside a sterile container, was collected. Watery saliva Sputum samples were not processed utilizing microbiological techniques. Samples from the wound were collected with a syringe or a sterile swab, while the pus, purulent exudates, and discharge were aseptically taken out from base of the lesion. Brain–heart infusion transport medium was used to submerge the swab. After the collection of samples, these were packed in the sterile zipper plastic bags and kept in the tight capped container containing ice bags (2–8 °C) to transport into the microbiology section of the pathology laboratory for further processing.
After receiving the samples in the microbiology section, the containers were opened, and samples were taken out for further processing in the biosafety cabinet. The urine samples were inoculated on cysteine-lactose-electrolyte-deficient (CLED) agar media (Oxoid Limited, Hampshire, UK) with the help of a sterile disposable wire loop. The aseptically collected venous blood samples were placed in the Bact/Alert automated blood culture system (Biomerieux, Marcy-l’Étoile, France). After the instrument gave a notification for a positive blood culture, the samples were taken out from the instrument and reinoculated on blood, chocolate, and MacConkey (MAC) agar plates (Oxoid Limited, Hampshire, UK). The sputum, pus, wound swabs, and other samples were inoculated on blood, chocolate, and MAC agar plates.
After the inoculation of samples on various agar media plates, these were incubated at 37 °C for 18–24 h. The inoculated blood, CLED, and MAC plates were incubated under aerobic conditions, while the chocolate agar plates were incubated under anaerobic or microaerophilic conditions to obtain the growth of fastidious organisms. If there was no bacterial growth obtained after the first incubation period, the negative plates were incubated again for over 24 h. The inoculated plates were reported negative for bacterial growth if no growth had been obtained in 48 h of incubation period.

4.6. Identifying Bacterial Isolates

Using standard microbiology laboratory techniques, all isolates of the family Enterobacteriaceae were identified. Final identification of bacterial isolates was conducted using the Gram staining and biochemical tests. The biochemical tests used to identify the isolates were indole, the triple sugar iron (TSI), citrate, urease, oxidase, and motility tests [46].

4.7. Antimicrobial Susceptibility Testing

The clinical and laboratory standards institute (CLSI) recommended Kirby–Bauer disc diffusion method was applied to determine the susceptibility of all detected isolated bacteria to various antimicrobial agents on the Mueller–Hinton agar (MHA) plates. To obtain bacterial inoculum comparable to the McFarland turbidity (0.5) standard [47], pure bacterial colonies were suspended inside a tube of normal saline using 4 mL. The suspended colonies were uniformly spread on a Mueller–Hinton agar using a sterile swab before putting the discs on the MHA plate [47].
The mentioned antibiotic discs were used to test each isolate: amoxicillin (10 μg), amoxicillin-clavulanic acid (20 μg), cefotaxime (30 μg), ceftazidime (30 μg), cefepime (30 μg), meropenem (10 μg), imipenem (10 μg), gentamicin (10 μg), Amikacin (10 μg), Nitrofurantoin (10 μg), Piperacillin-tazobactam (10 μg), and sulfamethaxazole-trimethoprin (30 μg). The petri plates were incubated for 24 h at 37 °C. A digital caliper was used to measure the zone of inhibitions (ZOIs) surrounding the discs [48].
Depending on the standardized chart provided by CLSI recommendations [47], the antibiotics susceptibility tests were classified as sensitive, moderate, or resistant. If the isolate proved resistant to a minimum of one antibiotic in three different antimicrobial groups, the presence of multi-drug resistant Enterobacteriaceae was investigated.

4.8. Screening of ESBLs by Phenotypic Method

At first, the testing for ESBLs was performed by determining the diameters of the ZOIs caused either by amoxicillin-clavunate, cefotaxime, cefepime, or ceftazidime (30 μg) on the MHA plates [47]. According to the recommendation of CLSI, the ZOI breakpoints for amoxicillin-clavunate, ceftazidime, cefepime, and cefotaxime were 22 mm, 25 mm, and 27 mm, respectively [48].

4.9. Detection of Carbapenemase Producers

The modified carbapenem inhibitory method (mCIM), advised by CLSI [47], was used to evaluate bacterial isolates that had complete or intermediate resistance to at least one of the carbapenem (meropenem 10 μg, imipenem 10 μg) in the above-mentioned disc diffusion test. Therefore, the imipenem disc (10 μg) was administered after homogenizing the isolates in 3 mL of tryptic soya broth (TSB); the mixture was then cultured at 37 °C in the presence of climate air over 4 h. Meropenem and imipenem in TSB were then administered after the McFarland standards equivalent solution of the indicator organism (E. coli ATCC 25922), which is carbapenem sensitive, then swabbed onto a Mueller–Hinton agar. Zones of inhibition for carbapenems and other drugs were assessed after a 24-h incubation period at 37 °C. It was determined that a bacterial strain was a carbapenemases generator if it had pinpoint colonies inside an inhibition zone of 6 to 15 mm or even an inhibition zone of 16 to 18 mm and did not inhibit the E. coli ATCC 25922, which is carbapenem-susceptible [49].
As a quality control, throughout data collection, the data were examined to ensure that they were accurate and fully recorded on the spreadsheet. All laboratory tests were performed under strict adherence to quality assurance guidelines. While incubating 5% from the batch for an overnight period at 35–37 °C, media sterility was examined. Before usage, the medium, reagents, as well as antibiotic discs were examined for their expiration dates. Throughout the investigation, referent strains of Staphylococcus aureus (ATCC 25923), E. coli (ATCC 25922), Enterococcus faecalis (ATCC 29212), and P. aeruginosa (ATCC 27853) were utilized to evaluate the media capacity produced and to sustain growth of bacteria for cultures and susceptibility tests. E. coli ATCC 25922 and K. pneumoniae ATCC 700603 were chosen as negative and positive controls, accordingly, for the ESBL detection process. As negative and positive quality assurance isolates for detection of CPs, K. pneumoniae ATCC BAA1705 as well as K. pneumoniae ATCC BAA1706 were selected, respectively. The CLSI standards [47] were used to interpret the findings.

4.10. Gene Confirmation through Real Time PCR

Considering the manufacturer’s advice for quick identification and discrimination of the CTX, blaNDM, blaOXA-48, and blaKPC genes’ sequences associated with carbapenem resistance amongst gram-negative bacteria, all verified strains of CRE from the culture were examined using the Conventional Polymerase Chain Reaction [50].

4.10.1. Extraction of DNA

Isolation of the bacterial DNA was conducted by utilizing the NucliSens easyMAG platform and NucliSens magnetic extraction reagents (bioMérieux, Craponne, France). Extraction buffer (60 L) was used to recover the isolated DNA [1]. The extracted DNA was shifted to sterilized Eppendorf tube, and eluted DNA was, finally, stored at 4 °C for storage and further processing. After the extraction of DNA, the agarose gel electrophoresis was performed to check the presence of DNA. 1% agarose gel was prepared in 50X Tris-acetate-EDTA (TAE) buffer.

4.10.2. Primer Designing

The information about the baseline genes utilized in this test was found on the website http://www.lahey.org/studies/ (Accessed on 16 January 2022). Carbapenemases (Class A), which code for KPC type; oxacillinases (Class D), which code for OXA-48; and metalloenzymes (Class B), which code for NDM, IMP, and VIM, were the genes in question [10]. The GenBank (http://www.ncbi.nlm.nih.gov/genbank/) (Accessed on 16 January 2022) was used to retrieve these gene sequences of blaCTX, blaKPC, blaOXA-48, blaNDM-1. Primers were created particularly to amplify every allele of each carbapenemase family of genes listed above based on the thorough studies as well as alignments of every carbapenemase type. The Lasergen software programmer (DNASTAR, Madison, WI) was used to figure out the melting point (Tm) of each gene from the carbapenemase family that was amplified. Primers CTX, IMP, KPC, and NDM pairs then were modified from formerly released sequences [31]. The primer was tested in a single Reaction PCR configuration. In order to verify that the primers were successfully amplified at their particular locus, its amplicon displayed the predicted Tm in order to verify the accuracy of the real-time PCR. Structure of the Multiplex was then improved by measuring various primer pair concentrations. A 2% agarose gel in electrophoresis was used to confirm the length of every PCR result. IDT created all of the primers (Coralville, IA, USA). Table 7 lists primer sequences with references.

4.10.3. Multiplex Real Time PCR

The amplifications of desired genes were conducted using real-time polymerase chain reactions conducted in 25 mL of Master Mix containing distilled water, primer, and 1 mL of DNA template. The PCR conditions were taken from the previously published studies [51,52].
Each of the positive controls were evaluated in quadruplicate within the same cycle and in three other runs in order to evaluate the data from this novel multiplex, real-time PCR method. In order to determine how consistently the assay performed across and within runs, means of the melting temperature, standard deviation, and variation coefficient were computed [53].

4.11. Statistical Analysis

At first, the data were entered into a Microsoft Excel sheet (Microsoft, Redmond, WA, USA) and then transferred to a Statistical Package for Social Science (SPSS) version 22.0 (IBM USA) spreadsheet. Frequencies (n) and percentages (%) were calculated and summarized in tables to show the frequency of demographic characteristics. The Fisher’s exact test was run to see the statistical differences among different variables. A p-value of <0.05 was considered statistically significant.

5. Conclusions

Results of the current study have shown an alarming rise in antibiotic resistance among Enterobacteriaceae along with ESBL- and CP-producing characteristics which might lead to a higher prevalence of MDR bacteria in near future. Another major issue reported in the current study was resistance to 3rd and 4th generation cephalosporins. Therefore, actions to improve the infection prevention and control measures must be taken. Policy makers of the country must take increasing antibiotic resistance into account and issue guidelines for better management of such patients infected with MDR, XDR and CREs. There should be rules for selling, purchasing and prescribing the antibiotics in order to minimize the usage of antibiotics. The antibiotics should only be prescribed after seeing the bacterial culture reports and their antibiotic susceptibility patterns. Furthermore, large-scale national surveillance on the profile of carbapenem resistance, CP production, and ESBL production and their determining genes among Enterobacteriaceae clinical isolates is required to adjust the routine use of antimicrobials.

Author Contributions

Conceptualization, M.M.M. and N.A.; methodology, M.M.M., M.H. and S.M.; software, A.A.R., M.A.H., A.A. (Abdulsalam Alawfi) and A.A. (Amer Alshengeti); validation, M.A.N., S.A., M.K.A., S.A.A. and M.G.; formal analysis, M.M.M., M.H. and S.M.; investigation, M.M.M., M.H. and S.M.; resources, A.A.R., M.A.H., A.A. (Abdulsalam Alawfi) and A.A. (Amer Alshengeti); data curation, N.A., M.M.M., M.H. and S.M.; writing—original draft preparation, A.A.R., M.A.H., A.A. (Abdulsalam Alawfi) and A.A. (Amer Alshengeti); writing—review and editing, S.B., A.A.R., N.A., M.G. and S.A.A.; supervision, N.A.; project administration, N.A.; All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki and approved by the Institutional Review Board of Tehsil Headquarter Hospital Mailsi, District Vehari, Punjab, Pakistan (protocol code: THQ/GOP/01/01456, approved on 3 January 2022).

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study. Written informed consent has been obtained from the patients to publish this paper.

Data Availability Statement

More data related to the current study is available upon a reasonable request to [email protected].

Acknowledgments

Naveed Ahmed would like to acknowledge USM Graduate research assistance scheme. The authors would also like to acknowledge that this research was supported by Taif University Researchers support project Number (TURSP-2020/62), Taif University, P.O. Box-11099, Taif-21944, Saudi Arabia.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Mohammed, A.B.; Anwar, K.A. Phenotypic and genotypic detection of extended spectrum beta lactamase enzyme in Klebsiella pneumoniae. PLoS ONE 2022, 17, e0267221. [Google Scholar] [CrossRef] [PubMed]
  2. Idrees, M.M.; Rasool, M.F.; Imran, I.; Khalid, A.; Saeed, A.; Ahmad, T.; Alqahtani, F. A Cross-Sectional Study to Evaluate Antimicrobial Susceptibility of Uropathogens from South Punjab, Pakistan. Infect. Drug Resist. 2022, 15, 1845–1855. [Google Scholar] [CrossRef]
  3. Rabaan, A.A.; Alhumaid, S.; Mutair, A.A.; Garout, M.; Abulhamayel, Y.; Halwani, M.A.; Alestad, J.H.; Bshabshe, A.A.; Sulaiman, T.; AlFonaisan, M.K. Application of Artificial Intelligence in Combating High Antimicrobial Resistance Rates. Antibiotics 2022, 11, 784. [Google Scholar] [CrossRef]
  4. Iovleva, A.; Doi, Y. Carbapenem-resistant enterobacteriaceae. Clin. Lab. Med. 2017, 37, 303–315. [Google Scholar] [CrossRef]
  5. Khalid, F.; Saleem, S.; Ahmad, I. High prevalence of carbapenem-resistant Acinetobacter baumannii associated respiratory tract infections in Pakistani hospitals. J. Pak. Med. Assoc 2020, 70, 1630–1632. [Google Scholar] [CrossRef] [PubMed]
  6. Tadesse, S.; Mulu, W.; Genet, C.; Kibret, M.; Belete, M.A. Emergence of high prevalence of extended-spectrum beta-lactamase and carbapenemase-producing Enterobacteriaceae species among patients in Northwestern Ethiopia Region. BioMed Res. Int. 2022, 2022, 5727638. [Google Scholar] [CrossRef] [PubMed]
  7. Machado, E.; Costa, P.; Carvalho, A.; Investigators, S. Occurrence of Healthcare-Associated Infections (HAIs) by Escherichia coli and Klebsiella spp. producing extended-spectrum β-lactamases (ESBL) and/or carbapenemases in portuguese long-term care facilities. Pathogens 2022, 11, 1019. [Google Scholar] [CrossRef]
  8. Nahid, F.; Khan, A.A.; Rehman, S.; Zahra, R. Prevalence of metallo-β-lactamase NDM-1-producing multi-drug resistant bacteria at two Pakistani hospitals and implications for public health. J. Infect. Public Health 2013, 6, 487–493. [Google Scholar] [CrossRef] [Green Version]
  9. Idrees, M.M.; Saeed, A. Genetic and molecular mechanisms of multidrug-resistance in uropathogens and novel therapeutic combat. In Biochemistry of Drug Resistance; Springer: Washington, DC, USA, 2021; pp. 505–538. [Google Scholar]
  10. Nordmann, P.; Naas, T.; Poirel, L. Global spread of carbapenemase-producing Enterobacteriaceae. Emerg. Infect. Dis. 2011, 17, 1791–1798. [Google Scholar] [CrossRef]
  11. Papp-Wallace, K.M.; Endimiani, A.; Taracila, M.A.; Bonomo, R.A. Carbapenems: Past, present, and future. Antimicrob. Agents Chemother. 2011, 55, 4943–4960. [Google Scholar] [CrossRef]
  12. Biedenbach, D.; Bouchillon, S.; Hackel, M.; Hoban, D.; Kazmierczak, K.; Hawser, S.; Badal, R. Dissemination of NDM metallo-β-lactamase genes among clinical isolates of Enterobacteriaceae collected during the SMART global surveillance study from 2008 to 2012. Antimicrob. Agents Chemother. 2015, 59, 826–830. [Google Scholar] [CrossRef] [Green Version]
  13. Liu, Y.-Y.; Wang, Y.; Walsh, T.R.; Yi, L.-X.; Zhang, R.; Spencer, J.; Doi, Y.; Tian, G.; Dong, B.; Huang, X. Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: A microbiological and molecular biological study. Lancet Infect. Dis. 2016, 16, 161–168. [Google Scholar] [CrossRef] [PubMed]
  14. Yusof, N.Y.; Norazzman, N.I.I.; Hakim, S.N.a.W.A.; Azlan, M.M.; Anthony, A.A.; Mustafa, F.H.; Ahmed, N.; Rabaan, A.A.; Almuthree, S.A.; Alawfi, A. Prevalence of Mutated Colistin-Resistant Klebsiella pneumoniae: A Systematic Review and Meta-Analysis. Trop. Med. Infect. Dis. 2022, 7, 414. [Google Scholar] [CrossRef]
  15. Ahmed, N.; Tahir, K.; Aslam, S.; Cheema, S.M.; Rabaan, A.A.; Turkistani, S.A.; Garout, M.; Halwani, M.A.; Aljeldah, M.; Al Shammari, B.R. Heavy Metal (Arsenic) Induced Antibiotic Resistance among Extended-Spectrum β-Lactamase (ESBL) Producing Bacteria of Nosocomial Origin. Pharmaceuticals 2022, 15, 1426. [Google Scholar] [CrossRef] [PubMed]
  16. Rabaan, A.A.; Eljaaly, K.; Alhumaid, S.; Albayat, H.; Al-Adsani, W.; Sabour, A.A.; Alshiekheid, M.A.; Al-Jishi, J.M.; Khamis, F.; Alwarthan, S. An Overview on Phenotypic and Genotypic Characterisation of Carbapenem-Resistant Enterobacterales. Medicina 2022, 58, 1675. [Google Scholar] [CrossRef]
  17. Nordmann, P.; Gniadkowski, M.; Giske, C.; Poirel, L.; Woodford, N.; Miriagou, V.; European Network on Carbapenemases. Identification and screening of carbapenemase-producing Enterobacteriaceae. Clin. Microbiol. Infect. 2012, 18, 432–438. [Google Scholar] [CrossRef] [Green Version]
  18. Baran, I.; Aksu, N. Phenotypic and genotypic characteristics of carbapenem-resistant Enterobacteriaceae in a tertiary-level reference hospital in Turkey. Ann. Clin. Microbiol. Antimicrob. 2016, 15, 20. [Google Scholar] [CrossRef] [Green Version]
  19. Arnold, R.S.; Thom, K.A.; Sharma, S.; Phillips, M.; Johnson, J.K.; Morgan, D.J. Emergence of Klebsiella pneumoniae carbapenemase (KPC)-producing bacteria. South. Med. J. 2011, 104, 40–45. [Google Scholar] [CrossRef] [Green Version]
  20. Habib, A.; Lo, S.; Villageois-Tran, K.; Petitjean, M.; Malik, S.A.; Armand-Lefevre, L.; Ruppe, E.; Zahra, R. Dissemination of carbapenemase-producing Enterobacterales in the community of Rawalpindi, Pakistan. PLoS ONE 2022, 17, e0270707. [Google Scholar] [CrossRef]
  21. Imkamp, F.; Kolesnik-Goldmann, N.; Bodendoerfer, E.; Zbinden, R.; Mancini, S. Detection of Extended-Spectrum β-Lactamases (ESBLs) and AmpC in Class A and Class B Carbapenemase-Producing Enterobacterales. Microbiol. Spectr. 2022, 10, e0213722. [Google Scholar] [CrossRef] [PubMed]
  22. Zheng, Z.; Ye, L.; Chan, E.W.-C.; Chen, S. Identification and characterization of a conjugative bla VIM-1-bearing plasmid in Vibrio alginolyticus of food origin. J. Antimicrob. Chemother. 2019, 74, 1842–1847. [Google Scholar] [CrossRef]
  23. Bonardi, S.; Pitino, R. Carbapenemase-producing bacteria in food-producing animals, wildlife and environment: A challenge for human health. Ital. J. Food Saf. 2019, 8, 7956. [Google Scholar] [CrossRef]
  24. Kalasseril, S.G.; Krishnan, R.; Vattiringal, R.K.; Paul, R.; Mathew, P.; Pillai, D. Detection of New Delhi metallo-β-lactamase 1 and cephalosporin resistance genes among carbapenem-resistant Enterobacteriaceae in water bodies adjacent to hospitals in India. Curr. Microbiol. 2020, 77, 2886–2895. [Google Scholar] [CrossRef]
  25. Nakayama, T.; Hoa, T.T.T.; Huyen, H.M.; Yamaguchi, T.; Jinnai, M.; Minh, D.T.N.; Hoang, O.N.; Le Thi, H.; Thanh, P.N.; Hoai, P.H. Isolation of carbapenem-resistant Enterobacteriaceae harbouring NDM-1, 4, 5, OXA48 and KPC from river fish in Vietnam. Food Control 2022, 133, 108594. [Google Scholar] [CrossRef]
  26. Thaden, J.T.; Fowler, V.G.; Sexton, D.J.; Anderson, D.J. Increasing incidence of extended-spectrum β-lactamase-producing Escherichia coli in community hospitals throughout the southeastern United States. Infect. Control Hosp. Epidemiol. 2016, 37, 49–54. [Google Scholar] [CrossRef] [Green Version]
  27. Onduru, O.G.; Mkakosya, R.S.; Aboud, S.; Rumisha, S.F. Genetic determinants of resistance among ESBL-producing enterobacteriaceae in community and hospital settings in east, central, and Southern Africa: A systematic review and meta-analysis of prevalence. Can. J. Infect. Dis. Med. Microbiol. 2021, 2021, 5153237. [Google Scholar] [CrossRef]
  28. Coque, T.M.; Baquero, F.; Canton, R. Increasing prevalence of ESBL-producing Enterobacteriaceae in Europe. Eurosurveillance 2008, 13, 19044. [Google Scholar] [CrossRef] [PubMed]
  29. Vink, J.; Edgeworth, J.; Bailey, S. Acquisition of MDR-GNB in hospital settings: A systematic review and meta-analysis focusing on ESBL-E. J. Hosp. Infect. 2020, 106, 419–428. [Google Scholar] [CrossRef] [PubMed]
  30. Ham, Y.-S.; Kobori, H.; Kang, J.-H.; Matsuzaki, T.; Iino, M.; Nomura, H. Distribution of antibiotic resistance in urban watershed in Japan. Environ. Pollut. 2012, 162, 98–103. [Google Scholar] [CrossRef]
  31. Ssekatawa, K.; Byarugaba, D.K.; Wampande, E.; Ejobi, F. A systematic review: The current status of carbapenem resistance in East Africa. BMC Res. Notes 2018, 11, 629. [Google Scholar] [CrossRef] [PubMed]
  32. Sharif, M.R.; Soltani, B.; Moravveji, A.; Erami, M.; Soltani, N. Prevalence and risk factors associated with extended spectrum beta lactamase producing Escherichia coli and Klebsiella pneumoniae isolates in hospitalized patients in Kashan (Iran). Electron. Physician 2016, 8, 2081. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Shaikh, S.; Fatima, J.; Shakil, S.; Rizvi, S.M.D.; Kamal, M.A. Risk factors for acquisition of extended spectrum beta lactamase producing Escherichia coli and Klebsiella pneumoniae in North-Indian hospitals. Saudi J. Biol. Sci. 2015, 22, 37–41. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Legese, M.H.; Weldearegay, G.M.; Asrat, D. Extended-spectrum beta-lactamase-and carbapenemase-producing Enterobacteriaceae among Ethiopian children. Infect. Drug Resist. 2017, 10, 27–34. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Eshetie, S.; Unakal, C.; Gelaw, A.; Ayelign, B.; Endris, M.; Moges, F. Multidrug resistant and carbapenemase producing Enterobacteriaceae among patients with urinary tract infection at referral Hospital, Northwest Ethiopia. Antimicrob. Resist. Infect. Control 2015, 4, 12. [Google Scholar] [CrossRef] [Green Version]
  36. Ouedraogo, A.-S.; Sanou, M.; Kissou, A.; Sanou, S.; Solaré, H.; Kaboré, F.; Poda, A.; Aberkane, S.; Bouzinbi, N.; Sano, I. High prevalence of extended-spectrum ß-lactamase producing enterobacteriaceae among clinical isolates in Burkina Faso. BMC Infect. Dis. 2016, 16, 326. [Google Scholar] [CrossRef] [Green Version]
  37. Anago, E.; Ayi-Fanou, L.; Akpovi, C.D.; Hounkpe, W.B.; Agassounon-Djikpo Tchibozo, M.; Bankole, H.S.; Sanni, A. Antibiotic resistance and genotype of beta-lactamase producing Escherichia coli in nosocomial infections in Cotonou, Benin. Ann. Clin. Microbiol. Antimicrob. 2015, 14, 5. [Google Scholar] [CrossRef] [Green Version]
  38. Ampaire, L.; Nduhura, E.; Wewedru, I. Phenotypic prevalence of extended spectrum beta-lactamases among enterobacteriaceae isolated at Mulago National Referral Hospital: Uganda. BMC Res. Notes 2017, 10, 448. [Google Scholar] [CrossRef] [Green Version]
  39. Amladi, A.U.; Sudarsanam, T.D.; Kandasamy, S.; Kekre, N.; Veeraraghavan, B.; Sahni, R.D. Evaluation of CHROMagar™ TMmSuperCARBA™ as a Phenotypic Test for Detection of Carbapenemase Producing Organisms. J. Clin. Diagn. Res. 2019, 13, 11–15. [Google Scholar]
  40. Potter, R.F.; D’Souza, A.W.; Dantas, G. The rapid spread of carbapenem-resistant Enterobacteriaceae. Drug Resist. Updates 2016, 29, 30–46. [Google Scholar] [CrossRef] [Green Version]
  41. Kengne, M.; Dounia, A.T.; Nwobegahay, J.M. Bacteriological profile and antimicrobial susceptibility patterns of urine culture isolates from patients in Ndjamena, Chad. Pan Afr. Med. J. 2017, 28, 258. [Google Scholar] [CrossRef]
  42. Agyepong, N.; Govinden, U.; Owusu-Ofori, A.; Essack, S.Y. Multidrug-resistant gram-negative bacterial infections in a teaching hospital in Ghana. Antimicrob. Resist. Infect. Control 2018, 7, 37. [Google Scholar] [CrossRef]
  43. Apanga, P.A.; Ahmed, J.; Tanner, W.; Starcevich, K.; VanDerslice, J.A.; Rehman, U.; Channa, N.; Benson, S.; Garn, J.V. Carbapenem-resistant Enterobacteriaceae in sink drains of 40 healthcare facilities in Sindh, Pakistan: A cross-sectional study. PLoS ONE 2022, 17, e0263297. [Google Scholar] [CrossRef] [PubMed]
  44. Bilal, H.; Rehman, T.U.; Khan, M.A.; Hameed, F.; Jian, Z.G.; Han, J.; Yang, X. Molecular Epidemiology of mcr-1, blaKPC-2, and blaNDM-1 Harboring Clinically Isolated Escherichia coli from Pakistan. Infect. Drug Resist. 2021, 14, 1467–1479. [Google Scholar] [CrossRef]
  45. Braun, S.D.; Jamil, B.; Syed, M.A.; Abbasi, S.A.; Weiß, D.; Slickers, P.; Monecke, S.; Engelmann, I.; Ehricht, R. Prevalence of carbapenemase-producing organisms at the Kidney Center of Rawalpindi (Pakistan) and evaluation of an advanced molecular microarray-based carbapenemase assay. Future Microbiol. 2018, 13, 1225–1246. [Google Scholar] [CrossRef] [Green Version]
  46. Vandepitte, J.; Verhaegen, J.; Engbaek, K.; Piot, P.; Heuck, C.C.; Rohner, P.; Heuck, C. Basic Laboratory Procedures in Clinical Bacteriology; World Health Organization: Geneva, Switzerland, 2003. [Google Scholar]
  47. Wayne, P. Performance Standards for Antimicrobial Susceptibility Testing; Clinical and Laboratory Standards Institute: Berwyn, PA, USA, 2011. [Google Scholar]
  48. Hasan, D.L.; Khalid, H.M.; Mero, W.M. Phenotypic and Molecular Study of Extended-Spectrum β-lactamases Producing Enterobacteriaceae from Urinary Tract Infection in Zakho city, Kurdistan Region/Iraq. Acad. J. Nawroz Univ. 2022, 11, 305–313. [Google Scholar] [CrossRef]
  49. Abe, R.; Akeda, Y.; Iida, T.; Hamada, S. Population Analysis Profiling: Is It Still the Gold Standard for the Determination of Heteroresistance in Carbapenemase-Producing Enterobacteriaceae? Int. J. Antimicrob. Agents 2022, 60, 106644. [Google Scholar] [CrossRef]
  50. Dhital, R.; Shen, Z.; Zhang, S.; Mustapha, A. Detection of virulence and extended spectrum β-lactamase genes in Salmonella by multiplex high-resolution melt curve real-time PCR assay. J. Appl. Microbiol. 2022, 132, 2355–2367. [Google Scholar] [CrossRef]
  51. Naderi Mezajin, M.; Fatemizadeh, M.; Rostami, Z.; Khaki, P.; Shirzad, M.; Noorbakhsh, F. Antibiotic resistance pattern and frequency of SHV, CTX, TEM, and OXA resistance gene among salmonella serotypes. Health Biotechnol. Biopharma 2022, 6, 64–77. [Google Scholar]
  52. Suranadee, Y.; Jyalathacrachchi, H.; Gamage, S.; Gunasekara, S. P32 Occurrence of bla KPC, bla NDM and bla OXA-48 genes among carbapenemase-producing Enterobacteriaceae (CRE) in National Cancer Institute, Sri Lanka. JAC-Antimicrob. Resist. 2022, 4, dlac004.031. [Google Scholar] [CrossRef]
  53. Vamsi, S.K.; Moorthy, R.S.; Hemiliamma, M.N.; Reddy, R.B.C.; Sirikonda, S. Phenotypic and genotypic detection of carbapenemase production among gram negative bacteria isolated from hospital acquired infections. Saudi Med. J. 2022, 43, 236–243. [Google Scholar] [CrossRef] [PubMed]
Table
Table 1. Demographic characteristics and infections with Enterobacteriaceae that were found positive in a culture using various clinical samples.
Table 1. Demographic characteristics and infections with Enterobacteriaceae that were found positive in a culture using various clinical samples.
VariableTotal Samples (n)Positive Samples for Enterobacteriaceae (n)Prevalence (%)p-Value
Age (years)0.63
<1859112.8
18–2863143.6
29–3858143.6
39–4865143.6
49–6045133.3
>6094348.8
Gender0.35
Female1744812.4
Male2105213.5
Area of residence<0.05 *
Urban1606516.9
Rural224359.1
Admission department<0.05 *
ICU92277.0
Medical1074311.1
Surgery28133.3
OPD157174.4
Hospital setting<0.01 *
In–patient2278321.6
Out–patient157174.4
Total38410026.0
ICU: Intensive care unit. OPD: outpatient department. * Statistically significant. n: numbers. %: percentage.
Table
Table 2. Prevalence of Enterobacteriaceae in clinical specimens taken from various infection sites, hospitalization statuses, and residence areas of patients.
Table 2. Prevalence of Enterobacteriaceae in clinical specimens taken from various infection sites, hospitalization statuses, and residence areas of patients.
VariablesE. coliK. pneumoniaeP. aeruginosaA. baumanniiE. cloacaeProteus Spp.Morganella Spp.
Specimen type
Urine (n = 187)22 (11.7%)7 (3.7%)7 (3.7%)4 (2.1%)1 (0.5%)2 (1.0%)1 (0.5%)
Blood (n = 124)3 (2.4%)13 (10.4%)2 (1.6%)3 (2.4%)2 (1.6%)--
Sputum (n = 27)2 (7.4%)5 (18.5%)-2 (7.4%)1 (3.7%)1 (3.7%)-
Wound Sample (n = 46)8 (17.3%)6 (13.04%)1 (2.1%)3 (6.5%)1 (2.1%)2 (4.3%)1 (2.1%)
Hospitalization status
ICU (n = 92)10 (10.8%)5 (5.4%)3 (3.2%)6 (6.5%)1 (1.0%)1 (1.0%)1 (1.0%)
Medical (n = 107)14 (13.0%)16 (14.9%)4 (3.7%)2 (1.8%)3 (2.8%)3 (2.8%)1 (0.9%)
Surgery (n = 28)6 (21.4%)4 (14.2%)-3 (10.7%)---
OPD (n = 157)5 (3.1%)6 (3.8%)3 (1.9%)1 (0.6%)1 (0.6%)1 (0.6%)-
Area of residence
Urban (n = 160)19 (11.8%)14 (8.7%)6 (3.7%)5 (3.1%)3 (1.8%)3 (1.8%)-
Rural (n = 224)16 (7.1%)17 (7.5%)4 (1.7%)7 (3.1%)2 (0.8%)2 (0.8%)2 (0.8%)
Total (n = 384)35 (9.1%)31 (8.0%)10 (2.6%)12 (3.1%)5 (1.3%)5 (1.3%)2 (0.5%)
ICU: Intensive care unit. OPD: outpatient department. n: numbers. %: percentage.
Table
Table 3. Antimicrobial resistance profiling of Enterobacteriaceae.
Table 3. Antimicrobial resistance profiling of Enterobacteriaceae.
AntimicrobialsE. coli (n = 35)
(n/%)		K. pneumoniae
(n = 31)
(n/%)		P. aeruginosa
(n = 10)
(n/%)		A. baumannii
(n = 12)
(n/%)		E. cloacae
(n = 5)
(n/%)
Amoxicillin–clavulanic acid34 (97.1)31 (100)-1 (8.3)5 (100)
Amikacin20 (57.1)21 (67.7)1 (10)--
Nitrofurantoin25 (71.4)23 (74.1)--1 (20)
Sulfamethaxazole-trimethoprin26 (74.2)23 (74.1)-4 (33.3)4 (80)
Gentamicin21 (60.0)19 (61.2)4 (40)3 (25)1 (20)
Chloramphenicol25 (71.4)26 (83.8)-9 (75)0
Cefotaxime33 (94)30 (96.7)--5 (100)
Ceftazidime32 (91.4)29 (93.5)6 (60)4 (33.3)4 (80)
Cefepime26 (74.2)29 (93.5)5 (50)4 (33.3)4 (80)
Meropenem11 (31.4)8 (25.8)5 (50)3 (25)1 (20)
Imipenem11 (31.4)8 (25.8)5 (50)3 (25)1 (20)
Piperacillin-tazobactam22 (62.8)24 (77.4)6 (60)3 (25)1 (20)
n: numbers. %: percentage.
Table
Table 4. Antimicrobial resistance profiling of ESBL-producing Enterobacteriaceae.
Table 4. Antimicrobial resistance profiling of ESBL-producing Enterobacteriaceae.
AntimicrobialsE. coli (n = 28)
(n/%)		K. pneumoniae
(n = 29)
(n/%)		P. aeruginosa
(n = 5)
(n/%)		A. baumannii
(n = 5)
(n/%)		E. cloacae
(n = 4)
(n/%)
Amoxicillin–clavulanic acid28 (100)29 (100)-5 (100)4 (100)
Amikacin18 (64.2)19 (65.5)1 (20)--
Nitrofurantoin21 (75)22 (75.8)--1 (25)
Sulfamethaxazole-trimethoprin22 (78.5)22 (75.8)-4 (80)4 (100)
Gentamicin17 (60.7)16 (55.1)4 (80)3 (60)1 (25)
Chloramphenicol22 (78.5)24 (82.7)-5 (100)0
Cefotaxime28 (100)29 (100)-5 (100.)4 (100)
Ceftazidime28 (100)29 (100)-5 (100)4 (100)
Cefepime21 (75)22 (75.8)5 (100)4 (80)4 (100)
Meropenem11 (39.2)8 (27.5)5 (100)3 (60)1 (25)
Imipenem11 (39.2)8 (27.5)5 (100)3 (60)1 (25)
Piperacillin-tazobactam20 (71.4)22 (75.8)5 (100)3 (60)1 (25)
n: numbers. %: percentage.
Table
Table 5. Prevalence of ESBL, carbapenem resistance, and carbapenemase producers.
Table 5. Prevalence of ESBL, carbapenem resistance, and carbapenemase producers.
CharacteristicsESBL Producers
(n, %)		Carbapenems Resistance
(n, %)		Carbapenemase Producers
(n, %)
Hospitalization status
E. coliICU6, 17.15, 14.23, 8.5
Medical8, 22.81, 2.83, 8.5
Surgery3, 8.52, 5.71, 2.8
OPD11, 31.43, 8.52, 5.7
K. pneumoniaeICU8, 25.83, 9.62, 6.4
Medical6, 19.32, 6.43, 9.6
Surgery5, 16.12, 6.41, 3.2
OPD10, 32.21, 3.22, 6.4
P. aeruginosaICU2, 20.02, 20.02, 20.0
Medical1, 10.0 --
Surgery1, 10.02, 20.0 -
OPD1, 10.01, 10.01, 10.0
A. baumanniiICU2, 16.61, 8.31, 8.3
Medical-1, 8.3-
Surgery1, 8.3-
OPD2, 16.61, 8.31, 8.3
E. cloacaeICU2, 40.0--
Medical1, 20.0--
Surgery---
OPD1, 20.01, 20.01, 20.0
Area of residence
E. coliUrban17, 48.56, 17.16, 17.1
Rural11, 31.45, 14.23, 8.5
K. pneumoniaeUrban16, 51.64, 12.95, 16.1
Rural13, 41.94, 12.99.6
P. aeruginosaUrban3, 30.02, 20.02, 20.0
Rural2, 20.03, 30.02, 20.0
A. baumanniiUrban4, 33.31, 8.31, 8.3
Rural1, 8.32, 16.61, 8.3
E. cloacaeUrban3, 60.01, 20.01, 20.0
Rural1, 20.0--
ICU: Intensive care unit. OPD: outpatient department. n: numbers. %: percentage.
Table
Table 6. Number of genes detected against each bacterium.
Table 6. Number of genes detected against each bacterium.
BacteriaGenesDetection (n, %)
E. coliKPC4, 14.2
NDM8, 28.5
CTX8, 28.5
OXA-4811, 39.2
K. pneumoniaeKPC6, 20.6
NDM13, 44.8
CTX7, 24.1
OXA-485, 17.2
P. aeruginosaKPC3, 60
NDM2, 40
CTX1, 20
OXA-482, 40
A. baumanniiKPC2, 40
NDM1, 20
CTX1, 20
OXA-482, 40
E. cloacaeKPC1, 25
NDM1, 25
CTX2, 50
OXA-481, 25
Table
Table 7. Detection with PCR of ESBL and carbapenemases genes.
Table 7. Detection with PCR of ESBL and carbapenemases genes.
Target GenesPrimer NameSequence (5′–3′)Amplicon SizePrimer ConcentrationReference
blaCTXCTX-M
CTX-R		TGGGTAAAATAGGTGACCAGA ATGTGCAGCACCAGTAAGGT6500.1[51]
blaKPCKPC-F
KPC-R		CGTCTAGTTCTGCTGTCTTG
CTTGTCATCCTTGTTAGGCG		7980.5[52]
blaNDM-1NDM-F
NDM-R		GGTTTGGCGATCTGGTTTTC CGGAATGGCTCATCACGATC6210.1[52]
blaOXA-48OXA-48-F
OXA-48-R		GCGTGGTTAAGGATGAACAC CATCAAGTTCAACCCAACCG4380.2[52]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Mustafai, M.M.; Hafeez, M.; Munawar, S.; Basha, S.; Rabaan, A.A.; Halwani, M.A.; Alawfi, A.; Alshengeti, A.; Najim, M.A.; Alwarthan, S.; et al. Prevalence of Carbapenemase and Extended-Spectrum β-Lactamase Producing Enterobacteriaceae: A Cross-Sectional Study. Antibiotics 2023, 12, 148. https://doi.org/10.3390/antibiotics12010148

AMA Style

Mustafai MM, Hafeez M, Munawar S, Basha S, Rabaan AA, Halwani MA, Alawfi A, Alshengeti A, Najim MA, Alwarthan S, et al. Prevalence of Carbapenemase and Extended-Spectrum β-Lactamase Producing Enterobacteriaceae: A Cross-Sectional Study. Antibiotics. 2023; 12(1):148. https://doi.org/10.3390/antibiotics12010148

Chicago/Turabian Style

Mustafai, Muhammad Muqaddas, Mavra Hafeez, Safa Munawar, Sakeenabi Basha, Ali A. Rabaan, Muhammad A. Halwani, Abdulsalam Alawfi, Amer Alshengeti, Mustafa A. Najim, Sara Alwarthan, and et al. 2023. "Prevalence of Carbapenemase and Extended-Spectrum β-Lactamase Producing Enterobacteriaceae: A Cross-Sectional Study" Antibiotics 12, no. 1: 148. https://doi.org/10.3390/antibiotics12010148

APA Style

Mustafai, M. M., Hafeez, M., Munawar, S., Basha, S., Rabaan, A. A., Halwani, M. A., Alawfi, A., Alshengeti, A., Najim, M. A., Alwarthan, S., AlFonaisan, M. K., Almuthree, S. A., Garout, M., & Ahmed, N. (2023). Prevalence of Carbapenemase and Extended-Spectrum β-Lactamase Producing Enterobacteriaceae: A Cross-Sectional Study. Antibiotics, 12(1), 148. https://doi.org/10.3390/antibiotics12010148

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop